Primer probe group, kit and method for identifying 12bp insertion / deletion polymorphic site of intron region of bovine prion protein gene

Abstract

The invention provides a primer probe group, a kit and a method for identifying 12bp insertion / deletion polymorphic sites of an intron region of a bovine prion protein gene, and belongs to the technical field of gene detection. The primer probe group comprises 12 to mF1 as shown in SEQ ID NO: 2, 12 to mR2 as shown in SEQ ID NO: 4, 12 to IP1 as shown in SEQ ID NO: 6 and 12 to DP1 as shown in SEQ ID NO: 7, and a nucleotide sequence of an intron region 12bp is as shown in SEQ ID NO: 1. The primer probe group can specifically detect the 12bp insertion / deletion polymorphism of the bovine PRNP intron region, and provides a scientific basis for bovine genotype identification and mad bovine disease susceptibility risk assessment.

Description

Technical Field

[0001] This invention belongs to the field of gene detection technology, and in particular relates to a primer and probe set, kit and method for identifying 12bp insertion / deletion polymorphic sites in the intron region of bovine prion protein gene. Background Technology

[0002] Bovine spongiform encephalopathy (BSE), commonly known as "mad cow disease," is a fatal neurodegenerative disease caused by spatial structural variations of prion proteins (PrP). Animal prion proteins are encoded by the prion protein gene (PRNP), and the genetic polymorphism of this gene directly affects the susceptibility of cattle to BSE by influencing the expression level and conformational stability of prion proteins. Studies have shown that individuals carrying the 12bp deletion allele in the intron region of the PRNP gene (regardless of heterozygosity or homozygosity) have a significantly increased risk of BSE, while those carrying the insertion allele exhibit stronger resistance. Therefore, PRNP genotyping can be used to assess bovine susceptibility to BSE, effectively monitoring herd health and the safety of bovine products. It also provides a new approach for large-scale screening of disease-resistant breeding cattle, promoting progress in disease-resistant breeding and providing a scientific basis for ensuring livestock safety.

[0003] Current methods for detecting insertion / deletion polymorphic sites in bovine PRNPs (such as Sanger sequencing, PCR-RFLP, and high-throughput sequencing) generally suffer from limitations such as high cost, cumbersome operation, and long cycle time. For example, while Sanger sequencing is the "gold standard" and can accurately resolve sequences, it suffers from interpretation errors due to peak overlap and high cost; PCR-RFLP is prone to false negative results due to incomplete enzyme digestion; and although high-throughput sequencing can achieve parallel analysis of multiple targets, its expensive equipment investment and high technical requirements limit its widespread application in grassroots laboratories and livestock enterprises. To address these limitations, there is an urgent need to develop new identification methods that are simple, rapid, and suitable for widespread application.

[0004] Multienzyme isothermal rapid amplification (MIRA) is a novel isothermal amplification technique developed in recent years based on recombinase polymerase amplification (RPA). Through optimization of its reaction enzyme system, MIRA exhibits higher amplification efficiency and detection sensitivity. This technology can unwind the DNA double-strand template at a constant temperature, achieving rapid amplification of the target fragment. MIRA-LFD technology is a visual gene detection method that combines MIRA with lateral flow dipsticks (LFD). The detection results form colored bands on the dipstick, providing a direct, visible result. The entire process requires no complex equipment and is easy to promote and apply.

[0005] Existing technologies do not disclose the use of MIRA-LFD for PRNP genotyping. Therefore, this invention is proposed. Summary of the Invention

[0006] In view of this, the purpose of this invention is to provide a primer and probe set, kit, and method for identifying 12bp insertion / deletion polymorphism sites in the intron region of the bovine prion gene, to construct a MIRA-LFD-based detection system for 12bp insertion / deletion polymorphism sites, to design and optimize a specific primer and probe set, to establish a method for detecting 12bp polymorphic genotypes of the bovine PRNP gene, to further improve detection efficiency, to enrich existing detection methods, and to provide feasible technical support for cattle individual screening on farms.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0008] This invention provides a primer and probe set for identifying 12bp insertion / deletion polymorphism sites in the intron region of the bovine prion protein gene. The primer and probe set includes an upstream primer 12-mF1, a downstream primer 12-mR2, an insertion probe 12-IP1, and a deletion probe 12-DP1.

