A genome sequence specific to gender of eriocheir sinensis and a genetic gender identification method

By designing sex-specific genome sequences and genetic sex identification methods for mud crabs, and using PCR amplification and gel electrophoresis to identify males and females, the problem of identifying genetic sex in sex-controlled breeding of mud crabs has been solved, achieving rapid and accurate sex identification and promoting research on sex regulation.

CN119193794BActive Publication Date: 2026-04-10EAST CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-12
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

Existing technologies for sex control breeding of mud crabs are imperfect, making it difficult to identify the genetic sex of individuals on a large scale and with high accuracy and speed.

Method used

A sex-specific genome sequence and genetic sex identification method for mud crab were designed. PCR amplification was performed using specific primers, and the sex was identified by agarose gel electrophoresis, including female-specific primers and control primers to verify the accuracy of the template.

Benefits of technology

It enables rapid and accurate identification of the genetic sex of individual mud crabs, applicable to sex-controlled breeding and sex determination research, simplifying the sex determination process and reducing costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119193794B_ABST
    Figure CN119193794B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of Scylla paramamosain gender-specific genomic sequences and genetic gender identification method, the gender-specific genomic sequence is as SEQ NO.1 and as SEQ NO.2 shown in sequence;Wherein, genetic gender is female individual genome simultaneously containing SEQ NO.1 and SEQ NO.2 sequence, genetic gender is male individual genome only containing SEQ NO.2 sequence.Simultaneously, the present application also uses the gender-specific sequence to develop the genetic gender identification method based on PCR technology.The present application can be used for the identification of Scylla paramamosain gender-specific large fragment and genetic gender rapid detection, with the advantages of strong specificity, high accuracy, simple operation, low cost etc., can be used for crab sex control breeding industry and gender determination and differentiation mechanism research etc., with wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of sex regulation and genetic sex identification of marine crabs, and particularly relates to a sex-specific genomic sequence of Scylla paramamosain and a genetic sex identification method. BACKGROUND

[0002] Scylla paramamosain belongs to the family of Portunidae in the order of Decapoda in the class of Crustacea, and is widely distributed in the coast of Asia. It is an important economic crab in China, Japan, the Mekong River region, and Vietnam, and is also an important aquaculture invertebrate species in China. In 2020, the artificial breeding of Scylla paramamosain and the marine catch yield reached 140,738 and 71,196 tons, respectively. Due to its high nutritional value, strong tolerance, and convenient transportation, it has a high market value.

[0003] Scylla paramamosain shows obvious sexual dimorphism in body size, growth rate, nutritional value, and gonad development degree, and these traits have high economic value. Compared with females, males often have larger body size, but the growth rate of female crabs of the same size is often faster. Female Scylla paramamosain with mature ovaries and full gonads are favored by the market and have higher economic value. Therefore, gender traits, especially female proportion traits, are important traits for future crab breeding. The current crab sex control breeding technology theory and key technical methods are not perfect, which is a key factor restricting crab sex regulation. SUMMARY

[0004] The technical problem to be solved by the present application is to provide a sex-specific genomic sequence of Scylla paramamosain and a genetic sex identification method, which can accurately and quickly identify the genetic sex of Scylla paramamosain individuals on a large scale.

[0005] The present application provides a sex-specific genomic sequence of Scylla paramamosain, which is the sequence as shown in SEQ NO. 1 and as shown in SEQ NO. 2; wherein the genetic sex of a female individual genome contains both SEQ NO. 1 and SEQ NO. 2 sequences, and the genetic sex of a male individual genome contains only SEQ NO. 2 sequence.

[0006] Further, the indels of the sex-specific genomic sequence are four insertions or deletions that can only be detected in the genome of a female individual, which are a 3bp and an 8bp deletion compared with SEQ NO. 2 sequence, and a 2bp and a 1bp insertion.

[0007] Further, the SNP sites of the gender-specific genomic sequence respectively refer to the SNP sites at positions 154, 175, 192, 231, 246, 251, 252, 270, 284, 326, 359, 377, 387, 388, 390, 416 and 440 of SEQ NO. 1 in the female genome.

