Reagent card box for detecting SFTSV, Erhi body and Lyme disease spirochetes

Abstract

The invention relates to a reagent card box for detecting spirochetes of severe fever with thrombocytopenia syndrome virus, Erhi and Lyme disease, relates to the technical field of molecular biology detection, and comprises a primer probe composition for detecting spirochetes of severe fever with thrombocytopenia syndrome virus, Erhi and Lyme disease, and a kit for detecting spirochetes of severe fever with thrombocytopenia syndrome virus, Erhi and Lyme disease. The primer and the probe for detecting the severe fever with thrombocytopenia syndrome virus comprise a forward primer as shown in SEQ ID NO: 1, a reverse primer as shown in SEQ ID NO: 2 and a probe as shown in SEQ ID NO: 9, the primer and the probe used for Escherichia coli detection comprise a forward primer shown in SEQ ID NO: 3, a reverse primer shown in SEQ ID NO: 4 and a probe shown in SEQ ID NO: 10. The primer and the probe for lyme disease spirochete detection comprise a forward primer of SEQ ID NO: 5, a reverse primer of SEQ ID NO: 6 and a probe of SEQ ID NO: 11. The reagent card box disclosed by the invention adopts a POCT (Point-of-Care Testing) technology to carry out multiple real-time fluorescent PCR amplification detection on nucleic acids of the severe fever with thrombocytopenia syndrome virus, the Escherichia body and the Lyme disease spirochetes, and has timeliness, closeness, accuracy and convenience.

Description

Technical Field

[0001] This application relates to the field of molecular biology detection, and in particular to a reagent cartridge for the detection of SFTSV, Ehrlich assemblica and Lyme disease spirochetes. Background Technology

[0002] Ticks are the second leading vector of infectious diseases after mosquitoes, capable of transmitting various zoonotic diseases and posing a significant threat. Tick-borne pathogens include Severe Fever with Thrombocytopenia Syndrome Virus (SFTSV), Ehrlichella, and Lyme disease spirochetes. SFTSV belongs to the family Phenuiviridae, genus Bandavirus, and is classified as Dabie Banda Virus (DBV), a single-stranded RNA virus. Severe fever with thrombocytopenia syndrome (SFTSV) typically refers to an acute zoonotic disease caused by SFTSV infection. This disease is sporadic in mountainous and hilly areas, predominantly in summer and autumn, and is often associated with tick bites. The clinical symptoms of SFTSV infection, besides high fever and thrombocytopenia, mainly include gastrointestinal disorders, leukopenia, and bleeding tendency. Currently, routine diagnostic methods for SFTSV infection typically include virus isolation and culture, serological testing, and nucleic acid molecular detection. Human ehrlichiosis, also known as Rocky Mountain spotted fever without spots, is caused by Ehrlichia transmitted by ticks. It presents with sudden onset, chills, high fever, often accompanied by bradycardia (<90 beats / min), headache, muscle pain, nausea, vomiting, fatigue, and malaise. Examination reveals leukopenia, thrombocytopenia, hepatocellular damage, and abnormal liver function. Ehrlichiosis can be diagnosed through serological testing, PCR technology, immunofluorescence assays, and bacterial culture. Lyme disease is an infectious disease caused by infection with Lyme disease spirochetes (Borrelia burgdorferi), also known as a tick-borne disease. It is characterized by its primary vector, the tick, and is common in parts of the Americas, Europe, and Asia. Early localized lesions of Lyme disease typically appear 3–32 days after infection, presenting as skin symptoms such as red patches and spreading red rings, accompanied by fever, fatigue, and muscle pain. Lyme disease can generally be diagnosed through serological tests, complete blood counts, and examination for *Borrelia burgdorferi*.

