A SNP marker affecting the total flavor nucleotide content in pigs and its application
By detecting and utilizing specific SNP markers on the international pig genome version 11.1, combined with CRISPR/Cas9 gene editing technology, the total flavor nucleotide content of pork was increased generation by generation, solving the problem of low total flavor nucleotide content in pork in existing technologies, and achieving improved meat quality and accelerated breeding progress.
Patent Information
- Application Number
- CN202511333401.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-18
- Publication Date
- 2026-03-10
- Estimated Expiration
- 2045-09-18
AI Technical Summary
Existing technologies are insufficient to effectively increase the total flavor nucleotide content of pork, which affects the umami flavor and market competitiveness of pork, and there is a lack of efficient molecular marker-assisted breeding methods.
By detecting and utilizing specific SNP markers on the international pig genome version 11.1, combined with CRISPR/Cas9 gene editing technology, the frequency of dominant alleles was increased generation by generation, thereby optimizing the total flavor nucleotide content of pigs.
This method enables a rapid and accurate increase in the total flavor nucleotide content of pork, improving meat quality and enhancing the progress of pig genetic improvement and economic benefits.
Smart Images

Figure CN120843700B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of molecular markers and animal genetic breeding technology, and in particular to an SNP marker that affects the total flavor nucleotide content in pigs and its application. Background Technology
[0002] Flavor nucleotides belong to the 5'-monophosphate nucleotides (5'-NMPs), mainly including: purines such as 5'-adenosine monophosphate (5'-AMP), 5'-inosine monophosphate (5'-IMP), and 5'-guanylic acid monophosphate (5'-GMP); pyrimidines such as 5'-uridine monophosphate (5'-UMP) and 5'-cytidine monophosphate (5'-CMP); and their derivatives such as inosine. AMP, IMP, GMP, UMP, and inosine not only significantly enhance the flavor of food, giving it a unique umami taste, but also play important roles in many aspects of human metabolism, nutrient absorption, intestinal health, immune system, and nervous system function. Among them, AMP, IMP, GMP, and UMP are basic ribonucleotides that make up RNA. IMP is composed of ribose, phosphate, and hypoxanthine and is a common precursor of AMP and GMP, while inosine is formed by the combination of ribose and hypoxanthine.
[0003] Flavor nucleotides, as core components of umami flavor, directly influence the umami and overall flavor quality of pork through their types and contents, playing a crucial role in enhancing pork's market competitiveness and thus attracting widespread attention from academia and industry. Among them, IMP, GMP, and AMP can significantly amplify the intensity of umami perception through molecular synergistic effects with MSG. This mechanism involves conformational changes in taste receptors and intracellular signal cascade amplification. This synergistic effect makes the sensory intensity of complex umami systems far exceed the simple sum of single components, providing a molecular basis for enhancing food flavor. In-depth research on flavor nucleotides in pork helps to reveal the intrinsic mechanisms of pork flavor formation, providing a theoretical basis for pork quality improvement and processing technology optimization. Therefore, exploring the marker sites affecting total flavor nucleotides and improving breeding populations is of great significance to the production and economic benefits of pig farming. Summary of the Invention
[0004] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide an SNP marker that affects the total flavor nucleotide content in pigs.
[0005] Another object of the present invention is to provide the application of the above-mentioned SNP marker.
[0006] The objective of this invention is achieved through the following technical solution:
[0007] A SNP marker that affects the total flavor nucleotide content in pigs, comprising at least one of the following SNP markers:
[0008] (I) The SNP site corresponds to the T>C mutation at position 233,860,695 on chromosome 1 in the International Pig Genome Version 11.1;
[0009] (II) The SNP site corresponds to the C>G mutation at position 21419829 on chromosome 11 in International Pig Genome Version 11.1;
[0010] (III) The SNP site corresponds to the G>A mutation at position 61539869 on chromosome 5 in International Pig Genome Version 11.1;
[0011] (IV) The SNP site corresponds to the C>T mutation at position 73318431 on chromosome 6 in International Pig Genome Version 11.1;
[0012] (V) The SNP site corresponds to the A>G mutation at position 7924927 on chromosome 15 in International Pig Genome Version 11.1;
[0013] (VI) The SNP site corresponds to the T>C mutation at position 477203 on chromosome 17 in International Pig Genome Version 11.1;
[0014] (VII) The SNP site corresponds to the AT>A mutation at position 9931110 on chromosome 15 in International Pig Genome Version 11.1;
[0015] (VIII) The SNP site corresponds to the G>T mutation at site 23364277 on chromosome 7 in International Pig Genome Version 11.1;
[0016] (IX) The SNP site corresponds to the C>T mutation at site 8446065 on chromosome 17 in International Pig Genome Version 11.1.
[0017] For (II), the SNP-labeled nucleic acid sequence is preferably as shown in SEQ ID NO:1, wherein M in the sequence is C or G, and its SNP site is a single base mutation of C243-G243 at position 243 of the sequence marked in SEQ ID NO:1.
