Application of SNP (Single Nucleotide Polymorphism) molecular marker related to character of live litter size of pig

Abstract

The invention belongs to the technical field of pig molecular marker-assisted selection, and particularly relates to application of an SNP molecular marker related to the character of the number of live piglets born by pigs. The SNP molecular marker is a basic group of a 32663785th site of a ninth chromosome in a pig genome Sscrofa11.1. 109, the SNP site of the molecular marker has C / T polymorphism, and T is a favorable allelic variation of the character of the number of live piglets born by a pig. The dominant alleles of the SNP are preferably selected, the frequency of the dominant alleles can be increased generation by generation, the number of live piglets of pigs is increased, and the genetic improvement progress of the pigs is accelerated, so that the breeding and production benefits of the pigs are effectively improved.

Description

Technical Field

[0001] This invention relates to the field of marker-assisted selection technology for pigs, and particularly to the application of a SNP molecular marker related to the trait of pig litter size. Background Technology

[0002] Improving the number of live piglets produced is a crucial research area in pig farming, significantly impacting livestock economics and breeding efficiency. As a core indicator of pig reproductive performance, the number of live piglets produced directly relates to farming costs, the number of litters per sow per year, and piglet survival rate. Industry statistics show that for every additional live piglet produced, the annual profit per sow increases, with large-scale farms seeing a 15%-20% increase in economic benefits. However, due to the complexity of genetics and the interaction of environmental factors, improving the number of live piglets produced remains a significant challenge.

[0003] The main measures to improve the number of live piglets produced in pigs include traditional breeding techniques and optimization of feeding management. Phenotypic selection (such as the number of litters per sow per year and the average number of live piglets per litter) is a conventional method for breeding pigs. However, this method relies on long-term production data accumulation and has significant drawbacks: (1) Phenotypic selection can only be evaluated after sows reach sexual maturity and complete reproduction, which usually takes 3-5 years, resulting in a long breeding cycle; (2) Reproductive traits are easily affected by environmental factors such as feeding management and disease control, leading to slow and unstable genetic progress; (3) Traditional breeding cannot directly link gene loci related to molecular mechanisms such as embryo survival and sow lactation capacity, resulting in limited breeding accuracy. Improving the nutritional supply of pregnant sows (such as adding amino acids and vitamins), optimizing the farrowing environment, and postpartum care measures can partially increase the number of live piglets produced. However, such measures have limited benefits for sows with low genetic potential, and the overall improvement potential is small.

[0004] The rapid development of genomics technology in recent years has made it possible to explore the core genes and molecular mechanisms regulating live piglet count. Molecular marker-assisted breeding utilizes the close linkage between molecular markers and target trait genes. By detecting molecular markers, the presence of the target gene can be detected, achieving the goal of selecting for the target trait. It has the advantages of being rapid, accurate, and unaffected by environmental conditions. Single nucleotide polymorphisms (SNPs) are a type of molecular marker, referring to changes in DNA sequence caused by variations in a single nucleotide at the same location in the genome between individuals. These changes can subsequently affect gene expression, transcriptional activity, and splicing modifications. Screening for genes and SNPs related to the live piglet count trait in pigs, combined with marker-assisted breeding methods, provides an efficient tool for early selection of pigs and rapid screening of highly fertile sows. Summary of the Invention

[0005] The purpose of this invention is to provide a SNP molecular marker associated with the number of live piglets produced in pigs, so as to provide guidance for the detection of the number of live piglets produced in pigs or for molecular marker-assisted breeding.

[0006] The technical solution of the present invention is as follows:

[0007] This invention provides a porcine SNP molecular marker located at the base position 32663785 on chromosome 9 in the porcine genome Sscrofa11.1.109. The SNP site of this molecular marker exhibits C / T polymorphism, where T is a favorable allele variation for increasing the number of live piglets produced in pigs.

[0008] The porcine SNP molecular marker and the substance for detecting the porcine SNP molecular marker may be used in any of the following ways:

[0009] Used for detecting or assisting in the detection of the live piglet count trait;

[0010] Genetic breeding used to improve the live piglet count trait;

[0011] Preferably, the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1.