[0003] While the methods described above may offer good clinical value, they suffer from drawbacks such as being time-consuming, cumbersome, having low sensitivity, causing immune cross-reactivity, and requiring expensive specialized equipment, thus hindering their widespread clinical adoption. Conventional PCR testing kits also present limitations for primary care laboratories: 1) they require specialized personnel and a biosafety level 2 laboratory; 2) specific nucleic acid extraction methods and conditions are prone to contamination and prolong the process; 3) single-sample testing kits for SFTSV, Ehrlich ascites, and Lyme disease spirochetes are time-consuming and labor-intensive for large-scale sample testing; 4) they cannot perform multiple tests per tube, requiring users to prepare reaction solutions according to specific formulas, demanding strict operational skills.

[0004] Therefore, there is an urgent need in this field to develop a time-saving, labor-saving, and highly sensitive POCT kit for the simultaneous detection of SFTSV, Ehrlich assemblica, and Lyme disease spirochetes. Summary of the Invention

[0005] The purpose of this application is to provide a time-saving, labor-saving, and highly sensitive reagent cartridge for the simultaneous detection of SFTSV, Ehrlich assemblica, and Lyme disease spirochetes. It is particularly suitable for the rapid detection of clinical samples from patients with cross-infection or mixed infection of SFTSV, Ehrlich assemblica, and Lyme disease spirochetes, and is of great significance for the prevention and control of the epidemic.

[0006] In a first aspect, this application provides a primer and probe composition for the detection of SFTSV, Ehrlich assemblica, and Lyme disease spirochetes. The primers and probes for SFTSV detection include: forward primer: SEQ ID NO:1, reverse primer: SEQ ID NO:2, and probe: SEQ ID NO:9; the primers and probes for Ehrlich assemblica detection include: forward primer: SEQ ID NO:3, reverse primer: SEQ ID NO:4, and probe: SEQ ID NO:10; and the primers and probes for Lyme disease spirochetes detection include: forward primer: SEQ ID NO:5, reverse primer: SEQ ID NO:6, and probe: SEQ ID NO:11.

[0007] Optionally, the primer-probe composition further includes an internal standard primer and probe, wherein the internal standard primer and probe include: forward primer: SEQ ID NO:7, reverse primer: SEQ ID NO:8, and probe: SEQ ID NO:12.

[0008] Optionally, the 5' end of the probe includes a fluorescent reporter group, which is selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3 or CY5.

[0009] Optionally, the 3' end of the probe includes a fluorescence quenching group selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, DABCYL, or MGB.

[0010] Secondly, this application provides a reagent cartridge for the detection of SFTSV, Ehrlich assemblica and Lyme disease spirochetes, comprising the primer and probe composition described in the first aspect.

[0011] Optionally, the reagent cartridge is provided with a lysis buffer area, a washing buffer area, and an amplification area from top to bottom; the lysis buffer area contains lysis buffer, the washing buffer area contains washing buffer, and the amplification area contains PCR reaction solution and the primer and probe composition described in the first aspect.

[0012] Optionally, the PCR reaction solution includes a thermostable DNA polymerase with reverse transcription activity.

[0013] Optionally, the DNA polymerase is Tth DNA polymerase or rTth DNA polymerase.

[0014] Optionally, the PCR reaction solution is Hotstart Onestep RT-PCR Master Mix.

[0015] Optionally, the volume ratio of the PCR reaction solution to the primer-probe composition is 3-4:2-3.

[0016] Optionally, the amplification region further includes an encapsulation region, which encapsulates the internal standard (IC) and Mn using a fusible material. 2+ The encapsulation fluid.

[0017] Optionally, the fusible material is selected from any one or more of paraffin, dodecane, tetradecane, and hexadecane.

[0018] This technical solution allows for the encapsulation of Mn at low temperatures. 2+ And IC, the Mn inside after high temperature melting 2+ IC can be mixed with PCR reaction solution. When used, it melts to form paraffin oil, which can prevent PCR products from forming aerosols and polluting the environment. Paraffin oil has low thermal conductivity, which can effectively ensure the temperature conditions for PCR. Its low-temperature solidification characteristics can fix the position of the magnetic beads after the temperature drops during the pullback.