[0009] The nucleotide sequence of the upstream primer 12-mF1 is shown in SEQ ID NO: 2;

[0010] The nucleotide sequence of the downstream primer 12-mR2 is shown in SEQ ID NO: 4;

[0011] The nucleotide sequence of the insert probe 12-IP1 is shown in SEQ ID NO: 6;

[0012] The nucleotide sequence of the deletion probe 12-DP1 is shown in SEQ ID NO: 7;

[0013] The nucleotide sequence of the 12bp intron region of the bovine gluten protein gene is shown in SEQ ID NO: 1.

[0014] This invention also provides the application of the aforementioned primer-probe set in the preparation of products that identify 12bp insertion / deletion polymorphism sites in the intron region of the bovine prion protein gene.

[0015] The present invention also provides a reagent for identifying 12bp insertion / deletion polymorphism sites in the intron region of the bovine prion gene, comprising the aforementioned primer and probe set, A Buffer, B Buffer, and ddH2O.

[0016] The present invention also provides a kit for identifying 12bp insertion / deletion polymorphism sites in the intron region of the bovine prion gene, comprising the aforementioned primer and probe set, A Buffer, B Buffer and ddH2O.

[0017] This invention also provides a method for identifying the genotype of a 12bp insertion / deletion polymorphism site in the intron region of the bovine prion protein gene, comprising the following steps:

[0018] (1) Extract genomic DNA from the sample to be tested;

[0019] (2) Using the genomic DNA obtained in step (1) as a template, the primer and probe set is used to perform multi-enzyme isothermal rapid amplification of nucleic acid to obtain amplification products;

[0020] (3) The amplification products described in step (2) are detected by lateral flow chromatography test strips;

[0021] (4) Determine the genotype of the polymorphic site based on the color development results of the test strip.

[0022] Preferably, the sample to be tested includes blood, hair, embryonic cells, beef, milk, milk powder, or cheese.

[0023] The preferred reaction system for rapid multi-enzyme isothermal nucleic acid amplification is as follows:

[0024] The final concentrations of the upstream primer 12-mF1, the downstream primer 12-mR2, the insertion probe 12-IP1, and the deletion probe 12-DP1 were 0.006–0.010 μmol / L, respectively. The template DNA was 5.0 μL.

[0025] The preferred reaction procedure for rapid multi-enzyme isothermal nucleic acid amplification is as follows:

[0026] React at 30–45℃ for 5–30 minutes.

[0027] Preferably, if the control line and the test line T2 show color, it is determined to be a homozygous deletion type; if the control line and the test line T1 show color, it is determined to be a homozygous insertion type; if the control line, the test line T2, and the test line T1 all show color, it is determined to be a heterozygous insertion-deletion type; if only the control line shows color, it is determined to be a negative result.

[0028] The present invention also provides the application of the method in identifying resistance to bovine infectious spongiform encephalopathy in a test sample; the test sample includes blood, hair, embryonic cells, beef, milk, milk powder, or cheese.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] This invention designs a specific primer and probe set (preferably primer set 12-mF1 / 12-mR2, probe 12-IP1 / 12-DP1) targeting the 12bp insertion / deletion polymorphism site in the bovine prion protein gene intron region. By optimizing the reaction temperature, reaction time, and probe concentration, a MIRA-LFD genotyping system is established. The primer and probe set and method of this invention can specifically detect homozygous PRNP intron region 12bp insertion / deletion sites and their hybrid genotypes, solving the technical problem of cumbersome procedures in current identification of PRNP intron region 12bp insertion / deletion polymorphism sites in bovine products. It is an important supplement to current detection techniques for PRNP intron region 12bp insertion / deletion polymorphism sites in bovine products; it can also determine bovine resistance to BSE, providing a convenient detection method for bovine genotyping and BSE susceptibility assessment.