[0012] In this invention, the substance for detecting porcine SNP molecular markers includes PCR primers for amplifying genomic DNA fragments, including the SNP sites, or a kit containing the primers.

[0013] Preferably, the nucleotide sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0014] Preferably, the kit also includes PCR amplification reagents.

[0015] The present invention also provides a method for detecting the number of live piglets produced in pigs, comprising: detecting the base type at position 32663785 on chromosome 9 of the pig genome, and finding that the TC and CC genotype populations produce fewer live piglets than the TT genotype population.

[0016] Preferably, the method for detecting the base type at position 32663785 on chromosome 9 of the pig genome includes: designing primers to amplify the nucleotide sequence shown in SEQ ID NO.1, using the primers to perform PCR amplification on pig genomic DNA, and detecting the genotype at position 156 in the gene sequence of the amplified product.

[0017] Further optimization was performed using Sanger sequencing to obtain the genotype at the 9:32663785C>T locus.

[0018] This invention also provides a genetic breeding method for increasing the number of live piglets produced in pigs, comprising: determining the base type at locus 32663785 on chromosome 9 of breeding pigs in the core pig population, and making corresponding selections based on the base type:

[0019] In the breeding of pigs, individuals with the TT and TC bases at the 32663785th locus on chromosome 9 are selected, while CC-type individuals are eliminated, in order to increase the frequency of the T gene at this locus in each generation, thereby increasing the number of live piglets produced in the offspring.

[0020] Preferably, the base at position 32663785 of the pig chromosome 9 is shown as the 156th bp of the sequence shown in SEQ ID NO.1.

[0021] The beneficial effects of this invention are:

[0022] This invention studies and identifies SNP molecular markers that affect the number of live piglets produced in pigs. Using these molecular markers for early marker-assisted selection can accelerate the process of pig breed selection.

[0023] This invention predicts the number of live piglets produced in pigs by detecting the base types at the SNP sites of the molecular markers. The TC and TT genotype populations produce more live piglets than the CC genotype population. By applying primers to amplify the molecular markers affecting the number of live piglets produced, an efficient and accurate molecular marker-assisted breeding technology for pigs is established. Applying this technology to pig breeding allows for the selection of piglets with superior live piglet production traits and the timely culling of inferior piglets, thereby increasing the number of piglets produced and improving the reproductive efficiency of pig farms. Attached Figure Description

[0024] Figure 1 Manhattan plot (left) and QQ plot (right) for GWAS of live piglet production.

[0025] Figure 2 The graph shows the association between different SNP molecular marker genotypes and the number of live offspring.

[0026] Figure 3 The Sanger sequencing result is for the 9:32663785C>T site. Detailed Implementation

[0027] This invention involves whole-genome resequencing of pig genomic DNA, comparing the resequencing data with the pig reference genome (Sscrofa11.1.109), obtaining all high-quality SNPs on the genome, and analyzing the correlation between each locus and the live piglet number trait to obtain a molecular marker associated with the live piglet number trait. The SNP molecular marker is located at the base position 32663785 on chromosome 9 in the pig genome Sscrofa11.1.109. The SNP site of this molecular marker has C / T polymorphism, where T is the favorable allele variation of the live piglet number trait.

[0028] The nucleotide sequence of the SNP molecular marker of this invention is shown in SEQ ID NO:1:

[0029] CCTTTGGCTGCTCGAAGAATTACTGGGACGTATAGAAAGGCTGGAGAAGCCTGCTCTCCACTCATGAGGAGTGTGCAGGTGTTAGCTTGCCACCAGGCAGAGCAAAGAAAGGTCTGCCCTAGTGGCTGTGAC CTTACTATTCTCCCCAGTTAGAGCAGAGTAAACATCAGTACCCCCTCACTCCAGACCACAGCTTAGCACTGGATCTAGGGTGGCAAGGTCCTGGGAAAAGATTCAGTCTAGGGATGCAAAGTCAACAA(SEQ ID NO.1).