[0019] Optionally, the encapsulation fluid mainly consists of 2-400 mM Mn 2+ It is composed of IC and trehalose.

[0020] Optionally, the Mn 2+ It comes from any one or more of manganese sulfate, manganese acetate, and manganese chloride.

[0021] Optionally, the internal standard is synthetic DNA adapted to the internal standard primer and probe.

[0022] Optionally, the sequence of the internal standard is shown in SEQ ID NO:28, and the sequence is cloned from the PUC57 plasmid.

[0023] Optionally, the lysis buffer includes GTC, NaAc, NaCl, SDS, NP-40, Triton X-100, and PEG8000.

[0024] Optionally, the concentration of GTC is 0.8M-1.5M.

[0025] Optionally, the lysis buffer consists of 0.8M GTC, 0.5M NaAc, 1.0M NaCl, 1% SDS, 5% NP-40, 1% Triton X-100 and 2% PEG8000.

[0026] Optionally, the pH of the lysis solution is adjusted to 5.0–7.0 using acetic acid.

[0027] Optionally, the washing solution consists of Tris-HCl, KCl, PEG, and optionally BSA.

[0028] Optionally, the pH of the washing solution is adjusted to 5.0–8.0 using acetic acid.

[0029] Thirdly, this application provides a detection kit for SFTSV, Ehrlich assemblica, and Lyme disease spirochetes, comprising the cartridge of the second aspect, as well as positive and negative control samples.

[0030] Optionally, the positive control is a diluted solution of engineered bacteria containing inactivated plasmids of the target gene sequence for the detection of fever with thrombocytopenia syndrome virus, Ehrlich, and Lyme spirochetes.

[0031] Optionally, the negative control product is pure water.

[0032] Fourthly, this application provides a detection method based on the reagent cartridge of the second aspect, the steps of which are as follows: 1. Collect samples and process them using reagent cartridges; 2. Real-time quantitative RT-PCR amplification; 3. Interpretation of test results.

[0033] Optionally, the sample may be derived from whole blood, plasma, or serum.

[0034] Optionally, the RT-PCR amplification procedure is as follows: In summary, this application includes at least one of the following beneficial technical effects: This invention employs point-of-care testing (POCT) technology for multiplex real-time fluorescent RT-PCR amplification of the nucleic acids of fever with thrombocytopenia syndrome virus (FPSV), Ehrlich's bacillus, and Lyme spirochetes. Simultaneously, it identifies the nucleic acids of FPSV, Ehrlich's bacillus, and Lyme spirochetes based on the amplification results of the labeled three-color fluorescence. It also includes internal quality control functions to prevent false negatives and ensure the accuracy of sample collection and purification processes. The POCT reagent cartridge of this invention can be widely used for sample detection and laboratory diagnosis of patients with FPSV, Ehrlich's bacillus, and Lyme disease caused by FPSV, Ehrlich's bacillus, and Lyme spirochetes, as well as suspected FPSV, Ehrlich's bacillus, and Lyme spirochetes infections. It is particularly suitable for rapid clinical sample detection in patients with cross-infection or mixed infection of FPSV, Ehrlich's bacillus, and Lyme spirochetes, and has significant implications for epidemic prevention and control, as detailed below: 1. Fully Enclosed Modular Design: The microfluidic cartridge's automated control and multi-layered anti-contamination structure integrates nucleic acid extraction, amplification, and detection processes within a fully enclosed cartridge, structurally eliminating aerosol contamination, protecting the safety of testing personnel, and eliminating the need for a PCR laboratory. This significantly reduces the requirements for laboratory construction standards in nucleic acid testing and eliminates equipment contamination problems caused by nucleic acid extraction. 2. Timeliness: The integrated nucleic acid extraction and amplification technology and automatic judgment software allow the detection process to produce results in just 70-90 minutes, truly achieving full automation from sample processing to result reporting. Furthermore, it enables the identification of fever with thrombocytopenia syndrome virus, Ehrlich aspergillus, and Lyme spirochetes by RT-PCR single-well and single-fluorescence detection channel, greatly reducing the professional skills required of laboratory personnel, improving detection efficiency, and making it suitable for rapid clinical diagnosis. 3. Accuracy: Dedicated primers and probes are designed specifically for the nucleic acid sequences of three viruses: Fever with Thrombocytopenia Syndrome Virus (FTSV), Ehrlich, and Lyme Treponema, ensuring the specificity and sensitivity of the detection. Simultaneously, it can reflect the infection status of FTSV, Ehrlich, and Lyme Treponema in the sample and confirm which of the three viruses is causing the infection. It can be used for the monitoring, prevention, and clinical diagnosis of FTSV, Ehrlich, and Lyme Treponema, contributing to the early diagnosis and treatment of FTSV, Ehrlich, and Lyme Treponema infections. 4. Convenience: Stored at 2-8℃, eliminating the need for conventional -20℃ freezing, which helps with cold chain transportation and preservation of products. Attached Figure Description