[0031] This invention is based on the MIRA detection technology platform, which meets the equipment requirements of almost all molecular testing laboratories, facilitating the application of this invention's technology. This invention can effectively identify all products potentially derived from bovine sources; the method is simple, efficient, and easy to promote and apply. It provides strong technical support for bovine gene-assisted breeding and can also be used for safety risk assessment of livestock products. Attached Figure Description

[0032] Figure 1 Sequencing results of genotypes at different insertion / deletion polymorphic sites at the 12bp locus of the bovine PRNP gene;

[0033] Figure 2 A schematic diagram illustrating the design principle of MIRA primers for 12bp insertion / deletion polymorphic sites;

[0034] Figure 3The image shows the optimized primer set results for the MIRA reaction of 12bp insertion / deletion polymorphism in the bovine PRNP intron region (where lane M is DNA Marker C (100-1200bp), lanes 4, 8, and 12 are blank controls, lanes 1-3 are 12-mF1 and 12-mR1 primer sets, lanes 5-7 are 12-mF1 and 12-mR2 primer sets, lanes 9-11 are 12-mF1 and 12-mR3 primer sets, lanes 1, 5, and 9 are deletion homozygous samples, lanes 2, 6, and 10 are insertion-deletion heterozygous samples, and lanes 3, 7, and 11 are insertion homozygous samples).

[0035] Figure 4 The image shows the optimized concentration of the insertion probe 12-IP1 for the MIRA reaction of the 12bp insertion / deletion polymorphism in the bovine PRNP intron region (where the concentrations of probes 1 and 2 are 10 μmol / L, probes 3 and 4 are 5 μmol / L, probes 5 and 6 are 2 μmol / L, probes 7 and 8 are 1 μmol / L, and probes 9 and 10 are 0.1 μmol / L; samples 1, 3, 5, 7, and 9 are homozygous deletion samples, and samples 2, 4, 6, 8, and 10 are homozygous insertion samples).

[0036] Figure 5 The image shows the optimized concentration of the deletion probe 12-DP1 for the MIRA reaction of the 12bp insertion / deletion polymorphism in the bovine PRNP intron region (where the concentrations of probes 1 and 2 are 10 μmol / L, probes 3 and 4 are 5 μmol / L, probes 5 and 6 are 2 μmol / L, probes 7 and 8 are 1 μmol / L, and probes 9 and 10 are 0.1 μmol / L; samples 1, 3, 5, 7, and 9 are homozygous deletion samples, and samples 2, 4, 6, 8, and 10 are homozygous insertion samples).

[0037] Figure 6 The optimal results of probe concentration optimization for the MIRA response of 12bp insertion / deletion polymorphism in the bovine PRNP intron region are shown in the figure (where the ratios of 12-IP1 / 12-DP1 probes 1-5 are 0.5:0.1, 0.4:0.2, 0.3:0.3, 0.2:0.4, and 0.1:0.5, respectively).

[0038] Figure 7 Figure 1 shows the optimized temperature conditions for the MIRA reaction of 12bp insertion / deletion polymorphisms in the bovine PRNP intron region (where numbers 1-6 are 30℃, 33℃, 36℃, 39℃, 42℃, and 45℃, respectively).

[0039] Figure 8The results of the optimized MIRA reaction time conditions for the 12bp insertion / deletion polymorphism in the bovine PRNP intron region are shown in the figure (where 1-6 are 5 min, 10 min, 15 min, 20 min, 25 min, and 30 min, respectively).

[0040] Figure 9 The image shows the results of identifying commercially available bovine products using the method of this invention (wherein, numbers 3, 7, and 11 are homozygous for 12bp insertion; numbers 1, 4, and 9 are heterozygous for 12bp insertion-deletion; and numbers 2, 5, 6, 8, 10, and 12 are homozygous for 12bp deletion). Detailed Implementation

[0041] The nucleotide sequence of the 12bp intron region of the bovine prion gene is shown in SEQ ID NO: 1, SEQ ID NO: 1: GGGGGCCGCGGC;

[0042] The nucleotide sequence of upstream primer 12-mF1 is shown in SEQ ID NO: 2; SEQ ID NO: 2: CGGATTGGTGGGAGGCAGACCTTGACCGTGAGTAG;

