Primers, detection kit and detection method for detecting herbicide resistant ps ii inhibitor herbicide avena fatua by PCR
By designing molecular marker sites and PCR detection primers associated with resistance to PS II inhibitor herbicides, the problem of rapid, simple and accurate detection of quinoa resistance was solved, enabling rapid and accurate prediction of sensitivity or resistance to PS II inhibitor herbicides and providing scientific guidance for herbicide use.
Patent Information
- Application Number
- CN202511357572.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-23
- Publication Date
- 2025-12-23
- Estimated Expiration
- 2045-09-23
Smart Images

Figure CN120843731B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to molecular marker sites and PCR detection primers associated with resistance to PS II inhibitor herbicides of lambsquarters, and particularly to molecular marker sites and PCR detection primers associated with resistance to PS II inhibitor herbicides of lambsquarters, and their application in detecting resistance to PS II inhibitor herbicides of lambsquarters. It belongs to the field of molecular marker sites and PCR detection primers associated with resistance to PS II inhibitor herbicides of lambsquarters and their applications. Background Technology
[0002] Photosystem II (PS II) is a crucial part of plant photosynthesis, containing a reaction center composed of D1 and D2 proteins, a light-harvesting antenna system, and an oxygen-evolving complex. Functionally, it absorbs and transfers light energy, achieves charge separation and stabilization, splits water to release oxygen, promotes electron transport, and stimulates the production of ATP and NADPH. PS II inhibitor herbicides, including bentazon, atrazine, cyclomethrin, and fenpropathrin, inhibit photosynthesis by interfering with the electron transport chain, ultimately leading to weed death. These herbicides are widely used for weed control in soybeans, cotton, and other crops.
[0003] However, in recent years, quinoa ( Chenopodium album L. The control efficacy of PS II inhibitor herbicides has significantly decreased, and some Chenopodium species have even developed cross-resistance to multiple PS II inhibitor herbicides. Therefore, it is urgent to develop a rapid, simple, and easy-to-use method for detecting herbicide-resistant weeds, and a rapid, simple, and accurate method for detecting herbicide-resistant Chenopodium is needed.
[0004] Traditional methods for detecting herbicide-resistant weeds typically involve collecting seeds of suspected resistant weeds from the field, germinating them, sowing them in culture pots, cultivating them to a certain leaf age, spraying them with a series of herbicides, continuing cultivation for a period of time, and finally calculating the medium concentration of herbicide and the resistance index by cutting the above-ground parts and weighing them fresh or drying them. This method has certain limitations, such as requiring a dedicated plant culture room, and having a long cultivation process and detection cycle; it cannot explain the resistance mechanism at the microscopic molecular level, nor can it provide guidance for scientific pesticide use, thus failing to effectively prevent the further development of herbicide-resistant populations.
[0005] With the advancement and application of molecular biology techniques, more and more herbicide-resistant weeds are being discovered, and their resistance mechanisms are gradually being revealed. Studies have shown that the resistance mechanism of lambsquarters to PS II inhibitor herbicides is mainly related to… psbA It is related to gene mutations. Therefore, by detecting... psbA Specific mutations in the gene sequence can determine whether quinoa has resistance to PS II inhibitor herbicides. SUMMARY
[0006] One of the purposes of the present application is to provide a molecular marker locus associated with the resistance of Chenopodium album to PS II inhibitor herbicides.
[0007] The second purpose of the present application is to provide a PCR detection primer pair designed according to the molecular marker locus.
[0008] The third purpose of the present application is to provide a PCR kit for predicting the sensitivity or resistance of Chenopodium album to PS II inhibitor herbicides.
[0009] The fourth purpose of the present application is to apply the target gene, the PCR detection primer pair and the PCR kit to predict the sensitivity or resistance of Chenopodium album to PS II inhibitor herbicides.
[0010] In order to achieve the above purposes, the main technical solutions adopted by the present application include:
[0011] The present application provides a molecular marker locus associated with the resistance of Chenopodium album to PS II inhibitor herbicides.