[0018] For (V), the SNP-labeled nucleic acid sequence is preferably as shown in SEQ ID NO:2, where M in the sequence is G or A, and the SNP site is a single base mutation of G239-A239 at position 239 of the sequence labeled in SEQ ID NO:2.
[0019] In a specific implementation plan:
[0020] For (I), the pigs are of American Duroc strain or its synthetic strain.
[0021] For (II)-(IV), the pigs are of American Landrace breed or their synthetic line.
[0022] For (V)-(VII), the pigs are of American Large White breed or their synthetic line.
[0023] For (VIII)-(IX), the pigs are of American Landrace, American Large White, or American Duroc or their synthetic lines.
[0024] A primer combination for detecting the above-mentioned SNP markers, comprising at least one of primer pairs primer-F1 and primer-R1, and primer pairs primer-F2 and primer-R2, the nucleotide sequences of which are shown in SEQ ID NO:3-6.
[0025] A kit for detecting the above-mentioned SNP markers, comprising the above-mentioned primer combination.
[0026] The application of the SNP markers, primer combinations, or kits in identifying the total flavor nucleotide content or meat quality traits of pigs or pork, screening pig breeds with high total flavor nucleotide content or excellent meat quality, or in the genetic breeding of pigs with total flavor nucleotide content or meat quality-related traits.
[0027] A method for genetic improvement of pigs, comprising the following steps:
[0028] Identify the aforementioned SNP markers of breeding pigs in the core breeding pig herd, and make corresponding selections based on the SNP markers:
[0029] For (I), select breeding pig individuals with the C / C or C / T genotype at position 233860695 on chromosome 1 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the T / T genotype, so as to increase the frequency of allele C at this locus generation by generation.
[0030] For (II), select breeding pig individuals with the C / C or G / C genotype at position 21419829 on chromosome 11 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the G / G genotype, so as to increase the frequency of allele C at this locus generation by generation.
[0031] For (III), select breeding pig individuals with the A / A or G / A genotype at position 61539869 on chromosome 5 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the G / G genotype, so as to increase the frequency of allele A at this locus generation by generation.
[0032] For (Ⅳ), select breeding pig individuals with the C / C or C / T genotype at position 73318431 on chromosome 6 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the T / T genotype, so as to increase the frequency of allele C at this locus generation by generation.
[0033] For (V), select breeding pig individuals with the A / A or A / G genotype at position 7924927 on chromosome 15 in International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the G / G genotype, so as to increase the frequency of allele A at this locus generation by generation.
[0034] For (VI), select breeding pig individuals with the C / C or T / C genotype at position 477203 on chromosome 17 in International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the T / T genotype, so as to increase the frequency of allele C at this locus generation by generation.
[0035] For (VII), select breeding pig individuals with the AT / AT or AT / A genotype at position 9931110 on chromosome 15 in International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the A / A genotype to increase the frequency of the AT allele at this locus generation by generation.
[0036] For (VIII), select breeding pig individuals with the G / G genotype at position 23364277 on chromosome 7 of International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the G / T genotype, so as to increase the frequency of the G allele at this locus generation by generation;
[0037] For (IX), select breeding pig individuals with the C / C or T / C genotype at position 8446065 on chromosome 17 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the T / T genotype, so as to increase the frequency of allele C at this locus generation by generation.
[0038] A method for identifying the total flavor nucleotide content or meat quality-related traits of pigs or pork, comprising the following steps:
[0039] Identify the aforementioned SNP markers in pigs or pork, and determine the total flavor nucleotide content or meat quality-related traits in pigs or pork based on the SNP sites of the SNP markers, wherein:
[0040] For (I), the total flavor nucleotide content of pigs, from high to low or the meat quality from good to bad, is sorted by the genotype at position 233860695 on chromosome 1 of the International Pig Genome Version 11.1, in the following order: C / C genotype, C / T genotype and T / T genotype.
[0041] For (II), the total flavor nucleotide content of pigs, from high to low or the meat quality from excellent to poor, is sorted by the genotype at position 21419829 on chromosome 11 of the International Pig Genome Version 11.1, in the following order: C / C genotype, G / C genotype and G / G genotype.
[0042] For (III), the total flavor nucleotide content of pigs, from high to low or the meat quality from good to bad, is sorted by the genotype at position 61539869 on chromosome 5 of the International Pig Genome Version 11.1, in the following order: A / A genotype, G / A genotype and G / G genotype.
[0043] For (Ⅳ), the total flavor nucleotide content of pigs, from high to low or the meat quality from excellent to poor, is sorted by the genotype at position 73318431 on chromosome 6 of the International Pig Genome Version 11.1, in the following order: C / C genotype, C / T genotype and T / T genotype.
[0044] For (V), the total flavor nucleotide content of pigs, from high to low or the meat quality from excellent to poor, is ordered by the genotype at position 7924927 on chromosome 15 of the International Pig Genome Version 11.1, in the following order: A / A genotype, A / G genotype, and G / G genotype.