[0035] Figure 1 This is a schematic diagram of the integrated reagent card holder of the present invention; Figure 2 This is a schematic diagram illustrating the use of the integrated reagent card holder provided in an embodiment of the present invention; Figure 3 Figure showing the results (relative efficiency) of high-temperature accelerated aging of card cartridges with different designs; Figure 4 The graph shows the comparison results of different pyrolysis solutions; Figure 5 The image shows the detection results of a fully automated nucleic acid detection analyzer using three primer and probe combinations for SFTSV. Figure 6 The image shows the detection results of a fully automated nucleic acid detection analyzer using a combination of three primers and probes for Ehrlich bodies. Figure 7 This image shows the detection results of a fully automated nucleic acid detection analyzer using a combination of three primers and probes for Lyme spirochetes. Detailed Implementation

[0036] To more clearly demonstrate the objectives, technical solutions, technical effects, and advantages of this invention, specific embodiments are further described below. The specific embodiments described herein are merely illustrative of this invention and are not intended to limit the invention. The invention is further illustrated below with reference to specific examples.

[0037] In this document, "reagent cartridge" refers to a fully automated nucleic acid extraction, amplification, and diagnostic integrated microfluidic cartridge. In this application, it is also referred to as "POCT reagent cartridge," "integrated reagent cartridge," "cartridge," or "microfluidic cartridge."

[0038] In this paper, "point-of-care testing (POCT)" is a new integrated gene analysis technology that combines nucleic acid extraction, real-time fluorescence gene detection and microfluidic reagent cartridges. It only requires manual sample addition, and the subsequent nucleic acid extraction, detection and analysis processes are all completed by the machine. It realizes a fully closed and automated output from sample to gene detection results. It has the characteristics of simple operation, high specificity, low cost, fast speed and accurate results.

[0039] Example 1 Primer and probe design and synthesis Targeting the latest known sequences of fever with thrombocytopenia syndrome virus, Ehrlich aspergillus, and Lyme spirochetes from NCBI, upstream-specific primers, downstream-specific primers, and TaqMan fluorescent probes were designed. The internal control (IC) was a synthetic DNA sequence: ttgcaga tttggacctg cgagcgggtt ctgacctgaa ggctctgcgcggacttgtgg agacagccgc tcaccttggc tattcagtt (SEQ ID NO:28). This IC sequence was cloned onto the PUC57 plasmid; the IC primers and probes were adapted to it for differentiation from the target gene signal.

