A specific DNA fragment, identification primers, and applications for sex identification in the longfin brevicornu.

Abstract

This invention discloses a specific DNA fragment, primers, and applications for sex identification of the longfin sclerotium. PCR amplification and agarose gel electrophoresis were performed using PCR primers. The results showed that individuals with a specific 271bp band were male, while those without a band were female. This invention discloses a molecular marker, primers, and identification method for sexing the longfin sclerotium. Sexing can be determined by taking fin rays without killing the fish; it can also identify the sex of juvenile fish whose sex cannot be determined by appearance. It has advantages such as accuracy, simplicity, speed, and minimal harm to the fish, providing important assistance for the conservation of wild longfin sclerotium resources and the development of the aquaculture industry.

Description

Technical Field

[0001] This invention relates to the field of fish genetic sex identification technology, specifically to a specific DNA fragment, primer, and identification method for sex identification of the longfin brevicornu. Background Technology

[0002] The longfin scaly fish (Acrossocheilus longipinnis) belongs to the order Cypriniformes, family Cyprin idae, subfamily Barbinae, and genus Acrossocheilus. It is a rare stream-dwelling fish endemic to the Hongshui River basin. It has five vertical transverse bands on its sides, and its dorsal fin has an elongated, filamentous terminal unbranched fin ray and the first branched fin ray, making it valuable for both its ornamental and economic purposes. However, due to the development of cascade hydropower projects in the Hongshui River, habitat fragmentation, and overfishing, its wild population has declined sharply, and it has been listed as a vulnerable species (VU) in urgent need of protection. Before sexual maturity, the longfin scaly fish lacks obvious secondary sexual characteristics, making it impossible to distinguish males and females morphologically in the early stages of development.

[0003] Currently, the traditional method involves raising longfin lanceolate fish to sexual maturity, then squeezing their abdomens to observe sperm and egg release to determine their sex. This method is time-consuming, inefficient, and limited by the developmental stage, severely impacting the artificial breeding and wild population conservation of longfin lanceolate fish. Therefore, providing a specific DNA fragment, primers, and identification method for sex determination in longfin lanceolate fish is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0004] This invention provides a specific DNA fragment for sex identification of the longfin brevicornu, as shown in SEQ ID NO.3. This fragment is located on the Y chromosome and can specifically identify male longfin brevicornu.

[0005] This invention provides a reagent for detecting specific DNA fragments for sex identification in the longfin brook.

[0006] The final object of the present invention is to provide the application of a reagent for detecting specific DNA fragments for sex identification of the longfin brook, including for sex identification or breeding of the longfin brook.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] The applicant constructed sequencing libraries from the whole-genome DNA of male and female *Gymnocypris lanceolatus*, performed 2b-RAD sequencing on an Illumina sequencing platform, and selected one male and one female for whole-genome survey sequencing to obtain reference sequences. Comparative genomic analysis of the tag sequences from male and female individuals yielded a sex-specific DNA fragment tag sequence, a male-specific DNA tag sequence, as shown in SEQ ID NO.3. No homologous sequences were found by comparison with the GenBank database.

[0009] The scope of protection of this invention also includes:

[0010] A reagent for detecting a specific DNA fragment for sex identification in the longfin brook, wherein the specific DNA fragment is shown in SEQ ID NO.3.

[0011] The reagents described above are preferably primers.

[0012] The reagents described above preferably use primers GCY-F: 5'-CTGTTTTCCTATGCTGTGTATCAATTACC A-3' and GCY-R: 5'-TCTTGTCGCTGTCATTCTGTCGCA-3'.

[0013] Application of reagents for detecting specific DNA fragments for sex identification in *Scleroderma longfinense*. Specifically, the application process includes:

[0014] The genomic DNA of the longfin sclerotium was detected using reagents. If the reagents detected the presence of the polynucleotide shown in SEQ ID NO.3 in the DNA of the longfin sclerotium, the longfin sclerotium was determined to be male; if the polynucleotide shown in SEQ ID NO.3 was not detected, the longfin sclerotium was determined to be female.

[0015] Application of reagents for detecting specific DNA fragments for sex identification in the preparation of sex detection kits for the longfin brook.

[0016] Application of reagents for detecting specific DNA fragments for sex identification in *Lymnocypris lanceolatus* in *Lymnocypris lanceolatus* breeding.

[0017] Compared with the prior art, the present invention has the following advantages:

[0018] This invention discloses a specific DNA fragment, identification primers, and applications for sex identification of the longfin lanceolate fish. Sex can be determined by taking any tissue (preferably fin rays) of the longfin lanceolate fish without killing it; simultaneously, sex can be identified in juvenile fish that have not yet reached gonadal maturity. The PCR primers disclosed in this invention can be used for genetic sex identification of the longfin lanceolate fish using conventional PCR amplification and agarose gel electrophoresis; it has the advantages of accuracy, simplicity, speed, and minimal harm to the fish, providing assistance for the protection of wild longfin lanceolate fish resources and the development of the aquaculture industry. Attached Figure Description

[0019] Figure 1 This is a gel electrophoresis image used in the present invention to identify the sex of the longfin brevicornu.

[0020] Among them, M:DL2000; 1-9, 19-26, and 35-43 are male longfin brevicornuate samples; 10-18 and 27-34 are female longfin brevicornuate samples. Detailed Implementation

[0021] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the technical solutions described in the present invention are conventional solutions in the art, and the reagents or materials, unless otherwise specified, are all from commercial channels.