[0045] For (VI), the total flavor nucleotide content of pigs, from high to low or the meat quality from excellent to poor, is ordered by the genotype at position 477203 on chromosome 17 of the International Pig Genome Version 11.1, in the following order: C / C genotype, T / C genotype, and T / T genotype.
[0046] For (VII), the total flavor nucleotide content of pigs, from high to low or the meat quality from excellent to poor, is ordered by the genotype at position 9931110 on chromosome 15 of the International Pig Genome Version 11.1, in the following order: AT / AT genotype, AT / A genotype, and A / A genotype.
[0047] For (VIII), the total flavor nucleotide content of pigs, from high to low or the meat quality from excellent to poor, is sorted by the genotype at position 23364277 on chromosome 7 of the International Pig Genome Version 11.1, in the following order: G / G genotype, G / T genotype;
[0048] For (IX), the total flavor nucleotide content of pigs, from high to low or the meat quality from excellent to poor, is ordered by the genotype at position 8446065 on chromosome 17 of the International Pig Genome Version 11.1, in the following order: C / C genotype, T / C genotype, and T / T genotype.
[0049] The application of the SNP markers, primer combinations, or kits described herein in the fields of gene editing or transgenics.
[0050] A method for establishing a new pig breed and / or a new pig strain that increases the total flavor nucleotide content or improves meat quality-related traits, comprising the following steps:
[0051] The above-mentioned SNP markers in pigs were identified, and the following mutations were performed based on the SNP markers:
[0052] For (I), pigs with the SNP marker having the genotype T / T or C / T, the T / T or C / T genotype is mutated to C / C genotype by site-directed mutagenesis;
[0053] For (II), pigs with the SNP marker having the genotype G / G or G / C, the G / G or G / C genotype is mutated to C / C through site-directed mutagenesis;
[0054] For (III), pigs with the SNP marker having the genotype G / G or G / A are mutated to the A / A genotype through site-directed mutagenesis;
[0055] For (Ⅳ), pigs with the SNP marker having the genotype T / T or C / T are mutated to the C / C genotype through site-directed mutagenesis;
[0056] For (V), pigs with the SNP marker having the genotype G / G or A / G, the G / G or A / G genotype is mutated to A / A through site-directed mutagenesis;
[0057] For (VI), pigs with the SNP marker having the genotype T / T or T / C are mutated to the C / C genotype through site-directed mutagenesis;
[0058] For (VII), pigs with the SNP marker having the genotype A / A or AT / A are mutated to the AT / AT genotype through site-directed mutagenesis;
[0059] For (VIII), pigs with the SNP marker having the genotype G / T are mutated to the G / G genotype through site-directed mutagenesis;
[0060] For (IX), pigs with the SNP marker having the genotype T / T or T / C are mutated to the C / C genotype through site-directed mutagenesis.
[0061] The mutation is performed using transgenic methods or gene editing methods.
[0062] The preferred method for mutation is to use the CRISPR / Cas9 gene editing method.
[0063] The present invention has the following advantages and effects compared with the prior art:
[0064] (1) Based on three experimental pig groups of purebred American Landrace pigs, purebred American Large White pigs, and purebred American Duroc pigs, this invention uses whole-genome resequencing and GWAS analysis to study and identify nine SNP markers related to total flavor nucleotides. At least one of the SNP markers in this invention can be used to detect relevant indicators in pigs, or at least one of these SNP markers can be used for genetic improvement.
[0065] (2) Based on the SNP marker that affects the total flavor nucleotide content of pigs, this invention establishes a set of efficient and accurate molecular marker-assisted breeding technology, including primers and kits for detecting the SNP marker, methods for detecting the total flavor nucleotide content or meat quality-related traits of pigs or pork, and methods for genetic improvement of pigs. When applied to the genetic improvement of the total flavor nucleotide content or meat quality traits of pigs, it can quickly and accurately select and breed the total flavor nucleotide content or meat quality traits of pigs, thus accelerating the breeding process.
[0066] (3) This invention uses molecular breeding to solve the problem of low total flavor nucleotide content. By selecting the superior alleles of the above-mentioned SNPs, the frequency of superior alleles can be increased generation by generation, the total flavor nucleotide content can be increased, the pork quality can be improved, and the progress of pig genetic improvement can be accelerated, thereby effectively improving the economic benefits of breeding pigs. Attached Figure Description
[0067] Figure 1 This is a Manhattan plot of GWAS analysis of the total flavor nucleotide content trait on different chromosomes in different experimental populations; where the X-axis represents the location of the molecular marker site on the chromosome, and the Y-axis represents the -log value corresponding to the molecular marker site. 10 (P-value).
[0068] Figure 2 This is a violin plot showing the genotypes of all loci and the corresponding flavor nucleotide content in the corresponding populations. The X-axis represents the genotype of the SNP molecular marker locus, and the Y-axis represents the total flavor nucleotide content of the individual. Detailed Implementation
[0069] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.