[0012] In a preferred embodiment of the present application, the nucleotide sequence of the molecular marker is shown in SEQ ID No. 1 or SEQ ID No. 2:
[0013] catttcggct cggttgcagc ggctactgct gttttcttga tctacccaat tggtcaagga
[0014] agcttttctg atggtatgcc tctaggaatc tctggtactt tcaactttat gattgtattc
[0015] caggctgagc acaacatcct tatgcatcca tttcacatgt taggtgtagc tggtgtattc
[0016] ggcggctccc tttttagtgc tatgcatggg tccttggtaa cttctagttt gatcagggaa
[0017] actacagaaa atgaatctgc taatgagggt tacagattcg ggcaagagga agaaacttat
[0018] aatattgtag ctgctcatgg ttatttcggc cgattgatct ttcaatatgc tagtttcaac
[0019] aactctcgtt ctttacactt cttcttagct gcttggcctg tagtaggtat ttggtttact
[0020] gctttaggta ttagtactat ggccttcaac ttaaatgggt tcaatttcaa ccaatctgta
[0021] gttgatagtc aaggtcgtgt aattaatact tgggctgata tcattaaccg tgctaacctt
[0022] ggtatggaag ttatgcatga acgtaatgct cataacttcc ctctagacct agccgctatc
[0023] gaagctccat cttaa (SEQ ID No. 1).
[0024] catttcggct cggttgcagc ggctactgct gttttcttga tctacccaat tggtcaagga
[0025] agcttttctg atggtatgcc tctaggaatc tctggtactt tcaactttat gattgtattc
[0026] caggctgagc acaacatcct tatgcatcca tttcacatgt taggtgtagc tggtgtattc
[0027] ggcggctccc tttttagtgc tatgcatggg tccttggtaa cttctagttt gatcagggaa
[0028] actacagaaa atgaatctgc taatgagggt tacagattcg ggcaagagga agaaacttat
[0029] aatattgtag ctgctcatgg ttatttcggc cgattgatct ttcaatatgc tagtttcaac
[0030] aactctcgtt atttacactt cttcttagct gcttggcctg tagtaggtat ttggtttact
[0031] gctttaggta ttagtactat ggccttcaac ttaaatgggt tcaatttcaa ccaatctgta
[0032] gttgatagtc aaggtcgtgt aattaatact tgggctgata tcattaaccg tgctaacctt
[0033] ggtatggaag ttatgcatga acgtaatgct cataacttcc ctctagacct agccgctatc
[0034] gaagctccat cttaa(SEQ ID No.2)。
[0035] The molecular marker site is located at the 371th base of the nucleotide sequence shown in SEQ ID No.2, which is mutated from C to A, and the phenotype of the PS II inhibitor herbicide is resistance.
[0036] Another aspect of the present application provides a PCR detection primer pair designed according to the molecular marker site.
[0037] In a preferred embodiment of the present application, the PCR detection primer pair consists of an upstream primer with a nucleotide sequence shown in SEQ ID No.3 and a downstream primer with a nucleotide sequence shown in SEQ ID No.4; the nucleotide sequence amplified by using SEQ ID No.3 and SEQ ID No.4 as primers covers the gene fragment region shown in SEQ ID No.1 and SEQ ID No.2; wherein the 371th base of the sequence of SEQ ID No.1 is C, representing a PS II inhibitor herbicide sensitive type; and the 371th base of the sequence of SEQ ID No.2 is A, representing a PS II inhibitor herbicide resistance type.
[0038] The primer pair can be used as a primer pair for amplifying a molecular marker, and further used for predicting the sensitivity or resistance of Chenopodium to PS II inhibitor herbicides. Therefore, the application of the primer pair in detecting the sensitivity or resistance of Chenopodium to PS II inhibitor herbicides is within the protection scope of the present application. Moreover, a kit comprising the primer pair and used for detecting the sensitivity or resistance of Chenopodium to PS II inhibitor herbicides is also within the protection scope of the present application.