[0008] The application further provides a genetic gender identification method for Scylla paramamosain, comprising the following steps:

[0009] (1) Extracting genomic DNA of a Scylla paramamosain individual to be identified: taking a single individual from a Scylla paramamosain embryo or zoea sample; taking one chelae from a mysis stage or early juvenile crab sample; taking 1 ml of blood with an anticoagulant for individuals from which blood can be extracted, and centrifuging at 5000 rpm for 2 minutes to obtain blood cells;

[0010] (2) Using the genomic DNA extracted in step (1) as a template, performing PCR amplification using control primers to obtain a PCR amplification product: wherein the control primers are SEQ1-F: GCTGTGAAGCCAAACAACAAC and SEQ1-R: CCTCTTCTTTACACAGCCTCT.

[0011] (3) Performing agarose gel electrophoresis on the PCR amplification product obtained in step (2) and observing the electrophoresis result; all PCR products have a bright band at 225 bp, and if there is no bright band, the template is problematic and should be removed.

[0012] (4) Performing PCR amplification on the genomic DNA template verified in step (3) using female-specific primers and performing agarose gel electrophoresis; if a bright band appears at 224 bp, it is identified as female, and if there is no bright band at this position, it is identified as male; wherein the female-specific primers are SEQ2-F: CTACTGTGAAGCCAAACAATT and SEQ2-R: TCCTAGCCTCTTCTTGATGTT.

[0013] Preferably, the reaction conditions for PCR amplification in steps (2) and (4) are as follows: pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 30 s, repeating for 30 cycles; finally, extension at 72℃ for 7 min and storage at 4℃.

[0014] Preferably, the reaction system for PCR amplification in steps (2) and (4) is 25 ul, including 12.5 ul of 2x Taq PCR Mix, 9.5 ul of ddH2O, 1 ul of each of the upper and lower primers, and 1 ul of the DNA template. The Taq enzyme needs to use a high-fidelity Taq enzyme with 3' to 5' exonuclease activity.

[0015] Preferably, the female-specific primer can be used to identify the genetic sex of Scylla paramamosain.

[0016] Advantages

[0017] (1) The present application can be used for the identification of gender-specific large fragments of Scylla paramamosain and the rapid detection of the genetic sex of individuals that cannot be determined as male or female or pseudo-male, pseudo-female individuals, has the advantages of strong specificity, high accuracy, simple operation, low cost, etc., can be used in the fields of Scylla paramamosain sex control breeding, sex determination and differentiation mechanism research, and has a broad application prospect.

[0018] (2) The present application designs a female-specific primer suitable for different geographical populations of Scylla paramamosain, a rapid, harmless PCR-based gender verification method, and can be used to distinguish Scylla paramamosain larvae that are difficult to determine gender and pseudo-male, pseudo-female individuals caused by environmental conditions, the identification method is simple and effective; In addition, a pair of control primers are designed to verify the template, avoiding inaccurate gender determination caused by template itself problems, the present application not only expands the method of genetic identification of Scylla paramamosain, but also promotes the research of Scylla paramamosain gender regulation, and lays the foundation for monosex breeding industry. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 Gel electrophoresis results of the identification method according to the present application. DETAILED DESCRIPTION

[0020] The present application will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application. In addition, it should be understood that those skilled in the art can make various modifications or modifications to the present application after reading the content taught by the present application, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

[0021] Example 1

[0022] 1. Sequence acquisition

[0023] Genome resequencing analysis was performed on a total of 218 individuals (108 females and 110 males) from 7 Scylla paramamosain populations, P<1 -10 A total of 1457 gender difference sites were screened and identified, which were characterized by more homozygous in males and more heterozygous in females, indicating that Scylla paramamosain may be of ZW type sex determination. One generation sequencing analysis was performed on the difference of some gender difference sites in female and male individuals, and a female and male difference sequence was discovered, i.e. the sequence as shown in SEQ NO. 1 and the sequence as shown in SEQ NO. 2.

[0024] 2. Primer design

[0025] According to the known DNA sequence and the female-specific SNP site, a primer design software Primer Premier 5.0 is used for design.

[0026] In order to avoid the non-amplified band caused by template problem, resulting in misjudgment of the result, a pair of primers is designed as a control, and the nucleotide sequence is as follows:

[0027] SEQ1-F: GCTGTGAAGCCAAACAACAAC;

[0028] SEQ1-R: CCTCTTCTTTACACAGCCTCT.

