SNP molecular marker pde1a gene g.122017741 ta locus related to goat lambing number trait and application

By screening the PDE1A gene g.122017741TA site on goat chromosome 2 as an SNP molecular marker, the problem of slow goat breeding progress in existing technologies has been solved, resulting in a significant increase in the number of goat lambs and improved breeding efficiency.

CN120843698BActive Publication Date: 2026-04-07INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511265925.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-05
Publication Date
2026-04-07
Estimated Expiration
2045-09-05

AI Technical Summary

Technical Problem

The lack of effective molecular markers in existing technologies for screening SNP loci related to lambing number in goats has led to slow progress in goat breeding and difficulty in improving the lambing number trait.

Method used

The PDE1A gene g.122017741TA locus located on goat chromosome 2 was selected as an SNP molecular marker. Genotyping was performed using PCR primers, and GWAS analysis was used to verify its significant association with goat litter size. This study was applied to marker-assisted selection and genetic breeding.

Benefits of technology

By screening and applying the PDE1A gene g.122017741TA locus, the lambing performance of goats can be significantly improved, the number of offspring can be increased, and the breeding efficiency can be enhanced.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120843698B_ABST
    Figure CN120843698B_ABST
Patent Text Reader

Abstract

The application relates to the field of modern livestock breeding technology, and particularly relates to a SNP molecular marker related to a goat lambing number character PDE1A The SNP molecular marker is located at the 51st bp of the nucleotide sequence shown in SEQ ID NO. 01, and the polymorphism is A / T. When the genotype of the polymorphism site contained in the molecular marker is AA, the corresponding relative advantage of the lambing number character of the goat to be detected is obtained. The molecular marker provided by the application can be applied to identification or prediction of the goat lambing character, and can also be applied to the field of molecular breeding. Based on analysis of the goat genotype, the genetic potential of the goat is judged. By selecting the superior allele genotype of the SNP molecular marker, the application can improve the goat lambing number, is used for genetic improvement of breeding performance of the goat, and effectively improves the economic benefit of the goat breeding industry.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of modern livestock breeding technology, and particularly relates to a SNP molecular marker PDE1A gene g.122017741TA site on chromosome 2 of goats related to the lambing number trait and application. BACKGROUND

[0002] The reproductive performance of goats is an important factor restricting the development of the industry, and increasing the lambing number of goats can not only increase the yield of mutton, but also improve the breeding efficiency. The lambing number trait of goats includes average lambing number, live lambing number, and multiple lambing rate, and these traits have an important influence on the lambing capacity of goats.

[0003] Current studies have shown that the lambing number of goats is controlled by multiple genes in cooperation, and the key SNP sites include: g.7919G>A of ZBP1 gene (extremely significantly related to the total lambing number in Boer goats); exon 10 mutation of FSHR gene (such as C1606T in Liaoning Cashmere Goat and C1246A in Qianbei Ma Sheep); g.29893723C>G allele of BMPR1B gene (CC / GG genotype has a higher lambing number in white cashmere goats). In addition, the g.66027842A>C allele of GDF9 gene also has a significant influence, but the genetic effect has breed specificity.

[0004] Screening of new SNP sites related to the lambing number of goats can provide new molecular marker resources for molecular marker-assisted selection of goats and accelerate the process of breeding improvement of goats.

[0005] Therefore, the present application is provided. SUMMARY

[0006] To solve the above technical problems, the present application provides a SNP molecular marker PDE1A gene g.122017741TA site related to the lambing number trait of goats and application.

[0007] Specifically, the technical scheme of the present application is as follows:

[0008] In a first aspect, the present application provides a SNP molecular marker related to the lambing number trait of goats, which is located at the 51st bp of the nucleotide sequence shown in SEQ ID NO. 01, and the polymorphism thereof is A / T.

[0009] Preferably, the genotype of the polymorphic site contained in the SNP molecular marker is AA, which corresponds to the relative advantage of the lambing number trait of the goat to be tested.

[0010] Preferably, the genotype of the polymorphic site contained in the SNP molecular marker is TT, which corresponds to the relative disadvantage of the lambing number trait of the goat to be tested.

[0011] The molecular markers screened in this invention can be applied to genotypic analysis of genes related to goat litter size or association analysis related to goat litter size, providing a new molecular marker resource for marker-assisted selection of goat litter size.