[0030] The 9:32663785C>T site is located at position 156 from the 5' end of SEQ ID NO.1. The C / T polymorphism at this site is significantly associated with the number of live piglets born. The number of live piglets born to individuals with the CC genotype is significantly lower than that of individuals with the TC genotype (P<0.01), the number of live piglets born to individuals with the TC genotype is significantly lower than that of individuals with the TT genotype (P<0.01), and the number of live piglets born to individuals with the CC genotype is significantly lower than that of individuals with the TT genotype (P<0.001).

[0031] This invention provides substances for detecting the porcine SNP molecular marker, including PCR primers for amplifying genomic DNA fragments including the SNP sites, or a kit containing the primers. The primers for amplifying the SNP molecular marker of this invention include upstream primer F: 5'-CCTTTGGCTGCTCGAAGAATTAC-3' (SEQ ID NO. 2) and downstream primer R: 5'-TTGTTGACTTTGCATCCCTAGACTG-3' (SEQ ID NO. 3). The kit also includes PCR amplification reagents.

[0032] In this invention, the preferred PCR amplification reagent is 2×Taq Master Mix (Dye). 2Taq Master Mix (Dye) is prepared by pre-mixing Taq DNA polymerase, dNTP mixture, MgCl2 and reaction buffer into a mixture of 2 times concentration and then optimizing the ratio. It has good amplification efficiency and high detection sensitivity.

[0033] The above-described primer set was used to amplify porcine genomic DNA by PCR. As one implementation method, the PCR amplification program consisted of 34 cycles: pre-denaturation at 94°C for 1 min, followed by denaturation at 98°C for 10 s, annealing at 60°C for 15 s, extension at 72°C for 45 s, and a final extension at 72°C for 5 min. The obtained amplified products were sequenced to detect the genotype at the 9:32663785C>T locus.

[0034] The criteria for judging the quality of a pig's live piglet count are:

[0035] If the genotype at the 9:32663785C>T locus is TT, the pig will produce a large number of live piglets.

[0036] If the genotype at the 9:32663785C>T locus is TC, the pig will have a moderate number of live piglets.

[0037] If the genotype of the 9:32663785C>T locus is CC, the pig will have a low number of live piglets.

[0038] This invention does not specifically limit the sequencing method; any sequencing method known in the art can be used. In this embodiment, Sanger sequencing is used to determine the amplified DNA sequence. As one implementation method, DNA sequencing is performed at Aoke (Wuhan) Biotechnology Co., Ltd., with two reactions for gene fragment sequencing. This invention determines the quality of the live piglet production trait in pigs based on the base type at position 156 from the 5' end of the sequence, thereby enabling the detection and optimization of the live piglet production trait through genetic breeding.

[0039] The SNP molecular markers of this invention can be applied to association analysis of genotypes related to the number of live piglets produced in pigs or traits related to the number of live piglets produced in pigs, providing a new molecular marker resource for marker-assisted selection of pig reproductive performance.

[0040] The technical solution of the present invention will now be described in more detail with reference to the embodiments and accompanying drawings. Obviously, the described embodiments are merely some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0041] The reagents and consumables used in this invention are all commercially available products that can be purchased from the market.

[0042] The following uses the Eqing Black Pig as an example to illustrate the technical solution of this invention, but it is not intended to limit the technical solution of this invention. Those skilled in the art can apply the technical solution of this invention to other pig breeds to detect and optimize the breeding of pigs with high live piglet count, which also falls within the protection scope of this invention.

[0043] Example 1

[0044] Screening for molecular markers associated with live piglet count

[0045] (1) Data collection on reproductive traits of Eqing Black Pig

[0046] We selected 244 female Eqing Black Pigs from Qingping Breeding Pig Farm in Dangyang City, Hubei Province, and collected data on their live piglet count.

[0047] (2) Sample collection and genomic DNA extraction of Eqing black pigs

[0048] Ear or tail tissues from the above-mentioned Eqing Black Pig sows were collected using ear-tapping forceps and placed in 1.5 mL centrifuge tubes containing 75% alcohol, then stored at -20°C. Genomic DNA was extracted from the samples using a universal column-type genomic DNA extraction kit from Kangwei Century, following the manufacturer's instructions. After passing quality control, the samples were stored at -20°C.