[0043] The nucleotide sequence of the downstream primer 12-mR1 is shown in SEQ ID NO: 3; SEQ ID NO: 3: CTTGTTCTTCTGAGCTCCCCAGCGGTTCCT; Biotin is labeled at the 5' end of SEQ ID NO: 3;

[0044] The nucleotide sequence of the downstream primer 12-mR2 is shown in SEQ ID NO: 4; SEQ ID NO: 4: GGCCTCGCCCTTGTTCTTCTGAGCTCCCCA; Biotin is labeled at the 5' end of SEQ ID NO: 4;

[0045] The nucleotide sequence of the downstream primer 12-mR3 is shown in SEQ ID NO: 5; SEQ ID NO: 5: GACCTGCGGCTCCTCTACCGGTGCGATTCG; Biotin is labeled at the 5' end of SEQ ID NO: 5;

[0046] The nucleotide sequence of the insert probe 12-IP1 is shown in SEQ ID NO: 6; SEQ ID NO: 6: TTTACTCGGAATGTGGGCgggggccgcggcHGGCTGGTCCCCCTCC; The 5' end of SEQ ID NO: 6 is modified with a FAM antigen marker, and a tetrahydrofuran (dSpacer modification) (represented by H) is marked at a sequence position 30nt away from the 5' end, which serves as the recognition site for nfo (nuclease), and the 3' end is modified with a phosphate group C3 Spacer;

[0047] The nucleotide sequence of the deletion probe 12-DP1 is shown in SEQ ID NO: 7; SEQ ID NO: 7: GGAGAGCTCCATTTACTCGGAATGTGGGCTHGCTGGTCCCCCTCCC; The 5' end of SEQ ID NO: 7 is modified with Dig, and a tetrahydrofuran (dSpacer modification) (represented by H) is marked at a sequence position 30nt away from the 5' end. This modification serves as the recognition site for nfo (nuclease endonuclease), and the 3' end is modified with a phosphate group C3 Spacer.

[0048] The product obtained by the 12-mF1 / 12-mR1 combination amplification is 306 / 318bp, as shown in SEQ ID NO: 8, SEQ ID NO: 8: CGGATTGGTGGGAGGCAGACCTTGACCG TGAGTAGGGCTGGGGGCTTGCGGCGGGCGGGGAACGTCGGGCCTG TTGAGCGTGCTCGTTGGTTTTTGCCAGCCGCCGCTCGGTTTTACCCTCC TGGTTAGGAGAGCTCCATTTACTCGGAATGTGGGC(GGGGGCCGCGGC)TGGCTGGTCCCCCTCCCGAGGTATGTGGGTGGTGTAGGAATCTAGCCCCTCCCACGCTCGTCCACTGCGGGAGTGGGATGGGCGAATCGCACCGGTAGAGGAGCCGCAGGTCCGAGGAACCGCTGGGGAGCTCAGAAGAACAAG;

[0049] The (GGGGGCCGCGGC) sequence in SEQ ID NO: 8 is an inserted sequence;

[0050] The product obtained by the 12-mF1 / 12-mR2 combination amplification is 315 / 327bp, as shown in SEQ ID NO: 9, SEQ ID NO: 9: CGGATTGGTGGGAGGCAGACCTTGACCG TGAGTAGGGCTGGGGGCTTGCGGCGGGCGGGGAACGTCGGGCCTG TTGAGCGTGCTCGTTGGTTTTTGCCAGCCGCCGCTCGGTTTTACCCTCC TGGTTAGGAGAGCTCCATTTACTCGGAATGTGGGC(GGGGGCCGCGGC)TGGCTGGTCCCCCTCCCGAGGTATGTGGGTGGTGTAGGAATCTAGCCCCTCCCACGCTCGTCCACTGCGGGAGTGGGATGGGCGAATCGCACCGGTAGAGGAGCCGCAGGTCCGAGGAACCGCTGGGGAGCTCAGAAGAACAAGGGCGAGGCC;

[0051] The (GGGGGCCGCGGC) sequence in SEQ ID NO: 9 is an insertion sequence;