[0040] The primers include: The upstream primer for the virus of fever with thrombocytopenia syndrome: 5'-CAAGGGAGCGGAAATATGAA-3' (SEQ ID NO: 1); Downstream primer for fever with thrombocytopenia syndrome virus: 5'-GGTTCACTGCAGGAAGAAGC-3' (SEQ ID NO: 2); Ehrlich body upstream primer: 5'-CTTAGGGATGCCGTTCAGAG-3' (SEQ ID NO:3); Ehrlich body downstream primer: 5'-ATCCGAATGCGCAACTATTC-3' (SEQ ID NO:4); upstream primer for Lyme spirochete: 5'-GTTATTGGAGCCGATCAGGA-3' (SEQ ID NO:5); Lyme spirochete downstream primer: 5'-CTTTTCCACCTTCCCAAACA-3' (SEQ ID NO: 6); Internal standard upstream primer: 5'-AGATTTGGACCTGCGAGCG-3' (SEQ ID NO:7); Internal standard downstream primers: 5'-GAGCGGCTGTCTCCACAAGT-3' (SEQ ID NO: 8); The TaqMan fluorescent probes are labeled with a three-color combination of fluorescent markers to achieve multiplex real-time fluorescent PCR amplification, including: Viral probe for fever with thrombocytopenia syndrome: 5'-GGAATGTGTCACAACTGGGAGGGC-3' (SEQ ID NO: 9); Ehrlich body probe: 5'-CCGAGTCAAGAGAGGAAGGGCA-3' (SEQ ID NO: 10); Lyme spirochete probe: 5'-GGGACGCATTGTATTTGATTACTGGCG-3' (SEQ ID NO:11); Internal standard probe: 5'-TTCTGACCTGAAGGCTCTGCGCG-3' (SEQ ID NO: 12); The 5' end of the probe is labeled with fluorescent reporter groups FAM, ROX, CY5 and HEX, respectively, and the 3' end of the probe contains a fluorescent quencher group BHQ1.

[0041] Example 2: Establishment of the Reagent Cartridge 2.1 Assembly of reagent card boxes A POCT reagent cartridge for detecting viruses, Ehrlich ascites, and Lyme spirochetes in patients with fever and thrombocytopenia syndrome. Figure 1 As shown, the assembly steps are as follows: (1) Dispensing PCR reaction solution and primer-probe composition of Example 1: Dispense 20 μL of PCR reaction solution and 15 μL of primer-probe composition into the bottom of the amplification region; (2) Embedding manganese ion solution and IC: 5 μL of encapsulation solution was embedded in the paraffin-encapsulated area (the upper layer of the PCR reaction solution) with paraffin; (3) Sealing: Seal the reaction solution with an appropriate amount of silicone oil; (4) Dispensing washing solution 2: Dispense 140μL of washing solution 2 into washing solution 2; (5) Sealing: Seal the washing solution 2 with an appropriate amount of silicone oil; (6) Dispensing washing solution 1: Dispense 140μL of washing solution 1 into washing solution 1; (7) Sealing: Seal the washing solution 1 with an appropriate amount of silicone oil; (8) Dispensing the lysis buffer: Dispense 800 μL of lysis buffer into the lysis buffer section.

[0042] 2.2 Reagents in the reagent cartridge 2.2.1 The specific components of the lysis buffer are as follows: GTC 0.8M NaAc 0.5M NaCl 1.0M SDS 1％ NP-40 5％ Triton X-100 (TX-100) 1％ PEG8000 2％ 2.2.2 The specific components of washing solution 1 are as follows: Tris-HCl (pH 8.3) 100mM KCl 100mM PEG 2％ 2.2.3 The specific components of washing solution 2 are as follows: Tris-HCl (pH 8.3) 100mM KCl 100mM PEG 2％ BSA 1.8％ 2.2.4 The PCR reaction solution was Hotstart Onestep RT-PCR Master Mix (from Hangzhou Suizeng Biotechnology Co., Ltd., product model B0027). Hotstart Onestep RT-PCR Master Mix mainly contains HotStartrTth enzyme, which is active in Mn... 2+ Under activated conditions, it exhibits highly efficient amplification activity.

[0043] The primer-probe composition is as follows: 2.2.5 The specific components of the encapsulation fluid are as follows: Components concentration <![CDATA[Manganese(II) acetate tetrahydrate (CH3COO)2Mn·4H2O]]> 2.5mM Trehalose 1％ Internal standard template DNA (IC) 1-5 ng / μl It should be understood that, depending on the different experimental needs, the specifications of each component in the embodiments of the present invention can be adjusted according to the above-mentioned content.