[0049] (3) Quality control of whole genome resequencing and SNP detection

[0050] Samples that passed quality control were used to construct sequencing libraries using the YZSeq Tn5 Library Prep Kit. After library construction, quality control was performed, and samples that passed were sequenced on the DNBSEQ-T7B platform to obtain raw reads. The results were stored in fastq file format.

[0051] The raw data was filtered using FASP software: adapter sequences were removed; reads with more than 3% N bases were removed; reads shorter than 30 bases were removed; and reads with more than 40% low-quality bases (quality value less than 15) were removed. The final result was clean data that met the requirements for data analysis.

[0052] Clean reads were aligned to the pig reference genome (Sscrofa11.1.109) using BWA software. The alignment results were output as a SAM file. The SAM file was compressed, sorted, and duplicate reads were removed using Sambamba software. SNP sites were detected in the sorted and deduplicated BAM file using Sentieon software.

[0053] SNPs were filtered using BCFtools software with the following parameters: QUAL < 30.0 || QD < 2.0 || FS > 60.0 || MQ < 40.0 || SOR > 4.0 || ReadPosRankSum < -8.0. VCFtools was then used for quality control: variants with a deletion rate higher than 0.5% were removed; variants with sequencing depths less than 3 and greater than 100 were removed; variants with 2 alleles were retained. Plink 2.0 was then used for even stricter quality control of the VCFtools output files, with the following conditions: retaining autosomal variants; filtering out variants with a minimum allele frequency less than 5%; filtering out variants with a deletion rate higher than 10%; and filtering out variants that did not conform to Hardy-Weinberg equilibrium. Finally, 13,899,481 high-quality SNPs were obtained for subsequent analysis.

[0054] (4) GWAS analysis

[0055] GWAS analysis was performed on the live piglet number (NBA) trait of Eqing Black Pig using the MLM model of rMVP software, generating Manhattan plots and QQ plots. Figure 1 Using P = 2.48e-06 as the threshold for significant SNP sites, we obtained SNP sites that were significantly associated with the number of live piglets produced by Eqing Black Pig.

[0056] Example 2

[0057] Association analysis of different genotypes of significant SNPs with the number of live offspring

[0058] For significant SNPs identified by GWAS, genotypic data of the C>T mutation site at position 32663785 on chromosome 9 of each Eqing Black pig were extracted using Plink software. Individuals with the same genotype were grouped together, and the influence of different genotypes on the phenotype was detected using a one-way ANOVA test in SPSS 26.0 software. Statistical data are expressed as mean ± standard deviation, * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001. Finally, GraphPadPrism 8 software was used for plotting.

[0059] The results show ( Figure 2(or Table 1) The mutation at the 9:32663785C>T site leads to an increase in the number of live piglets born in Eqing Black Pigs. The average number of live piglets born for the wild CC genotype, the heterozygous TC mutant genotype, and the homozygous TT mutant genotype were 8.89, 9.83, and 11.61, respectively. The heterozygous TC genotype was significantly higher than the wild CC genotype (P<0.01), and the homozygous TT genotype was significantly higher than both the wild CC genotype and the heterozygous TC genotype (P<0.01). Therefore, this mutation is beneficial to the number of live piglets born. Both the TC and TT mutant genotypes are favorable alleles, and selection of individuals with this mutation should be strengthened during breeding.

[0060] Table 19: Association analysis between different genotypes at the 32663785C>T locus and the number of live offspring.

[0061] genotype Number of individuals Number of live offspring (heads) Comparison group P-value CC 131 8.89±2.34 CCvsTC 0.003** TC 84 9.83±2.05 TCvsTT 0.004** TT 16 11.61±2.72 CCvsTT 0.0001***

[0062] Example 3

[0063] Validation of polymorphic sites

[0064] To verify the authenticity and reliability of the SNP loci obtained from high-throughput sequencing, rather than being caused by sequencing errors, six sows were selected as samples and labeled as 1-6. The number of live piglets born in each litter during the entire reproductive cycle of these sows was recorded. The DNA sequence of these sow samples was extracted, and the genotype of the 9:32663785C>T locus was subjected to Sanger sequencing.

[0065] 1. Primer Design: The "subseq" parameter of the seqtk software was used to extract 500 bp of sequence information upstream and downstream of the 9:32663785 locus. Based on the extracted 1000 bp DNA sequence, primers were designed using Primer Premier 5.0 software.