[0039] Another aspect of the present application provides a PCR kit for predicting the sensitivity or resistance of Chenopodium to PS II inhibitor herbicides, comprising: Taq enzyme, dNTP, Mg 2+ 2, ddH2O and a PCR detection primer pair; the PCR detection primer pair is a PCR detection primer pair designed according to the target gene shown in SEQ ID No. 2.
[0040] In a preferred embodiment of the present application, the PCR detection primer pair consists of an upstream primer with the nucleotide sequence shown in SEQ ID No. 3 and a downstream primer with the nucleotide sequence shown in SEQ ID No. 4.
[0041] Another aspect of the present application is to apply the molecular marker, the PCR detection primer pair and the PCR kit to predict the sensitivity or resistance of Chenopodium to PS II inhibitor herbicides.
[0042] For reference, the present application further provides a PCR identification method for predicting the sensitivity or resistance of Chenopodium to PS II inhibitor herbicides, comprising: (1) establishing a PCR amplification system using the genomic DNA of Chenopodium to be detected as a template and the PCR detection primer pair to perform PCR amplification; (2) after obtaining the PCR amplification product, performing sequencing; if the 371th base of the amplification product is C, the Chenopodium to be detected shows sensitivity to PS II inhibitor herbicides; if the 371th base of the amplification product is A, the Chenopodium to be detected shows resistance to PS II inhibitor herbicides.
[0043] In a preferred embodiment of the present application, the PCR amplification system is as follows: 1 μL of each of the upstream and downstream primers, 1 U of Taq DNA polymerase, 2 μL of 25 mM Mg 2+ 2, 2 μL of DNA template, 1 μL of 2.5 mM dNTPs and double-distilled water to 50 μL.
[0044] In a preferred embodiment of the present application, the PCR amplification conditions are as follows: pre-denaturation at 95℃ for 4 min, denaturation at 95℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 1 min, 35 cycles, extension at 72℃ for 5 min and preservation at 4℃.
[0045] The DNA sequence of the Chenopodium album having different resistance to the PS II inhibitor herbicide is screened and compared to find a mutation site causing the resistance to the PS II inhibitor herbicide, and a specific PCR detection primer pair is designed according to the mutation site, and the Chenopodium album having the resistance to the PS II inhibitor herbicide is determined psbA The mutation site and the amino acid mutation type are found, and on this basis, the PCR kit and the prediction method of the Chenopodium album having the resistance to the PS II inhibitor herbicide are established. The PCR kit or the prediction method can be used to quickly and accurately predict the sensitivity or the resistance of the Chenopodium album to the PS II inhibitor herbicide, and can be used to determine whether the PS II inhibitor herbicide can be continuously used to prevent and control the resistant Chenopodium album in the field, and has the advantages of simple operation, fast speed, low cost, high accuracy and the like. BRIEF DESCRIPTION OF DRAWINGS
[0046] Figure 1 Fig. 4 is a PCR amplification result diagram of the four primer pairs; wherein M is a DNA Marker DL2000; 1 is a PCR amplification band of the primer pair psbA-1f / 1r; 2 is a PCR amplification band of the primer pair psbA-2f / 2r; 3 is a PCR amplification band of the primer pair psbA-3f / 3r; and 4 is a PCR amplification band of the primer pair psbA-4f / 4r.
[0047] Figure 2 Fig. 6 is a sensitivity detection result of the PCR primer pair (psbA-1f / 1r).
[0048] Figure 3 Fig. 7 is an electrophoresis diagram of the PCR amplification product of the primer pair (psbA-1f / 1r) for different Chenopodium album populations; M: DL2000 DNA Marker (100-2000 bp); lanes 1-18 represent the amplification products of 18 Chenopodium album samples collected from Heilongjiang, Inner Mongolia and Xinjiang, etc.