[0044] Example 3: Detection method based on reagent cartridges Rapid typing and identification were performed using a POCT reagent cartridge for detecting fever with thrombocytopenia syndrome virus, Ehrlich assemblica and Lyme spirochetes, as described in Example 2.

[0045] 3.1 Use of the test card box Whole blood samples were collected from individuals within 5 days of the onset of illness using anticoagulant blood collection tubes. Figure 2 As shown, open the lid of the card box, then open the sealing film, add 10 μL of magnetic beads (shake to fully suspend them before use), then add 200 μL of sample, mix the reagents by pipetting, and then tighten the lid.

[0046] 3.2 Real-time fluorescent PCR instant detection The cartridge from Example 3.1 was subjected to fully automated RT-PCR nucleic acid extraction and amplification using the Life Ready K1000 fully automated nucleic acid detection instrument. The PCR amplification products were analyzed using a fully automated nucleic acid detection and analysis system, and the results were determined by combining the amplification curve and Ct value.

[0047] The fluorescence channel settings are as follows: The RT-PCR amplification program is set as follows: 3.3 Interpretation of test results After the testing procedure is completed, the instrument will automatically report the test results. The results will show the detection results for Fever with Thrombocytopenia Syndrome Virus (FAM), Ehrlich Aspergillus (ROX), Lyme Treponema pallidum (Cy5), and internal quality control (HEX). If the results for FAM, ROX, and / or Cy5 show a clear S-shaped amplification curve (including an S-curve that has not reached the plateau phase), and Ct ≤ 38, then the corresponding result is considered positive. If all three fluorescences (FAM, ROX, Cy5) are negative and the internal quality control (HEX) Ct ≤ 38, then the corresponding result is considered negative. The internal standard HEX fluorescence channel test result should show a clear S-shaped amplification curve (including an S-curve that has not reached the plateau phase); otherwise, resampling and testing are required.

[0048] Example 4: Sensitivity and Specificity Testing Based on Reagent Cartridges 4.1 Specificity test The method described in Example 3 was used to verify positive nucleic acids in samples of target pathogens (Fever with Thrombocytopenia Syndrome Virus (SFT), Ehrlich, and Lym) and to specifically detect nucleic acids in samples of non-target pathogens (Dengue Virus, Yellow Fever Virus, HBV, HCV, Tick-borne Encephalitis Virus, New Bunyavirus, and Crimean-Congo Hemorrhagic Fever Virus). All tests for target pathogens were positive, while all tests for other non-target pathogens were negative. These results indicate that the method has good specificity, with a specificity of 100%.

[0049] 4.2 Sensitivity Test The method described in Example 3 was used to test positive control samples (inactivated diluted plasmid-engineered bacteria containing the target gene sequence of fever with thrombocytopenia syndrome virus, Ehrlich, and Lyme spirochetes) at different concentrations. The test results are shown in Tables 1, 2 and 3.

[0050] Table 1 Table 2 Table 3 According to the guidelines for performance analysis of IVD products issued by the China Food and Drug Administration, the data in Tables 1, 2, and 3 were statistically analyzed using Probit regression. The limit of detection (LOD) was set at the 95% detection rate. The results are as follows: LOD for fever with thrombocytopenia syndrome virus: 117.979 copies / ml, 95% confidence limit: 80.019 to 646.527 copies / ml; LOD for Ehrlich aspergillus: 153.027 copies / ml, 95% confidence limit: 100.696 to 840.944 copies / ml; LOD for Lyme spirochetes: 166.809 copies / ml, 95% confidence limit: 119.315 to 390.782 copies / ml.