[0052] The product obtained by the 12-mF1 / 12-mR3 combination amplification is 274 / 286bp, as shown in SEQ ID NO: 10, SEQ ID NO: 10: CGGATTGGTGGGAGGCAGACCTTGACC GTGAGTAGGGCTGGGGGCTTGCGGCGGGCGGGGAACGTCGGGCCT GTTGAGCGTGCTCGTTGGTTTTTGCCAGCCGCCGCTCGGTTTTACCCTC CTGGTTAGGAGAGCTCCATTTACTCGGAATGTGGGC(GGGGCCGCGG C)TGGCTGGTCCCCCTCCCGAGGTATGTGGGTGGTGTAGGAATTCTA GCCCCCTCCCACGCTCGTCCACTGCGGGAGTGGGATGGGCGAATCGC ACCGGTAGAGGAGCCGCAGGTC;

[0053] The (GGGGGCCGCGGC) sequence in SEQ ID NO: 10 is an inserted sequence.

[0054] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0055] Example 1: Confirmation of 12bp insertion / deletion polymorphism sequence in the intron region of the bovine PRNP gene

[0056] This embodiment provides a 12bp insertion / deletion polymorphism specific site in the bovine PRNP intron region. The specific steps are as follows:

[0057] (1) Take 6 bovine blood samples (with complete pedigree records from the farm and confirmed by Sanger sequencing) and extract genomic DNA according to the instructions of the animal tissue kit (purchased from Hangzhou Xinjing Biotechnology Co., Ltd.).

[0058] (2) Using the genomic DNA extracted in step (1) as a template, the 12bp insertion / deletion polymorphism sites in the bovine PRNP intron region were identified. The PCR amplification primers were as follows (Imran M, Mahmood S, Babar ME, et al. PRNP gene variation in Pakistani cattle and buffaloes[J]. Gene, 2012, 505(1):180-185.):

[0059] Upstream primer 12indelF (SEQ ID NO: 11): 5'-GTGCTCGTTGGTTTTTGC-3';

[0060] Downstream primer 12indelR (SEQ ID NO: 12): 5'-TCCTACACACCACCCACATA-3'.

[0061] (3) The amplification product obtained in step (2) is detected by agarose gel electrophoresis. The initial concentration of agarose during the agarose gel electrophoresis is 1.5 wt%, and the agarose gel also contains 0.01% nucleic acid dye Gelred.

[0062] (4) When the amplification product has only one 119 bp electrophoretic band, it is determined to be a homozygous individual with a 12 bp deletion in the PRNP intron region; when the amplification product has two electrophoretic bands, 119 bp and 131 bp, it is determined to be a heterozygous individual with an insertion-deletion in the PRNP intron region. When the amplification product has only one 131 bp electrophoretic band, it is determined to be a homozygous individual with an insertion in the 12 bp intron region of the PRNP.

[0063] Based on the above identification, the amplified 12bp insertion / deletion polymorphic sequence product from cattle was subjected to Sanger sequencing. The PRNP sequence fragment obtained from the bovine sequencing was compared using MegAlign software, confirming the presence of a 12bp insertion / deletion polymorphism in the intron region. Furthermore, different genotypes were observed at this site in the samples, including homozygous deletion, heterozygous insertion-deletion, and homozygous insertion. The experimental results are as follows: Figure 1 As shown.

[0064] Example 2: MIRA primer design for 12bp insertion / deletion polymorphism sites in bovine PRNP intron regions.

[0065] Based on the bovine PRNP sequence (GenBank accession number AJ298878.1) and sequencing results, individuals with different polymorphic genotypes (12 bp insertion / deletion) were selected from the samples. Primers and probes for multi-enzyme isothermal rapid amplification (MIRA) technology were designed according to the site sequence polymorphism. To simultaneously identify 12 bp insertion and deletion genotypes in the bovine PRNP intron region in the MIRA-LFD dual reaction, insertion and deletion detection probes were designed. When designing the insertion detection probe, the endonuclease recognition site was designed after the 12 bp insertion sequence in the intron region, and paired with the two different homozygous genotypes respectively. A pair of primers was also designed at the same position in the bovine conserved sequence. A schematic diagram of the primer and probe design principle is shown below. Figure 2 As shown in Table 1, the designed primer and probe sequences were synthesized by Anhui General Biotechnology Co., Ltd., and the primers and probes were diluted to 10 μmol / L for later use.