[0012] In a second aspect, the present invention provides substances for detecting the SNP molecular markers described in the first aspect above, including PCR primers for amplifying genomic DNA fragments containing the SNP molecular markers or kits containing the primers.

[0013] Thirdly, the present invention provides the application of the aforementioned molecular markers or substances in at least one of the following:

[0014] (1) Application in identifying the lambing rate trait in goats;

[0015] (2) Application in predicting the lambing number trait in goats;

[0016] (3) Application in goat resource identification, improvement or molecular marker-assisted breeding.

[0017] Preferably, the lambing number trait includes the average number of lambs born.

[0018] Preferably, the goat breed includes the Dongbao Blackhead Goat.

[0019] Fourthly, the present invention provides a method for detecting reproductive traits in goats, comprising: detecting whether the N-labeled single nucleotide in the sequence shown in SEQ ID NO:1 of a goat is A or T, and determining the reproductive traits of the goat based on the detection results.

[0020] Preferably, the present invention uses primers of the amplified sequence SEQ ID NO:1 to perform genotyping on the Dongbao Blackhead sheep material to be tested. If the genotype is AA, the relative advantage of the average number of lambs per individual to be tested is determined.

[0021] Fifthly, this invention provides a genetic breeding method to improve the number of lambs born in goats. The method involves identifying the SNP molecular markers of breeding goats in the core goat population. The SNP molecular markers are located at the 51st bp of the nucleotide sequence shown in SEQ ID NO. 01, with a polymorphism of A / T. Based on the goat SNP molecular markers, corresponding selections are made: in the successive breeding of breeding goats, individuals with the AA and / or AT type base at the 51st base of the SNP marker are selected, while TT type individuals are eliminated, in order to increase the frequency of gene A at this locus generation by generation, thereby improving the lambing performance of offspring goats.

[0022] Beneficial effects:

[0023] This invention provides a SNP molecular marker, the PDE1A gene g.122017741TA site, associated with the lambing count trait in goats, and its application. The SNP molecular marker is located at the 51st bp of the nucleotide sequence shown in SEQ ID NO. 01, and its polymorphism is A / T. When the genotype of the polymorphic site contained in the molecular marker is AA, it corresponds to a relative advantage in the lambing count trait of the goat being tested. This molecular marker provided by this invention can be applied to the identification or prediction of lambing status in goats, and can also be applied in the field of molecular breeding, determining the genetic potential of goats based on genotypic analysis. By optimizing the dominant allele of this SNP molecular marker, this invention can improve the lambing performance of goat offspring, enabling genetic improvement of breeding goats and effectively improving the economic benefits of meat sheep farming. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in this invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be described below.

[0025] Figure 1 Manhattan plot of goat litter size, with arrows pointing to the molecular markers screened in this invention, located upstream of the PDE1A gene on goat chromosome 2. Detailed Implementation

[0026] The main objective of this invention is to screen for a molecular marker, g.122017741TA, located in the upstream region of the PDE1A gene that is associated with the lambing number trait in goats, and to provide the application of this molecular marker in goat lambing number detection or goat breeding.

[0027] First, this invention provides a goat SNP molecular marker located at nucleotide position 122017741 on chromosome 2 of the goat reference genome. The base at this position is A or T. The nucleotide sequence of the 50 bp upstream and downstream of this SNP position is shown below (SEQ ID NO:1):

[0028] AAATCTGAGGAAATATAGCAAAGTTACTAGAAGTGATAGAATGTA ATAAAN(T / A)GATTTTAACAAGTTTACAATATAAAAAGATGCAAAAATC AATATCATGCT.

[0029] The N at position 51 of the above sequence represents a T51-A51 allelic mutation, which causes nucleotide polymorphism in the SEQ ID NO:1 sequence. This molecular marker can be used to detect factors related to goat litter size, and when the nucleotide at position 51 of the sequence shown in SEQ ID NO:1 is A, it is favorable for goats to have a higher average litter size.

[0030] The present invention further provides a reagent or kit comprising primers for detecting the above-mentioned SNP molecular markers. Those skilled in the art can design primers capable of amplifying the sequence shown in SEQ ID NO:1 according to primer design principles to detect the SNP marker genotypes associated with goat litter size in the present invention, thereby predicting goat reproductive traits, especially average litter size.