[0070] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field.
[0071] In the examples, the standards for HPLC detection were adenosine monophosphate (AMP) (CAS: 61-19-8), inosine monophosphate (IMP) (131-99-7), guanosine monophosphate (GMP) (5550-12-9), uridine monophosphate (UMP) (3387-36-8), and inosine (58-63-9), which were purchased from Shanghai Anpu Experimental Technology Co., Ltd.
[0072] Example 1
[0073] 1. Laboratory animals
[0074] The pig population used in this invention consists of: 173 purebred American Landrace pigs, 166 purebred American Large White pigs, and 158 purebred American Duroc pigs.
[0075] All pigs were sourced from Jiangxi Yudu Jiada Livestock Co., Ltd. All pigs were slaughtered and tested at Jiangxi Nanchang Guohong Food Co., Ltd. after reaching 200 days of age, in the slaughterhouse's cutting workshop. After slaughter and bleeding, the hair, internal organs, head, tail, and limbs (below the wrists and joints) were removed, and the skin was removed to obtain a carcass. Sampling was completed within 30 minutes of slaughter to minimize the impact of post-mortem metabolism on the content of purine nucleotides and their metabolites. The longissimus dorsi muscle was precisely separated from the left side of the pig carcass between the 1st and 2nd lumbar vertebrae, and visible connective tissue and fascia were removed. Approximately 2.0g of muscle tissue was taken, rapidly transferred to a 2mL cryovial, cut into small pieces, and flash-frozen in liquid nitrogen (-196℃), then stored in an ultra-low temperature freezer at -80℃ until the experiment.
[0076] 2. HPLC Quantitative Determination of Total Flavor Nucleotides in Pork
[0077] In this embodiment, the total flavor nucleotides are the sum of adenosine monophosphate (AMP), guanylic acid (GMP), inosine monophosphate (IMP), uridine monophosphate (UMP), and inosine.
[0078] (1) Extraction of flavor nucleotides: 0.4g (accurate to 0.001g) of muscle sample was accurately weighed from the shredded longissimus dorsi muscle sample and placed in a 15mL polypropylene acid-resistant centrifuge tube.
[0079] (2) Acid hydrolysis extraction: Add 6 mL of 6% (w / w) perchloric acid solution pre-cooled to 4℃, and then homogenize it for 45 s with a handheld high-speed homogenizer (run for 10 s / pause for 5 s, cycle 3 times), and use an ice bath intermittently to prevent overheating.
[0080] (3) Centrifugation purification: Transfer the homogenate to a constant temperature water bath shaker (4℃), shake at 200 rpm for 15 min to promote nucleotide release; centrifuge at 4℃ and 5000 rpm for 10 min, collect the supernatant into a new tube, repeat the centrifugation twice, and combine the supernatants from the two centrifugations.
[0081] (4) Precise pH control for acid-base neutralization: Place the combined supernatant from step (3) in an ice bath and use a micropipette to add 3 mol / L NaOH solution dropwise to adjust the pH to 6.5 ± 0.1 (using a pH meter for real-time monitoring). This can minimize interference with ATPase activity. Add ultrapure water to bring the volume to 10 mL, vortex to mix, and let stand for 10 min to promote ion balance.
[0082] (5) The contents of AMP, GMP, IMP and inosine in the extract of the longissimus dorsi muscle of each individual were determined by high performance liquid chromatography (HPLC) (unit: mg / 100g). The HPLC analysis was performed on an ACQUITYUPLCH-ClassPLUS System (Waters). The chromatographic column was a Waters BEH C18 (1.7 μm, 2.1× 100 mm). The mobile phase was 0.05 mol / L KH2PO4 buffer (pH 6.0)-methanol (95:5, v / v). The flow rate was 0.2 mL / min (isocratic elution). The column temperature was 30℃. The detection wavelength was 254 nm. The injection volume was 2 μL. The external standard method was used for quantification. The standard curve should meet the requirement of R²≥0.999.
[0083] (6) Concentration data obtained from the HPLC system are converted from the original unit µg / mL to mg / 100g using the following formula:
[0084]
[0085] Where C represents the content of each flavor nucleotide in 100 grams of pork (mg / 100g), and C0 represents the concentration of each flavor nucleotide as measured by HPLC (µg / mL).
[0086] This invention presents descriptive statistics on the HPLC detection data of total flavor nucleotides in the longissimus dorsi muscle of three commercial pig breeds (Large White, Landrace, and Duroc). The sample size (N), mean, standard deviation (SD), minimum-maximum (Min-Max), and coefficient of variation (CV) were systematically calculated. The descriptive statistical results are shown in Table 1. The table shows that the total total flavor nucleotides were similar in Large White and Landrace, and slightly lower in Duroc, but the difference was not significant. The coefficient of variation for Duroc (20.6%) was significantly higher than that of the other breeds (11.8%–12.7%). In summary, Large White and Landrace exhibited excellent stability in total flavor nucleotides and are suitable as benchmark breeds for flavor characteristics.