[0066] Table 1 Primer sequences

[0067]

[0068] Example 3: Primer selection and condition optimization for MIRA primers for 12bp insertion / deletion polymorphism in bovine PRNP intron regions.

[0069] (1) The bovine blood sample DNA from Example 1 was used as the template DNA for the optimized MIRA system of the present invention.

[0070] (2) The MIRA reaction was performed using a DNA multi-enzyme isothermal rapid nucleic acid amplification kit (basic type, Anpu Future (Changzhou) Biotechnology Co., Ltd.). A 50 μL reaction system was used, comprising: 29.4 μL of Buffer A, 2.5 μL of Buffer B, 2.0 μL of 10 μmol / L upstream primer 12-mF1, 2.0 μL of paired 10 μmol / L downstream primers 12-mR1 (12-mR2 or 12-mR3), 5.0 μL of template DNA, and 9.1 μL of ddH2O. Amplification was performed using the basic MIRA program. Primer sets (12-mF1 and 12-mR1, 12-mF1 and 12-mR2, and 12-mF1 and 12-mR3) were optimized using a PCR instrument. The basic program was: reaction at 37℃ for 30 min. The reaction product was mixed with an equal volume of phenol, chloroform, and isoamyl alcohol (25:24:1), vortexed to remove protein, centrifuged at 12000 rpm for 5 min, and the supernatant was collected. Electrophoresis was then performed on a 2% agarose gel to screen the primers. The optimal primer set was determined based on the presence of non-specific fragment amplification and primer dimers, and whether the amplified target fragment matched the theoretical fragment length. Results are as follows: Figure 3 As shown.

[0071] Theoretically, heterozygous individuals should have two bands, but because the inserted fragment is relatively short, it is impossible to distinguish them on electrophoresis. Therefore, heterozygous individuals will only show one band in the electrophoresis results.

[0072] Figure 3 The results showed that the optimal primer set was 12-mF1 and 12-mR2.

[0073] The amplified products of the 12-mF1 and 12-mR1 groups were 306 bp in length, as shown in SEQ ID NO: 8;

[0074] The amplified products of the 12-mF1 and 12-mR2 groups were 315 bp in length, as shown in SEQ ID NO: 9;

[0075] The amplified products of the 12-mF1 and 12-mR3 groups are 274 bp in length, as shown in SEQ ID NO: 10.

[0076] (3) Under the conditions described in (2), the concentrations of the 12bp insertion and deletion probes in the bovine PRNP intron region (10, 5, 2, 1, and 0.1 μmol / L, respectively) were optimized. The MIRA-LFD reaction was performed using a DNA multi-enzyme isothermal rapid nucleic acid amplification kit (test strip type, Anpu Future (Changzhou) Biotechnology Co., Ltd.) in a 50 μL reaction system, including the following components: 29.4 μL of A Buffer, 2.5 μL of B Buffer, 2.0 μL of 10 μmol / L upstream primer 12-mF1, 2.0 μL of 10 μmol / L downstream primer 12-mR2, 0.6 μL of probe of the corresponding concentration (12-IP1 or 12-DP1), 5.0 μL of template DNA, and 8.5 μL of ddH2O. The reaction was carried out at 37℃ for 20 min. Add 10 μL of reaction solution to 90 μL of deionized water, mix well, and then titrate 80 μL of the diluted product onto a lateral flow dual nucleic acid detection test strip. Read the test strip results after 5 minutes and select the optimal probe concentration.

[0077] Experimental results are as follows Figure 4 and Figure 5 As shown, false positives occur when the probe concentration is high. In the optimal system, the probe concentration is 1 μmol / L. The best results are achieved by adding 0.4 μL and 0.2 μL of 12-IP1 and 12-DP1 to the reaction system, respectively, which are the optimal final concentrations of 0.008 μmol / L and 0.004 μmol / L.