[0031] The SNP molecular markers or reagents or kits described above in this invention can be applied to the detection of goat reproductive traits or goat breeding; the goat reproductive trait is the average number of lambs born to goats.

[0032] This invention does not limit the breed of goat, but may select breeds such as Chubao Blackhead Goat, Macheng Black Goat, Boer Goat, Yichang White Goat or Matou Goat.

[0033] The present invention further provides a method for detecting the number of lambs born to goats, which detects whether the N-labeled mononucleotide in the above-mentioned SEQ ID NO:1 sequence of the goat is A or T.

[0034] In a more preferred and specific implementation, this invention utilizes primers amplifying the sequence shown in SEQ ID NO:1 to perform genotyping on the goat material to be tested. Goats with the AA genotype have a significantly higher average litter size than those with the TT genotype. This invention preferably uses the reagents or kits mentioned above for detection.

[0035] This invention also provides the application of the above-mentioned single nucleotide polymorphisms of goat SNP sites or substances (reagents or kits) for detecting single nucleotide polymorphisms of goat SNP sites in the detection or auxiliary detection of reproductive traits or goat breeding.

[0036] This invention also provides a method for screening the above-mentioned SNP molecular markers, comprising the following steps:

[0037] ① Extract goat genomic DNA and perform whole-genome low-depth and high-depth resequencing to obtain raw sequencing data;

[0038] ② Quality control of the raw sequencing data was performed, and the data was compared with the goat reference genome. The Sentieon+Beagle strategy was used to detect genetic variations and fill genotypes on all autosomes of the sample to obtain high-quality SNP locus data.

[0039] ③ Using the FarmCPU model with rMVP software, GWAS analysis was performed on SNP sites and average multiparous lambing of goats to obtain SNP molecular markers related to the number of lambs born to the goats.

[0040] As a more specific implementation method, the low depth of the present invention is 1-2×, and the high depth is 15-20×; preferably, the number of low depth sequencing results is higher than that of high depth sequencing results, so as to fill the genotypes of more low depth sequencing results with fewer high depth sequencing results, thereby reducing sequencing costs.

[0041] This invention also provides a genetic breeding method to improve the number of lambs born in goats. The method involves identifying the above-mentioned SNP molecular markers in the breeding goats in the core goat population and making corresponding selections based on the goat SNP molecular markers: in the successive breeding of breeding goats, individuals with the AA type and / or AT type at the 51st base of the SNP marker are selected, and individuals with the TT type are eliminated, so as to increase the frequency of gene A at this locus in each generation, thereby improving the lambing performance of offspring goats.

[0042] In the following embodiments, this invention resequencing the whole genome of 500 Dongbao Blackhead sheep, with 466 sheep having a low sequencing depth of 1× and 34 sheep having a high sequencing depth of 15×, aims to fill in the genotypes of the low sequencing results (which are more numerous) with the high-depth sequencing results (which are fewer), thereby reducing sequencing costs. Then, the resequencing data was aligned to the goat reference genome (genome version ARS1.2), and the Sentieon+Beagle strategy was used to detect genetic variations and fill in the genotypes of all autosomes in the 500 samples. SNP locus data were obtained to conduct a GWAS study related to the weight of goats at 12 months of age, ultimately identifying the PDE1A gene associated with goat reproduction. The SNP marker locus is the 122,017,741st nucleotide on chromosome 15 of the goat reference genome Capra hircus ARS1.2, and the base at this locus is T. Referring to Ensembl, the nucleotide sequences of the 50 bp upstream and downstream of this SNP site were obtained, and the nucleotide sequence of this fragment is shown in SEQ ID NO:1 (where A at position 51 is the nucleotide of the allelic mutation). GWAS analysis showed that the g.122017741TA site was significantly associated with the number of lambs born in goats. Individuals with genotypes AA or TA had significantly higher lambing numbers than TT individuals, indicating that A is an allelic gene that favors higher lambing numbers. This molecular marker can be used to detect factors related to lambing numbers in goats, and when the nucleotide at position 51 of the sequence shown in SEQ ID NO:1 is A, it is beneficial for goats to have a higher lambing number, which is of great significance for goat breeding.