[0087] Table 1. Descriptive statistics of total flavor nucleotide content in the three varieties (unit: mg / 100g)
[0088]
[0089] Example 2
[0090] 1. Acquisition, quality control, and genotyping of whole-genome resequencing data in pigs.
[0091] (1) DNA extraction: Ear tissue samples were collected from each individual in the three experimental pig groups in Example 1, and genomic DNA was extracted from each individual using the standard phenol-chloroform method. The extracted genomic DNA was dissolved in TE buffer. The quality of the extracted genomic DNA was detected using a Nanodrop-ND1000 spectrophotometer. The quality standard was met when the A260 / 280 ratio was around 1.8-2.0 and the A260 / 230 ratio was around 1.7-1.9.
[0092] (2) DNA sequencing: The concentration of DNA samples that meet the standards is diluted to 50 ng / μL. The whole genome resequencing (paired-end 150 bp sequencing mode) is completed by the BGI T7 sequencing platform. The average sequencing depth of the sample reaches 30×, and the raw sequencing data in fastq format is obtained. Clean reads are obtained through fastp (v0.23.0) quality control for subsequent analysis.
[0093] (3) Sequence alignment: The raw sequencing data obtained in step (2) were aligned with the Sscrofa 11.1 (NCBI Suscrofa version 11.1) reference genome using BWA (v0.7.17) to obtain a sam format file.
[0094] (4) Mutation detection: Use samtools (v1.10) to sort and convert the sam format file in step (3) into a bam format file, then use Sambamba (v0.8.2) to remove the PCR repeat sequences in the bam format file, and finally use Graphtyper (v2.7.7) to perform genetic variation detection on all individual bam files to obtain population-level genotype data (vcf file).
[0095] (5) Variation Quality Control: The population-level genotype data obtained in step (4) was quality controlled using samtools. High-quality genotype sites were retained if they met the condition "FILTER="PASS"" and the variation detection quality value (GQ) > 20. Plink (v1.9) was further used to perform quality control on the population-level genotype data, excluding variant sites with a minor allele frequency (MAF) below 5% and samples with an individual genotype call rate below 80%. Finally, beagle (r1399) was used to autofill the genotypes to obtain high-quality genotype data.
[0096] After processing using the methods described above, 1,928,103, 1,964,653, and 1,513,322 mutation sites (including SNPs and Indels) were obtained in Dabai, Changbai, and Duroc, respectively.
[0097] 2. Genome-wide association study (GWAS) analysis and meta-analysis
[0098] (1) Genome-wide association analysis was performed on the phenotypic data after confounding correction using the Genome-wide Efficient Mixed Model Association algorithm (GEMMA v0.98.1). Specifically:
[0099] ① Phenotypic processing: This invention uses the lm() function in R language to perform simple linear regression on gender and batch number, and the corrected residuals are used as the phenotypes for the final association analysis.
[0100] ② The analysis uses a univariate linear mixed model (ULMM) for statistical inference, and its mathematical expression is constructed as follows:
[0101]
[0102] Where y represents the n-dimensional vector of the phenotype (quantitative trait or binary vector) to be analyzed, which in this study is the content of total flavor nucleotides; W represents a matrix consisting of a column of "1"s (n×c dimensions); α is the vector of the effect and intercept of the corresponding covariate (c dimensions); x represents the vector of the genotype of the detection locus (n dimensions); β represents the vector of the magnitude of the effect of the detection locus; u represents a vector with a mean of 0 and a covariance-variance matrix of λτ. -1 The random effects vector (n-dimensional) of a K-multivariate normal distribution; ε indicates that it follows a mean of 0 and a covariance-variance matrix of τ. -1 The residual vector of In (n-dimensional). In two n-variable normal distributions, n represents the number of phenotypes, τ -1 Let represent the variance of the residuals, and λ represent the ratio of the variance of the random effects to the variance of the residuals; K represents the n×n kinship matrix, and In represents the n×n identity matrix; MVNn represents the n-dimensional multivariate normal distribution. To correct for multiple hypothesis testing, a genome-wide significance threshold of 0.05 / N (Bonferroni correction) is set, where N is the number of valid SNPs / Indels.
[0103] (2) Using the results of the above GWAS analysis, the total flavor nucleotide content in the three populations was meta-analyzed in METAL software. The meta-analysis was performed based on the standard error weighting method (SCHEME STDERR).
[0104] This invention is based on GWAS analysis ( Figure 1 A total of nine representative SNP loci were obtained (including those obtained from meta-analysis), and their basic genetic parameters are shown in Table 2. The names of the representative SNP loci were obtained from the sus_scrofa.vcf.gz file downloaded from the NCBI database using bcftools software. If the website did not have the SNP name information for a particular locus, the SNP name was represented in the form of "chromosome_location". Other important genetic parameters for each representative locus were provided by GWAS analysis using GEMMA software, including the chromosome and location of the locus, alleles, effect size, and p-value (Wald test).