[0049] Figure 4 Fig. 8 is a Chenopodium album population having the sensitivity or the resistance to the PS II inhibitor herbicide psbA Fig. 9 is a comparison result diagram of the 371th base of the gene; wherein S is a Chenopodium album population having the sensitivity to the PS II inhibitor herbicide psbA Fig. 10 is a result diagram of the 270th amino acid of the protein coded by the gene (the coding product of TCT is serine); R is a Chenopodium album population having the resistance to the PS II inhibitor herbicide psbA Fig. 11 is a result diagram of the 270th amino acid of the protein coded by the gene (the coding product of TAT is tyrosine). DETAILED DESCRIPTION
[0050] The present application will be further described in conjunction with specific examples or experimental examples, and the advantages and features of the present application will become more apparent as the description proceeds. However, it should be understood that the examples or experimental examples are merely exemplary and do not constitute any limitation on the scope of the present application. It should be understood by those skilled in the art that the details and forms of the technical solutions of the present application can be modified or replaced without departing from the spirit and scope of the present application, and such modifications or replacements all fall within the protection scope of the present application.
[0051] Example 1 Establishment of a method for detecting the resistance of Chenopodium album to PS II inhibitor herbicides
[0052] 1 Extraction of Chenopodium album genomic DNA
[0053] Take 100 mg of Chenopodium album leaf, grind thoroughly in liquid nitrogen, and extract Chenopodium album genomic DNA by CTAB method. The DNA concentration needs to be greater than 2 ng / µL.
[0054] 2 Primer design and synthesis
[0055] Based on the nucleotide sequence of the psbA gene of Chenopodium album plants recorded in GenBank (accession number: YP_009380194.1), multiple pairs of specific primers were carefully designed using Oligo 9 software and sent to the company for synthesis. The nucleotide sequences of the multiple pairs of specific primers are as follows:
[0056] psbA-1f: AGCCTTCATTGCTGCTCCTC (SEQ ID No. 3);
[0057] psbA-1r: GCCCGAATCTGTAACCCTCA (SEQ ID No. 4).
[0058] psbA-2f: GACGCATACCCAGACGGAAA (SEQ ID No. 5);
[0059] psbA-2r: TGGTTATACAACGGTGGTCCT (SEQ ID No. 6).
[0060] psbA-3f: AACCGGAGCCGAATATGCAA (SEQ ID No. 7);
[0061] psbA-3r: GTGGTTATACAACGGTGGTCCT (SEQ ID No. 8).
[0062] psbA-4f: TTTCCGTCTGGGTATGCGTC (SEQ ID No. 9);
[0063] psbA-4r: AGATGGAGCTTCGATAGCGG (SEQ ID No. 10).
[0064] Figure 1 To present the results of the multi-pair specific primer screening experiment, lanes 1-4 show the PCR amplification results of primer pairs psbA-1f / 1r, psbA-2f / 2r, psbA-3f / 3r, and psbA-4f / 4r, respectively. Electrophoresis results showed that primer pair psbA-1f / 1r not only exhibited high amplification specificity but also significantly high amplification efficiency. Therefore, primer pair psbA-1f / 1r was selected as the optimal primer pair for this invention.
[0065] 3. Used for detecting quinoa psbA PCR reaction system for gene mutation sites
[0066] The PCR reaction system consisted of: 5 µL of 10×PCR reaction buffer, 2 µL of dNTPs (2.5 mM), 1 µL each of forward and reverse primers, 1 U of Taq DNA polymerase, 2 µL of template DNA, and double-distilled water to a final volume of 50 µL.
[0067] 4. Used to amplify quinoa psbA Gene response program
[0068] The PCR amplification reaction conditions were as follows: 95℃ pre-denaturation for 4 min, 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles, 72℃ extension for 5 min, and storage at 4℃.
[0069] 5. Identification and sequencing of PCR products
[0070] PCR amplification products were analyzed using 1% agarose gel electrophoresis and then sent to the company for sequencing to determine their suitability for PS II inhibitor-resistant or susceptible lambsquarters populations. psbA After gene sequencing, sequence alignment analysis is performed to find... psbA Mutation site.