[0078] (4) Under the conditions of (2) and (3), adjust the insertion / deletion probe concentration ratio (12-IP1 set to 0.5 / 0.4 / 0.3 / 0.2 / 0.1 μl and 12-DP1 set to 0.1 / 0.2 / 0.3 / 0.4 / 0.5 μl respectively) according to the brightness and presence of the MIRA-LFD reaction detection line, and optimize the combination of application amounts. All optimization results are based on the detection line results of the dual nucleic acid detection test strip.

[0079] Experimental results: such as Figure 6 As shown, the optimal probe concentration ratio of insertion detection probe 12-IP1 and deletion detection probe 12-DP1 in the dual MIRA amplification reaction system is 2:1.

[0080] (5) Using the bovine product genomic DNA extracted in step (1) as a template, MIRA amplification was performed using the primer and probe set in Table 1 to obtain the amplification product.

[0081] The MIRA-LFD amplification reaction system, in 50 μL increments, comprises the following components: Buffer A 29.4 μL, Buffer B 2.5 μL, 10 μmol / L upstream primer 12-mF 12.0 μL, 10 μmol / L downstream primer 12-mR 22.0 μL, 1 μmol / L insertion probe 12-IP 10.4 μL, 1 μmol / L deletion probe 12-DP 10.2 μL, template DNA 5.0 μL, and ddH2O 8.5 μL.

[0082] Amplification was performed using the MIRA program. The reaction temperature and time were optimized using a gradient PCR instrument. The basic procedure was as follows: different reaction temperatures (30℃, 33℃, 36℃, 39℃, 42℃, 45℃) were followed by a 20-minute reaction time. After color development on the test strip, the optimal temperature was selected based on the results. At the optimal temperature, the MIRA reaction time was further optimized by setting reaction times (5 min, 10 min, 15 min, 20 min, 25 min, 30 min). After color development on the test strip, the optimal time was selected based on the results. 10 μL of the reaction solution was added to 90 μL of deionized water, mixed well, and then 80 μL of the diluted product was titrated onto a dual nucleic acid detection test strip. After 5 minutes, the optimal reaction temperature and time were determined by observing the color development on the test strip.

[0083] Experimental results: such as Figure 7 and Figure 8 As shown, the optimal reaction temperature is 39℃ and the optimal reaction time is 20 min.

[0084] Example 4: MIRA-LFD Detection of Commercially Available Samples

[0085] Forty samples of fresh milk, beef, milk powder, and cheese from different dates and batches were purchased from supermarkets. The method for identifying 12bp insertion / deletion polymorphism sites in the intron region of bovine PRNPs, optimized according to Example 3 of this invention, was combined with Sanger sequencing to detect and identify the 40 commercially available bovine products. Sanger sequencing identification was performed according to the literature (Imran M, Mahmood S, Babar ME, et al. PRNP gene variation in Pakistani cattle and buffaloes[J]. Gene, 2012, 505(1):180-185.).

[0086] The main steps of the MIRA-LFD identification process are as follows:

[0087] (1) Genomic DNA of beef to be tested was extracted using an animal tissue DNA extraction kit (purchased from Hangzhou Xinjing Biotechnology Co., Ltd.); DNA of dairy products such as fresh milk powder was extracted according to the instructions of the TaKaRaMiniBEST Universal Genomic DNA (Baori Biotechnology (Beijing) Co., Ltd.) extraction kit.

[0088] (2) Using the genomic DNA extracted in step (1) as a template, MIRA was performed using preferred primers (12-mF1 and 12-mR2) and probes to obtain amplification products.

[0089] (3) The amplification product obtained in step (2) is tested by a lateral flow chromatography test strip. The dual test strip has three detection lines: a control line, a detection line T1, and a detection line T2.

[0090] (4) When the amplification product shows color on both the control line and the detection line T2, it is determined to be a deletion homozygous type (--); when the amplification product shows color on both the control line and the detection line T1, it is determined to be an insertion homozygous type (++); when the amplification product shows color on all three test lines—the control line, the detection line T1, and the detection line T2—it is determined to be an insertion-deletion heterozygous type (+-); when the amplification product shows color only on the control line, it is determined to be a negative result, the experiment is invalid, and it needs to be retested.