[0105] Table 2. Basic genetic parameters of 9 representative SNP loci
[0106]
[0107] Note: The meta-analysis integrates genome-wide association study data from three pig breeds: Duroc, Landrace, and Large White.
[0108] 3. Phenotypic analysis of total flavor nucleotide content under different genotypes
[0109] Genotypes at displayed molecular marker sites in each of the 497 pigs from three populations were extracted from sequencing files using Plink (v1.9). After counting the number of individuals with each genotype, the genotypes of these individuals were correlated with their corresponding total flavor nucleotide content. Then, the `summarise` function in the `dplyr` package of R was used to statistically analyze the differences in phenotypic distribution among different genotypes. The results are shown in Table 3 and... Figure 2 As shown in the figure. The p-value is obtained from the variance test.
[0110] Table 3. Effects of each molecular marker site on the total flavor nucleotide content (unit: mg / 100g)
[0111]
[0112] 4. Heritability analysis
[0113] Heritability is one of the most important fundamental genetic parameters in quantitative genetics, and it can be divided into broad-sense heritability, narrow-sense heritability, and realized heritability. In the breeding process, heritability generally refers to narrow-sense heritability (h0). 2 ), which refers to the proportion of the variance in quantitative trait breeding values to the variance in phenotypic values, is the additive effect portion after eliminating dominant and epistatic effects, and is stably inherited during generational transmission. This invention estimates single-marker heritability based on the effect value (β) and its standard error (SE) of each locus in the GWAS results file from step 3 above, and takes their mean as the approximate narrow-sense heritability at the whole-genome level. The specific calculation formula is as follows:
[0114]
[0115] Where β is the regression coefficient of a single SNP site, and SE is its corresponding standard error.
[0116] Table 4 shows the results of the heritability estimation analysis of the total flavor nucleotide content in the three populations. The heritability distribution of the total flavor nucleotide content in the three populations ranges from 0.339 to 0.355.
[0117] Table 4. Heritability estimation of total flavor nucleotide content in the three populations (h 2 )
[0118]
[0119] Example 3
[0120] This embodiment provides a method and process for detecting SNP markers in Example 2. Specifically, taking SNP markers rs3471810056 and rs320422189 as examples, their corresponding breeds are Landrace and Large White pigs, respectively. The specific method is as follows:
[0121] 1. Primer design
[0122] (1) The target fragment containing SNP sites that are significantly associated with the total flavor nucleotide content of American Landrace pigs is a 535bp nucleotide sequence from chromosome 11 (SEQ ID NO:1). The upstream and downstream primers for sequence amplification are primer-F1 and primer-R1, and its nucleic acid sequence is as follows:
[0123] Upstream primer-F1: 5'-TCTGGAGCTTTGCCTGAGAC-3' (SEQ ID NO:3);
[0124] Downstream primer-R1: 5'-CCTAGGACAGTGCAGTGGC-3' (SEQ ID NO:4).
[0125] (2) The target fragment containing SNP sites that are significantly correlated with the total flavor nucleotide content of American Large White pigs is a 513bp nucleotide sequence from chromosome 15 (SEQ ID NO:2). The upstream and downstream primers for sequence amplification are primer-F2 and primer-R2, and its nucleic acid sequence is as follows:
[0126] Upstream primer-F2: 5'-GCTTCTCTGCCTAGCTCCTG-3' (SEQ ID NO:5);
[0127] Downstream primer primer-R2: 5'-AGGAAACTGAGGTTTGAGAGAGA-3' (SEQ ID NO:6).
[0128] 2. PCR amplification
[0129] Add 1 μL of the DNA template to be tested, 3.4 μL of double-distilled water, 5 μL of 2×Taq PCR StarMixwith Loading Dye, and 0.3 μL each of forward and reverse primers to a 10 μL reaction system. The PCR reaction conditions are as follows: 94℃ pre-denaturation for 5 min, followed by 94℃ denaturation for 30 s, 55-65℃ annealing for 30 s, and 72℃ extension for 45 s, for 35 cycles, and a final extension at 72℃ for 5 min.
[0130] 3. DNA sequencing
[0131] DNA sequence sequencing and identification: Performed at BGI Genomics Co., Ltd. in Shenzhen, the gene fragments were sequenced using both forward and reverse reactions. The obtained sequences were compared with the NCBI genome sequence to identify mutations at corresponding SNP sites.