[0022] Example 1:

[0023] Obtaining specific DNA fragments for sex identification in the longfin brevicornu

[0024] During the breeding season, ten male and ten female *Gymnocypris lanceolatus* were identified through artificial egg extraction and gonadal observation. Their caudal fins were harvested, and their whole-genome DNA was extracted. The target genome was digested with BsaXI and SapI enzymes to construct a sequencing library. 2b-RAD sequencing was performed on an Illumina sequencing platform. One male and one female were selected for whole-genome survey sequencing to obtain reference sequences. Comparative genomic analysis of the tag sequences of males and females yielded sex-specific DNA fragment tag sequences. Primers were designed at both ends based on the position of the tag sequences in the genome survey to verify population validity. Finally, a male-specific DNA tag sequence was obtained, as shown in SEQ ID NO. 3. No homologous sequences were found by comparison with the GenBank database.

[0025] The detection primers designed for the above-mentioned male-specific DNA tag sequences are as follows:

[0026] GCY-F: 5'-CTGTTTTCCTATGCTGTGTATCAATTACCA-3'(SEQ ID NO.1)

[0027] GCY-R: 5'-TCTTTGTCGCTGTCATTCTGTCGCA-3'(SEQ ID NO.2)

[0028] Example 2:

[0029] Methods for sex determination of *Symplocos lanceolatus* using specific DNA fragment detection primers:

[0030] (1) Extract genomic DNA from the longfin bryo-like fish to be tested;

[0031] (2) PCR amplification

[0032] DNA polymerase: 2×TSINGKE Master Mix (Blue) (purchased from Beijing Qingke Biotechnology Co., Ltd., product number: Cat.TSE004);

[0033] The PCR reaction system is as follows:

[0034]

[0035] The PCR reaction conditions are as follows:

[0036]

[0037]

[0038] (3) Judgment method:

[0039] The longfin brevicornu exhibits an XY sex determination type, meaning males contain a Y chromosome (XY chromosome type), while females do not contain a Y chromosome (XX sex chromosome type). Males are determined by whether they can amplify a Y chromosome.

[0040] The reaction products were subjected to agarose gel electrophoresis at a gel concentration of 1%, a voltage of 220V, and a time of 20 min. Products exhibiting only a 271bp specific band were male, while those without a specific fragment were female. The DNA fragment with the amplified 271bp specific band is shown in SEQ ID NO.3, as follows:

[0041] CTGTTTTCCTATGCTGTGTATCAATTACCATAATATAATTATAAAGCATTAAATAAAGCATTTTTTTTCTTATTATAATGAAACGTTGCAGGCCTTCGCATGATCTAACAAGGAGCAGTTGTATTTGATTAACTAATGTTAACAAGGTAGGATTCATAAATAGTGTAACAAATGTATTGTTGATGAGAATCAGAAAGAGCTTTATTGCCAGGCATTTGTTTTAGTGACAGAAGCTCCAGAG TGCGACAGAATGACAGCGACAAGA .

[0042] Example 3:

[0043] Application of primers for detecting specific DNA fragments in sex determination of *Sclerodermus longfinnis*:

[0044] (1) Seventeen female and 26 male longfin ray culter fish whose sex was confirmed by paraffin section were collected. Fin tissue samples were collected and preserved in anhydrous ethanol. Genomic DNA was extracted using a DNA extraction kit, diluted to 50 ng / μl and stored at -20℃ for later use. The collected samples included wild samples.

[0045] (2) The above genomic DNA was amplified using the method of Example 2 and subjected to agarose gel electrophoresis. The DL2000 DNA Marker consists of 6 DNA fragments, namely 2,000bp, 1,000bp, 750bp, 500bp, 250bp and 100bp.

[0046] The results are as follows:

[0047] The sex of the samples was determined by examining the gonads through paraffin sections: samples 1-9, 19-26, and 35-43 were male longfin brevicornuate samples; samples 10-18 and 27-34 were female longfin brevicornuate samples.

[0048] Electrophoresis results of PCR products are shown below Figure 1 The lane numbers in the diagram match the sample numbers.

[0049] Only a 271bp specific band indicates males, while the absence of any band indicates females; this is consistent with the results of gonadal identification through paraffin section examination after dissection. This indicates that the male-specific primer screened in this invention can achieve the purpose of identifying the sex of the longfin brevicornu.

[0050] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A specific DNA fragment for sex identification of longfin yellowbelly dace, wherein the sequence of the DNA fragment is shown as SEQ ID NO.

3. 2.A primer for detecting the DNA fragment of claim 1, wherein the primer is GCY-F: 5'-CTGTTTTCCTATGCTGTGTATCAATTACCA-3' and GCY-R: 5'-TCTTGTCGCTGTCATTCTGTCGCA-3'. 3.The primer of claim 2 is applied in sex identification of longfin yellowbelly dace. 4.The application of claim 3, wherein the application process comprises: detecting the genomic DNA of longfin yellowbelly dace by using the primer, if the primer detects the polynucleotide shown as SEQ ID NO. 3 in the DNA of longfin yellowbelly dace, it is determined that the longfin yellowbelly dace is male; if the polynucleotide shown as SEQ ID NO. 3 is not detected, it is determined that the longfin yellowbelly dace is female. 5.The primer of claim 2 is applied in preparation of a sex detection kit for longfin yellowbelly dace. 6.The primer of claim 2 is applied in male breeding of longfin yellowbelly dace. ​

Images