[0043] This invention combines low-depth resequencing with genotype imputation and utilizes GWAS analysis to screen for significant SNP molecular markers affecting goat litter size. These markers are then used in marker-assisted selection and genomic selection to select genotypes favorable for increasing goat litter size for breeding. This progressively increases the gene frequency of dominant alleles, accelerating the breeding improvement process and bringing significant economic benefits to goat farming. This invention verifies the impact of these SNP molecular markers on goat litter performance and demonstrates their applicability in genetic improvement of breeding goats to increase average litter size, thereby enhancing offspring litter performance and increasing the market competitiveness of goat farming enterprises.

[0044] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0045] The endpoints and any values ​​of the ranges disclosed in this specification are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0046] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "specific implementation," or "some specific implementations," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0047] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Experimental methods not specifically described in the examples are generally performed under standard conditions or as recommended by the manufacturer.

[0048] Example 1

[0049] This embodiment provides a whole-genome resequencing method, as detailed below:

[0050] 1. Blood sample collection and white blood cell separation.

[0051] A 5 mL blood sample was collected from the goat's jugular vein using a veterinary lancet and placed in an EDTA anticoagulant tube. The anticoagulant tube was then placed in an ice box filled with ice packs and brought back to the laboratory. These samples were stored at 4°C for leukocyte extraction, following the specific steps below:

[0052] (1) Take 2-3 mL of blood sample into a 10 mL EP tube.

[0053] (2) Add ultrapure water to EP to make the total liquid volume 9 mL.

[0054] (3) Slowly invert the EP tube up and down 20 times and let it stand for 10 minutes.

[0055] (4) Place the EP tube into a centrifuge and centrifuge at 5000 rpm for 10 min.

[0056] (5) Slowly pour out the supernatant from the EP tube.

[0057] (6) Add ultrapure water again to make the total liquid volume 9 mL.

[0058] (7) Repeat steps (3), (4), and (5).

[0059] (8) After the separated white blood cells are numbered, they are placed in a -80℃ freezer.

[0060] 2. Genomic DNA extraction and whole-genome resequencing.

[0061] DNA extraction from leukocytes was performed using the Tianmo Biotechnology Genomic DNA Mini-Extraction Kit (catalog number: d3024), following the instructions. The qualified genomic DNA was sent to Beijing Novogene Technology Co., Ltd. for secondary quality control and library construction, and then subjected to PE150 whole-genome resequencing on the BGI platform. Raw data was obtained in FASTQ format. High-depth whole-genome resequencing was performed on 34 samples, with an average sequencing depth of approximately 19.72×, and a total data size of 1.4T; low-depth whole-genome resequencing was performed on 466 samples, with an average sequencing depth of approximately 1.65×, and a total data size of 1.6T.

[0062] Example 2

[0063] This embodiment provides a method for genome alignment, genetic variation detection, and genotype imputation, as detailed below:

[0064] 1. Analysis of raw sequencing data and genome alignment.

[0065] High-depth sequencing data and low-depth sequencing data are subjected to the same quality control process.

[0066] (1) The raw data was filtered using Fastp software. The filtering criteria were as follows: reads with a base quality value below 20 exceeding 30% were removed; reads with n bases greater than 5% were removed. After the above quality control steps, clean reads were obtained.

[0067] (2) Use BWA software to align cleanreads to the goat reference genome (Capra_hircus.ARS1.2).

[0068] (3) Use Samtools software to sort the compared BAM files.

[0069] (4) Use Picard to mark repeated reads.

[0070] (5) Use Samtools software to build indexes.

[0071] 2. Detection of variant sites and genotyping.

[0072] (1) GATKHaploytypeCaller generates gvcf files for each sample according to the autosomal number.

[0073] (2) GATKCombineGVCFs merges the gvcf files of each sample of a single chromosome.

[0074] (3) GATKGenotypeGVCFs were used for population SNP calling based on chromosomes.

[0075] (4) GATKMergeVcfs merges the vcf files of autosomal populations.

[0076] (5) GATKSelectVariants filters SNPs in vcf files of a population.

[0077] (6) GATK Variant Filtration is used to mark false positive SNP sites.

[0078] (7) The grep command filters tagged SNP sites.

[0079] (8) Plink software was used to filter SNP sites (geno0.1--maf0.05--hwe1e-06).