[0132] SEQ ID NO:1 (chr11:21419586-21420121):
[0133] TCTGGAGCTTTGCCTGAGACCCTATAGGCCACTGTGAGCTTTGTCGCTTTCTTAAAGGAGAGACACTAAAAGCCCTAGAGGTCTTTCTTTTGTTGAAAGAAATGGTATTTTCTCCCAAGTACTGATAAAAGTAATCATTTTCCTTCACAAAAACTGGCTGAAAACTCAAGGCCAAACGAGGGCACTGCACATGTTCCAAGAACAGAAGGCCCAGGAGGCCTTAGATGAGAAGTGATTTCAG M(C>G)
[0134] GTGGGAGCCAGGGAGCTCATGGACAAGGATCCCGTCAAGGTCACAGCTCCTCCCAGGGCGTGGCTGCATCCTGAGCAGGCTGGTCCGGGAGATGTGATGGGGTGGCCCAGAGCAGTGCCGTGGGGTCCCCTGTCCTTGCTGGCGATGATGGGGAGGCTCTCTGTTCCCTGCCCAGGGTCCTCCCCTCACTCTCCCAGCAAGTGTGGGGTCTGCGCCGGATCCGCCCGGAGCTCAGGGACTTCCTACTGGGACACACCTACTGGTCTGGGGTCGGCCACTGCACTGTCCTAGG
[0135] SEQ ID NO:2(chr15:7924688-7925201):
[0136] GCTTCTCTGCCTAGCTCCTGGCGATTTAGAATGTGATGGAATAAAGAAGCCTTTCCCTGCTAGTCACCTCTGAACAACTCTTAATTGAATTTCCGTTATAAGCTATGATGTCCCTAAGTTTGCAACAAATTCTTCAAATTTGTTTTCCTCTCTAAAGTGTGTGTGTGTGTGTGTGTGAGAGAGAGAGAGAGCGAGATGGGCATGTGGGTGCACGAGCGCACAGATACACCTCCCCCAT M(G>A)
[0137] CACATGTACAACAGGGTCCTTATAAGTTTATGAAGAACGTTCCAGTTAAACCTTTTGACTTTCTTAAATCAGAAGAGGGGAGATTTTCTTAGAAACAAATCATCGCATATTAATTTTTGAGAGTCAGTTTTAAAAACCTATTATTTTATCCTGGCATATTAGAAAGAGCAAAAGCTTGGAAATTTGCCAGGCAGAATTTCAAATCCCAGTCCTTCTATTTCCTAAGTGTGCCATGTTGGCAAGTTATTCTATCTCTCTCAAACCTCAGTTTCCT
[0138] Note: M marked in the sequence is the mutation site, indicated by an underline (the mutated base in parentheses represents the allele mutation). The primer binding position is indicated by bolding at the beginning and end of the sequence.
[0139] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. The use of a SNP locus affecting total tastant nucleotide content in pigs in the identification of pigs or pork total tastant nucleotide content, or in the genetic breeding of pigs for total tastant nucleotide content, characterized in that The SNP site comprises at least one of the following: (I) the SNP site corresponds to the T>C mutation at position 233860695 on chromosome 1 in the international pig genome version 11.1; (II) the SNP site corresponds to the C>G mutation at position 21419829 on chromosome 11 in the international pig genome version 11.1; (III) the SNP site corresponds to the G>A mutation at position 61539869 on chromosome 5 in the international pig genome version 11.1; (IV) the SNP site corresponds to the C>T mutation at position 73318431 on chromosome 6 in the international pig genome version 11.1; (V) the SNP site corresponds to the A>G mutation at position 7924927 on chromosome 15 in the international pig genome version 11.1; (VI) the SNP site corresponds to the T>C mutation at position 477203 on chromosome 17 in the international pig genome version 11.1; (VII) the SNP site corresponds to the AT>A mutation at position 9931110 on chromosome 15 in the international pig genome version 11.1; For (I), the pig is a Duroc of American line; For (II)-(IV), the pig is a Landrace of American line; For (V)-(VII), the pig is a Yorkshire of American line.
2. The use according to claim 1, characterized in that: For (II), the SNP site is M in the nucleotide sequence shown as SEQ ID NO: 1, and the base is C or G; For (V), the SNP site is M in the nucleotide sequence shown as SEQ ID NO: 2, and the base is G or A.
3. The use of a primer combination for detecting a SNP site affecting the total content of taste nucleotides in pigs in identifying the total content of taste nucleotides in pigs or pork, or in the genetic breeding of the total content of taste nucleotides in pigs, characterized in that The primer combination comprises at least one of primer pair primer-F1 and primer-R1, and primer pair primer-F2 and primer-R2, and the nucleotide sequences thereof are shown as SEQ ID NO: 3-6; The SNP site is the SNP site (II) or (V) described in claim 1; For (II), the pig is a Landrace of American line; For (V), the pig is a Yorkshire of American line.
4. Use of a kit for detecting a SNP site affecting the total content of taste nucleotides in pigs in identifying the total content of taste nucleotides in pigs or pork, or in the genetic breeding of the total content of taste nucleotides in pigs, characterized in that The kit comprises the primer combination described in claim 3; The SNP site is the SNP (II) or (V) described in claim 1; For (II), the pig is a Landrace of American line; for (V), the pig is a Yorkshire of American line.