[0029] According to the female-specific DNA fragment of Scylla paramamosain as the target sequence, a pair of female-specific primers of Scylla paramamosain is designed, and the nucleotide sequence is as follows:

[0030] SEQ2-F: CTACTGTGAAGCCAAACAATT;

[0031] SEQ2-R: TCCTAGCCTCTTCTTGATGTT.

[0032] 3. Sampling and extraction of genomic DNA

[0033] (1) 20 live Scylla paramamosain of known gender are taken, 10 males and 10 females. Blood cells are taken and stored at -80℃ for standby. (2) The method for extracting the genomic DNA is as follows: single individual is taken for Scylla paramamosain embryo or zoea sample; one chelae is taken for Scylla paramamosain mysis stage or early juvenile crab sample; for individuals that can extract blood, 1ml of blood is taken with anticoagulant, centrifuged at 5000rpm for 2 minutes to obtain blood cells. The sample is used to extract DNA by using animal tissue genomic DNA extraction kit, and the genomic DNA is extracted, diluted to 100ng / μL after concentration determination; and stored at -20℃ refrigerator for standby.

[0034] 4. PCR amplification

[0035] The genomic DNA obtained in step 2 is used as a template for PCR amplification; the reaction system for PCR amplification of Scylla paramamosain is 25ul, including 12.5ul 2×Taq PCR Mix, Taq enzyme needs to use high-fidelity Taq enzyme with 3' to 5' exonuclease activity, 9.5ul ddH2O, 1ul of each of the upper and lower primers, and 1ul of DNA template; the reaction condition for PCR amplification is as follows: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30s, 56℃ annealing for 30s, 72℃ extension for 30s, repeating for 30 cycles; finally, 72℃ extension for 7min, and 4℃ storage.

[0036] 5. Detection of PCR products by agarose gel electrophoresis

[0037] (1) Agarose gel electrophoresis: Prepare 1.5% agarose gel, take 5 μL of 2K DNA Marker when loading samples, take 5 μL of each sample to be tested, add 1 μL of 6× loading buffer, and the electrophoresis conditions are: voltage 180V, time 20-25min.

[0038] (2) Gel imaging: After electrophoresis, the agarose gel is placed in a gel imaging instrument, and after setting appropriate parameters, it is exposed and photographed.

[0039] 6. Interpretation of electrophoresis results

[0040] The effectiveness of primers can be judged by the presence or absence of specific bands. For example... Figure 1 As shown, M is a 2kbp DNA marker, and the bands from top to bottom are 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp. The control primer showed a bright band in both male and female individuals; the female-specific primer showed a relatively bright band in genetically female individuals, but no band was observed in genetically male individuals.

Claims

1. A method for genetic sex identification of Scylla paramamosain, comprising the following steps: (1) extracting genomic DNA of Scylla paramamosain to be identified: for Scylla paramamosain embryo or zoea sample, taking a single individual; for mysis stage or early juvenile sample, taking a cheliped; for individual from which blood can be extracted, taking blood with anticoagulant, centrifuging, and obtaining blood cells; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using control primers to obtain a PCR amplification product: wherein, the control primer is: SEQ1-F: GCTGTGAAGCCAAACAACAAC; SEQ1-R: CCTCTTCTTTACACAGCCTCT; (3) performing agarose gel electrophoresis on the PCR amplification product obtained in step (2), and observing the electrophoresis result; all PCR products have a bright band at 225 bp, if there is no bright band, the template has a problem and should be removed; (4) using female-specific primers to perform PCR amplification on the genomic DNA template verified in step (3), and performing agarose gel electrophoresis; if a bright band appears at 224 bp, it is identified as female, if there is no bright band at this position, it is identified as male; wherein the female-specific primer is: SEQ2-F: CTACTGTGAAGCCAAACAATT; SEQ2-R: TCCTAGCCTCTTCTTGATGTT.

2. The method of genetic sexing according to claim 1, wherein: The reaction conditions of PCR amplification in steps (2) and (4) are as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, repeating for 30 cycles; finally, 72℃ extension for 7 min, and 4℃ preservation.

Citation Information

Patent Citations

  • SNP sites for sex determination of Scylla paramamosain and identification method thereof

    CN106939343A

  • A PCR-based rapid genetic sex identification method for Scylla Paramamosain

    CN108570494A