[0091] Experimental results: as shown in Table 2 and Figure 9 The results are shown in the diagram (representing the test strip results for 12 samples). The results indicate that this invention can identify polymorphisms at the 12bp site of bovine PRNP, offering advantages such as simplicity, convenience, and compatibility with the instrument platforms required by most testing institutions. It serves as an important supplement for screening and risk assessment of high-risk groups for BSE (Bovine Spongiform Encephalopathy), providing technical support for the identification of 12bp polymorphisms in bovine PRNP, and is of significant importance.

[0092] Table 2. Identification Results

[0093]

[0094]

[0095]

[0096] As can be seen from the above embodiments and experimental examples, the primer-probe set and identification method described in this invention can specifically detect the 12bp insertion / deletion polymorphism in the PRNP intron region of bovine products, providing a scientific basis for genotyping of bovine products and risk assessment of susceptibility to mad cow disease.

[0097] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A primer and probe set for identifying a 12bp insertion / deletion polymorphic site in the intron region of the bovine prion gene, characterized in that, The primer-probe set includes upstream primer 12-mF1, downstream primer 12-mR2, insertion probe 12-IP1, and deletion probe 12-DP1; The nucleotide sequence of the upstream primer 12-mF1 is shown in SEQ ID NO: 2; The nucleotide sequence of the downstream primer 12-mR2 is shown in SEQ ID NO: 4; The nucleotide sequence of the insert probe 12-IP1 is shown in SEQ ID NO: 6; The nucleotide sequence of the deletion probe 12-DP1 is shown in SEQ ID NO: 7; The nucleotide sequence of the 12bp intron region of the bovine gluten protein gene is shown in SEQ ID NO:

1.

2. The application of the primer-probe set according to claim 1 in the preparation of products that identify 12bp insertion / deletion polymorphism sites in the intron region of the bovine prion protein gene.

3. A reagent for identifying 12bp insertion / deletion polymorphism sites in the intron region of the bovine prion protein gene, characterized in that, It includes the primer and probe set as described in claim 1, A Buffer, B Buffer, and ddH2O.

4. A kit for identifying 12bp insertion / deletion polymorphism sites in the intron region of the bovine prion protein gene, characterized in that, It includes the primer and probe set as described in claim 1, A Buffer, B Buffer, and ddH2O.

5. A method for identifying the genotype of a 12bp insertion / deletion polymorphic site in the intron region of a bovine prion protein gene, characterized in that, The steps include: (1) Extract genomic DNA from the sample to be tested; (2) Using the genomic DNA obtained in step (1) as a template, multi-enzyme isothermal rapid amplification of nucleic acid is performed using the primer and probe set described in claim 1 to obtain amplification products; (3) The amplification products described in step (2) are detected by lateral flow chromatography test strips; (4) Determine the genotype of the polymorphic site based on the color development results of the test strip.

6. The method according to claim 5, characterized in that, The samples to be tested include blood, hair, embryonic cells, beef, milk, milk powder, or cheese.

7. The method according to claim 6, characterized in that, The reaction system for rapid isothermal amplification of nucleic acids using multiple enzymes is as follows: The final concentrations of the upstream primer 12-mF1, the downstream primer 12-mR2, the insertion probe 12-IP1, and the deletion probe 12-DP1 were 0.006–0.010 μmol / L, respectively. The template DNA was 5.0 μL.

8. The method according to claim 7, characterized in that, The reaction procedure for rapid amplification of nucleic acids by multiple enzymes at isothermal temperature is as follows: React at 30–45℃ for 5–30 minutes.

9. The method according to claim 8, characterized in that, If the control line and test line T2 show color, the result is determined to be homozygous deletion; if the control line and test line T1 show color, the result is determined to be homozygous insertion; if the control line, test line T2, and test line T1 all show color, the result is determined to be heterozygous insertion-deletion; if only the control line shows color, the result is determined to be negative.

10. The application of the method according to any one of claims 5 to 9 in identifying the resistance of a test sample to bovine infectious spongiform encephalopathy; wherein the test sample includes blood, hair, embryonic cells, beef, milk, milk powder, or cheese.

Images