5. A method for genetic improvement of pigs, characterized by Comprising the following steps: determining the genotype of the SNP site described in claim 1 or 2 of the breeding swine in the breeding swine core group, and making a corresponding selection according to the genotype of the SNP site: For (I), selecting a breeding swine individual with C / C genotype at position 233860695 on chromosome 1 in the international pig genome version 11.1 from the breeding swine core group, and eliminating breeding swine individuals with C / T or T / T genotype to increase the frequency of allele C at this site generation by generation; For (II), selecting a breeding swine individual with C / C or G / C genotype at position 21419829 on chromosome 11 in the international pig genome version 11.1 from the breeding swine core group, and eliminating breeding swine individuals with G / G genotype to increase the frequency of allele C at this site generation by generation; For (III), selecting from the core group of breeding pigs, breeding pigs with A / A or G / A genotype at position 61539869 on chromosome 5 of the International Pig Genome 11.1 version, and eliminating breeding pigs with G / G genotype, so as to increase the frequency of allele A at this site generation by generation; For (IV), selecting from the core group of breeding pigs, breeding pigs with C / C genotype at position 73318431 on chromosome 6 of the International Pig Genome 11.1 version, and eliminating breeding pigs with C / T or T / T genotype, so as to increase the frequency of allele C at this site generation by generation; For (V), selecting from the core group of breeding pigs, breeding pigs with A / A genotype at position 7924927 on chromosome 15 of the International Pig Genome 11.1 version, and eliminating breeding pigs with A / G or G / G genotype, so as to increase the frequency of allele A at this site generation by generation; For (VI), selecting from the core group of breeding pigs, breeding pigs with C / C or T / C genotype at position 477203 on chromosome 17 of the International Pig Genome 11.1 version, and eliminating breeding pigs with T / T genotype, so as to increase the frequency of allele C at this site generation by generation; For (VII), selecting from the core group of breeding pigs, breeding pigs with AT / AT or AT / A genotype at position 9931110 on chromosome 15 of the International Pig Genome 11.1 version, and eliminating breeding pigs with A / A genotype, so as to increase the frequency of allele AT at this site generation by generation; For (I), the pigs are American Duroc; For (II)-(IV), the pigs are American Landrace; For (V)-(VII), the pigs are American Large White.
6. A method of identifying swine or pork total tastant nucleotide content, characterized by Comprising the following steps: determining the genotype of the SNP site of the pig or pork as claimed in claim 1 or 2, and judging the total taste nucleotide content of the pig or pork according to the genotype of the SNP site, wherein: For (I), the total taste nucleotide content of the pig is ranked from high to low according to the genotype at position 233860695 on chromosome 1 of the International Pig Genome 11.1 version, in the order of C / C genotype, C / T genotype and T / T genotype; For (II), the total taste nucleotide content of the pig is ranked from high to low according to the genotype at position 21419829 on chromosome 11 of the International Pig Genome 11.1 version, in the order of C / C genotype, G / C genotype and G / G genotype; For (III), the total taste nucleotide content of the pig is ranked from high to low according to the genotype at position 61539869 on chromosome 5 of the International Pig Genome 11.1 version, in the order of A / A genotype, G / A genotype and G / G genotype; For (IV), the total taste nucleotide content of the pig is ranked from high to low according to the genotype at position 73318431 on chromosome 6 of the International Pig Genome 11.1 version, in the order of C / C genotype, C / T genotype and T / T genotype; For (V), the total taste nucleotide content of the pig is ranked from high to low according to the genotype at position 7924927 on chromosome 15 of the International Pig Genome 11.1 version, in the order of A / A genotype, A / G genotype and G / G genotype; For (VI), the total taste nucleotide content of the pig is ranked from high to low according to the genotype at position 477203 on chromosome 17 of the International Pig Genome 11.1 version, in the order of C / C genotype, T / C genotype and T / T genotype; For (VII), the total taste nucleotide content of the pig is ranked from high to low according to the genotype at position 9931110 on chromosome 15 of the International Pig Genome 11.1 version, in the order of AT / AT genotype, AT / A genotype and A / A genotype. For (V), the pig total taste nucleotide content from high to low, with the genotype of the 7924927th position on the 15th chromosome of the international pig genome 11.1 version, in turn, A / A genotype, A / G genotype and G / G genotype; For (VI), the pig total taste nucleotide content from high to low, with the genotype of the 477203th position on the 17th chromosome of the international pig genome 11.1 version, in turn, C / C genotype, T / C genotype and T / T genotype; For (VII), the pig total taste nucleotide content from high to low, with the genotype of the 9931110th position on the 15th chromosome of the international pig genome 11.1 version, in turn, AT / AT genotype, AT / A genotype and A / A genotype; For (I), the pig is American Duroc; For (II)-(IV), the pig is American Landrace; For (V)-(VII), the pig is American Large White.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker related to pig backfat thickness and lean meat percentage on pig chromosome 1 and application
CN117904306A
SNP (Single Nucleotide Polymorphism) molecular marker related to pig lean meat percentage character and application of SNP molecular marker
CN117965749A