[0071] 6. PCR reaction sensitivity test
[0072] The extracted quinoa DNA was diluted to 5 ng / µL, and 0µL, 0.5µL, 1µL, 1.5µL and 2µL of quinoa DNA were used as templates for PCR amplification. The sensitivity of the PCR reaction was then tested.
[0073] according to Figure 2 The sensitivity test results show that when the template volume is 2 µL, the PCR product bands are clear, indicating that... psbAThe gene amplification was successful. The amount of DNA of Chenopodium album for detection was calculated to be not less than 10 ng.
[0074] Test Example 1: Chenopodium album resistant to PS II inhibitor herbicides psbA Gene mutation site determination test
[0075] Eighteen samples of suspected resistance collected from different soybean fields in Heilongjiang, Inner Mongolia and Xinjiang were each taken about 200 mg of Chenopodium album leaves and quickly added to liquid nitrogen for grinding. The CTAB method was used to extract genomic DNA, and the DNA concentration needed to be greater than 5 ng / µL. The test method was referred to Example 1. The DNA extraction concentration of each sample was uniformly diluted to 50 ng / µL, and the sample amount was 10 µL. Each sample successfully amplified a specific band of about 615 bp ( Figure 3 ), indicating that the designed primer had good universality and amplification efficiency.
[0076] The PCR products were sequenced, and the mutation sites were found by comparison; the test results are shown in Table 1 and Figure 4 .
[0077] Table 1: Detection of different Chenopodium album populations by PCR identification method psbA Gene mutation site
[0078]
[0079] The results showed that the psbA gene of the 18 Chenopodium album samples resistant to PS II inhibitor herbicides was mutated from C to A at the 371st base, resulting in a mutation from serine to tyrosine, which changed the Chenopodium album from being sensitive to PS II inhibitor herbicides to being resistant to PS II inhibitor herbicides.
[0080] Test Example 2 psbA Significant correlation verification of C→A mutation at the 371st base of the gene and PS II inhibitor herbicide resistance phenotype
[0081] 1. Test method
[0082] 1.1 Material collection and genotyping
[0083] A total of 110 samples of Chenopodium album were collected from Northeast, North China and Northwest China;
[0084] The psbA-1f / 1r primer pair in Example 1 was used to amplify the target fragment, and Sanger sequencing was performed;
[0085] According to the different bases at the 371st base, the samples were divided into: wild type (C) and mutant type (A). psbA52 strains; mutant type (the 371th base of the gene is A): 58 strains; excluding other mutant individuals, ensuring the uniqueness of the mutation site. psbA
[0086] 1.2 Herbicide treatment
[0087] All samples were uniformly potted and cultured indoors, and treated at the 3-4 leaf stage. A recommended dose of bentazone (a representative PS II inhibitor) was used for one-time spraying. After spraying, the temperature and humidity were kept constant, and the phenotype was recorded after 14 days.
[0088] 1.3 Phenotype determination criteria
[0089] Resistance score criteria: 0 (complete death) to 9 (good growth);
[0090] Survival statistics criteria: resistant: survival and recovery; sensitive: yellowing or death.
[0091] 2 Test results
[0092] The statistical and significant analysis results of the phenotype and genotype are shown in Table 2.
[0093] Table 2 psbA Analysis of the correlation between the mutation of the 371th base of the gene and the phenotype of PS II inhibitor herbicide resistance
[0094]
[0095] The difference in survival rate was significant (P<0.01) by chi-square test (x 2 test) analysis;
[0096] The difference in resistance score was also significant (P<0.01) by t-test analysis;
[0097] According to the test results in Table 2, it can be seen that psbA there is a statistically significant correlation between the C→A mutation at the 371th base of the gene and the herbicide resistance phenotype.
[0098] The above test results further prove psbA that the mutation of the gene (371th C→A) can be used as psbA a gene-mediated PSII inhibitor herbicide resistance molecular marker, which is helpful for molecular detection and field resistance monitoring.