[0066] F: CCTTTGGCTGCTCGAAGAATTAC;

[0067] R:TTGTTGACTTTGCATCCCTAGACTG;

[0068] The primer amplification sequence information is as follows, where the 9:32663785C>T site is located at position 156 from the 5' end of the sequence and is marked in bold. The underlined part is the corresponding sequence of the primer.

[0069]

[0070] 2. PCR amplification: Add 1 μL of DNA template, 8 μL of double-distilled water, 10 μL of 2×Es Taq MasterMix (Dye), and 0.5 μL of each primer to a 20 μL system.

[0071] The PCR reaction conditions were as follows: 94℃ pre-denaturation for 1 min, followed by 98℃ denaturation for 10 s, 60℃ annealing for 15 s, 72℃ extension for 45 s, for 34 cycles, and a final extension at 72℃ for 5 min.

[0072] 3. Sanger Sequencing: The DNA amplification products were sequenced at Aoke (Wuhan) Biotechnology Co., Ltd., with two sequencing reactions for each gene fragment. The obtained sequences were compared with the pig reference genome (Sscrofa11.1.109) in the Ensembl genome to determine the mutation status of the corresponding SNP sites.

[0073] Table 2. Live piglet count and genotype of the 9:32663785C>T locus in the sample pigs.

[0074] Sample number Number of live offspring (feet) genotype 1 9 CC 2 9.6 CC 3 10.4 TC 4 11.86 TC 5 13 TT 6 12 TT

[0075] Sequencing results as follows Figure 3 As shown, where Figure 3 In the sample, A and B are CC genotype samples, C and D are TC genotype samples, and E and F are TT genotype samples, all of which match the live piglet number trait of the tested pigs.

[0076] In summary, the SNP molecular markers related to the average number of live piglets produced by pigs provided by this invention can be used to identify the number of live piglets produced by pigs based on genotype, enabling early selection and accelerating the breeding process.

[0077] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of a porcine SNP molecular marker or a substance for detecting said porcine SNP molecular marker in any of the following aspects, characterized in that, Used for detecting or assisting in the detection of the live piglet count trait; Genetic breeding used to increase the number of live piglets produced; The SNP molecular marker is located at position 32663785 on chromosome 9 in the pig reference genome Sscrofa11.1.

109. The SNP site of this molecular marker has C / T polymorphism, where T is a favorable allele variation for the number of live piglets produced.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.

1.

3. The application according to claim 1, characterized in that, The substance for detecting porcine SNP molecular markers includes PCR primers for amplifying genomic DNA fragments, including the SNP sites, or a kit containing the primers.

4. The application according to claim 3, characterized in that, The nucleotide sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.

3.

5. The application according to claim 3, characterized in that, The kit also includes PCR amplification reagents.

6. A method for detecting the number of live piglets produced in pigs, characterized in that, The base type at locus 32663785 on chromosome 9 of the pig genome was detected. The TC and CC genotype populations had fewer live piglets than the TT genotype population.

7. The method according to claim 6, characterized in that, A method for detecting the base type at position 32663785 on chromosome 9 of the pig genome includes: designing primers to amplify the nucleotide sequence shown in SEQ ID NO.1, using the primers to perform PCR amplification of pig genomic DNA, and detecting the genotype at position 156 in the gene sequence of the amplified product.

8. The method according to claim 7, characterized in that, The genotype of the 9:32663785C>T locus was obtained using Sanger sequencing.

9. A genetic breeding method for increasing the number of live piglets produced, characterized in that, Determine the base type at locus 32663785 on chromosome 9 of breeding pigs in the core pig herd, and make corresponding selections based on this base type: In the breeding of pigs, individuals with the TT and TC bases at the 32663785 locus on chromosome 9 are selected, while CC-type individuals are eliminated. This process aims to increase the frequency of the T gene at this locus in each generation, thereby increasing the number of live piglets produced in offspring.

10. The method according to claim 9, characterized in that, The bases at position 32663785 on the pig's chromosome 9 are shown as the 156th bp in the sequence shown in SEQ ID NO.1.

Images