[0080] (9) Beagle software fills in the missing sites.

[0081] (10) Use Sentieon Haplotyper and GVCFtyper modules to detect and genotype population genomic genetic variations.

[0082] (11) Using Beagle for genotyping, 26,131,221 high-quality SNPs were obtained.

[0083] Example 3

[0084] This example demonstrates the application of the PDE1A gene g.122017741TA molecular marker genotyping method in goat litter size association analysis, as detailed below:

[0085] Association analysis between the PDE1A gene g.122017741TA molecular marker and goat birth rate.

[0086] (1) The phenotype used for the association analysis between genotype and number of lambs was measured by professional technicians in strict accordance with the measurement specifications. The age was measured at 360±15 days. The live weight of the sheep was measured after fasting for 12-16 hours and fasting for 2 hours. The number of litters and the corresponding number of lambs per sheep per year were also recorded.

[0087] (2) GWAS analysis of SNP loci and average number of lambs was performed using the FarmCPU model with rMVP software.

[0088] The FarmCPU model uses both fixed-effects and random-effects models for iteration. The fixed-effects analysis model is as follows:

[0089] y = Xb + Z t u t +S i d i +e

[0090] In the formula, y is the observer vector of the trait; b is the individual fixed effects vector, including the first three principal components of the SNP, birth season, number of lambs, and birth weight; u t The nucleotide genotype matrix of t pseudo-quantitative traits is used as a fixed effect; X and Z t They are b and u respectively t The correlation matrix; S i It is the i-th SNP marker, d i This represents the corresponding effect value; e is the random residual effect vector, which follows a normal distribution e ~ N(0, Iσ). e 2 ).

[0091] GWAS analysis showed that the PDE1A gene g.122017741TA was significantly associated with the number of goats born. Figure 1 The effect of different genotypes of this marker on the number of lambs born in goats is shown in Table 1.

[0092] Table 1. Effects of different genotypes of the PDE1A gene (g.122017741TA) molecular marker on lambing number in goats.

[0093]

[0094] Note: A marker is considered significant when its p-value is less than 1E-05 (Bonferroni correction).

[0095] As shown in Table 1, for the lambing trait in goats, individuals with genotypes TA or AA had significantly higher lambing numbers than individuals with AA, indicating that A is an allele that is beneficial to increasing the number of lambs.

[0096] Finally, it should be noted that the above embodiments are merely preferred embodiments of the present invention, used to illustrate the technical solutions of the present invention, and not to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention. Therefore, any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of substances detecting SNP molecular markers associated with goat litter size traits in the identification or prediction of goat litter size traits, characterized in that, The SNP molecular marker is located at the 51st bp of the nucleotide sequence shown in SEQ ID NO.01, and the polymorphism is A / T; the lambing number trait is the average number of lambs born; the breed of goat is Dongbao Blackhead Goat.

2. The application according to claim 1, characterized in that, The genotype of the polymorphic site contained in the SNP molecular marker is AA, which corresponds to the relative dominance of the lambing number trait in the goats being tested.

3. The application according to claim 1, characterized in that, The genotype of the polymorphic site contained in the SNP molecular marker is TT, which corresponds to a relative disadvantage in the litter size trait of the goat being tested.

4. The application according to claim 1, characterized in that, The substance used to detect the SNP molecular marker is a PCR primer that amplifies the genomic DNA fragment including the SNP molecular marker, or a kit containing the primer.

5. A method for detecting the reproductive traits of Dongbao black-headed sheep, characterized in that, include: The N-labeled single nucleotide in the sequence shown in SEQ ID NO:1 of Dongbao Blackhead Goat is detected as either A or T, and the average number of lambs born in the goat is determined based on the detection results. If the genotype is AA, determine the relative advantage of the average number of lambs born to the tested individual.

6. A genetic breeding method for increasing the lambing number of Dongbao Blackhead sheep, characterized in that, To determine whether the N-labeled single nucleotide in the sequence shown in SEQ ID NO:1 of the core goat population is A or T, the breeding sheep are selected for successive generations to select individuals of type AA and / or type AT, and individuals of type TT are eliminated, so as to increase the frequency of gene A at this locus in each generation, thereby improving the lambing performance of offspring goats.