Claims
1. The use of a reagent for detecting a molecular marker locus associated with resistance to PS II inhibitor herbicides in Chenopodium quinoa, said molecular marker locus being located at base number 371 of the nucleotide sequence shown in SEQ ID No. 2, which is mutated from C to A, and the phenotype for resistance to PS II inhibitor herbicides; comprising: (1) extracting DNA of the sample to be detected; (2) designing a pair of PCR detection primers according to the nucleotide sequence of the molecular marker site; (3) establishing a PCR amplification system using the designed pair of PCR detection primers to perform PCR amplification; (4) after obtaining the PCR amplification product, sequencing is performed, if the 371th base of the amplification product is C, then the sample to be detected is sensitive to PS II inhibitor herbicides; if the 371th base of the amplification product is A, then the sample to be detected is resistant to PS II inhibitor herbicides.
2. Application of a pair of PCR detection primers in detecting the resistance of Chenopodium album to PS II inhibitor herbicides, wherein the pair of PCR detection primers is used to detect a molecular marker site associated with the resistance of Chenopodium album to PS II inhibitor herbicides, the molecular marker site is located at the 371th base of the nucleotide sequence shown in SEQ ID No. 2, the base is mutated from C to A, and the phenotype for PS II inhibitor herbicides is resistance; the pair of PCR detection primers consists of an upstream primer with a nucleotide sequence shown in SEQ ID No. 3 and a downstream primer with a nucleotide sequence shown in SEQ ID No.
4.
3. A method of predicting the sensitivity or resistance of Chenopodium to a PS II inhibitor herbicide, characterized in that, including: (1) using the genomic DNA of the sample to be detected as a template and establishing a PCR amplification system using a pair of PCR detection primers to perform PCR amplification; (2) after obtaining the PCR amplification product, sequencing is performed, if the 371th base of the amplification product is C, then the sample to be detected is sensitive to PS II inhibitor herbicides; if the 371th base of the amplification product is A, then the sample to be detected is resistant to PS II inhibitor herbicides; the pair of PCR detection primers is used to detect a molecular marker site associated with the resistance of Chenopodium album to PS II inhibitor herbicides, the molecular marker site is located at the 371th base of the nucleotide sequence shown in SEQ ID No. 2, the base is mutated from C to A, and the phenotype for PS II inhibitor herbicides is resistance; the pair of PCR detection primers consists of an upstream primer with a nucleotide sequence shown in SEQ ID No. 3 and a downstream primer with a nucleotide sequence shown in SEQ ID No.
4.
4. The method of claim 3, wherein, The PCR amplification system is as follows: 1 μL of each of the upstream and downstream primers, 1 U of Taq DNA polymerase, 2 μL of 25 mM Mg 2+ 2 μL; 2 μL of DNA template, 1 μL of 2.5 mM dNTPs, and double distilled water added to 50 μL; The PCR amplification conditions are as follows: pre-denaturation at 95℃ for 4 min, denaturation at 95℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 1 min, 35 cycles, extension at 72℃ for 5 min, and preservation at 4℃.
5. Use of a PCR kit in predicting the susceptibility or resistance of Chenopodium to PS II inhibitor herbicides; said PCR kit comprising: Taq enzyme, dNTP, Mg 2+ ddH2O and a PCR detection primer pair; the PCR detection primer pair is used for detecting a molecular marker site associated with resistance to PSII inhibitor herbicide, the molecular marker site is at base 371 of the nucleotide sequence shown in SEQ ID No. 2, which is mutated from C to A, and the phenotype for PSII inhibitor herbicide is resistance; the PCR detection primer pair consists of an upstream primer with the nucleotide sequence shown in SEQ ID No. 3 and a downstream primer with the nucleotide sequence shown in SEQ ID No. 4.
Citation Information
Patent Citations
PCR detection method of photosystem II inhibitor herbicide resistant digitaria sanguinalis
CN106119369A
Chenopodium quinoa willd CqARF2 gene mutant as well as identification method and application thereof
CN120591297A