[0051] Example 5: Detection of Clinical Samples Clinical samples from the Zhejiang Provincial Center for Disease Control and Prevention (CDC) were tested using the detection method described in Example 3, and the results were statistically analyzed against the known results from the CDC. The results are shown in Tables 4, 5, and 6. The detection results of the reagent cartridge prepared in this invention showed high consistency with the results confirmed by the Zhejiang Provincial CDC using conventional fluorescent PCR, with the same overall test concordance rate. However, compared to the control method, the integrated reagent cartridge prepared in this invention resulted in a shorter detection time and higher sensitivity.

[0052] Table 4 Table 5 Table 6 Example 6: Optimization of the IC Built into the Card Box Three pre-installed IC methods were designed: 1.1 The internal standard template DNA (IC), MnAC and trehalose are wrapped together in the paraffin-wrapped area. The elution and amplification area (also referred to as the amplification area in this application) is the PCR reaction solution and primers / probes. 1.2 Wrap IC, primers, probes, and trehalose together in a paraffin-wrapped area. The amplification area contains MnAC and PCR reaction solution. 1.3 Wrap MnAC and trehalose in the paraffin-wrapped area, and place IC, primers, probes, and PCR reaction solution in the amplification area.

[0053] Three experimental cartridges were prepared according to the above three designs (with Mn as the activating ion). 2+The PCR reaction solution was HotstartOnestep RT-PCR Master Mix. Each component was injected into the test cartridge (low / critical concentration of IC template was used to facilitate the detection of possible differences). Three test cartridges were designed according to methods 1.1, 1.2, and 1.3: IC cartridge 1, IC cartridge 2, and IC cartridge 3.

[0054] High-temperature accelerated aging test results: Each cartridge was repeated twice (e.g., cartridge 1 is recorded as cartridge 1-1 and cartridge 1-2), and the results are as follows. Figure 3 As shown, Figure 3 The efficiency standard of 100% was taken from the 0-day result of IC card box 1-1, and the relative efficiency was calculated based on the difference in Ct value (the larger the Ct, the lower the efficiency). The results show that IC card box 1 has the best efficiency, with almost no change in efficiency during the 56-day accelerated aging process; IC card box 2 has slightly worse preservation performance than IC card box 1; IC card box 3 is not effective, and its preservation performance cannot meet the established requirements.

[0055] The method for embedding the internal label in the card box should be to connect IC and Mn. 2+ They are encapsulated together in paraffin wax. When the detection program runs, the paraffin wax melts, and MnAC and IC are added to the amplification area. They are then mixed with the PCR reaction solution and primers / probes for fluorescent PCR amplification.

[0056] According to the conversion formula in the document "Basic Principles and Methods for Determining the Shelf Life of Medical Devices by Accelerated Aging Test" published in China Medical Device Information, Vol.14, No.5, 2008, it can be concluded that the cartridge designed in this application can be stably stored at 8℃ for at least 1 year, meeting the storage requirements of AIGS test cartridges.

[0057] Example 7: Optimization of the lysis buffer formulation When an excessive amount of whole blood is added, a large number of impurities such as hemoglobin are carried into the PCR reaction solution, inhibiting the amplification efficiency and potentially leading to false negatives (failure of internal standard IC gene detection).

[0058] Based on the goals of reducing protein adsorption and improving lysis efficiency, a new lysis buffer formulation was designed, as shown in Table 7: Table 7 Lysis binding buffers were prepared according to the designed formula and filled into cartridges. Genomic DNA from human whole blood samples was detected using IC primers and probes. Anticoagulated whole blood samples from within one week were used as samples, with a sample volume of 200 μl / cartridge.

[0059] Test results: Formulas 4-7 were ineffective and failed to detect; Formula 8 showed amplification, but at a lower efficiency and was not as effective as Formula 1. The results for formulations 1-3 (i.e., lysis buffer 1, lysis buffer 2, and lysis buffer 3) are as follows: Figure 4 As shown in Table 8, analysis of CT values ​​and amplification curves reveals that formulation 3 was ineffective, exhibiting low amplification efficiency and insufficient lysis capacity. Overall, formulation 2 demonstrated the best performance with stable amplification efficiency. Formulation 1, while less effective than 2, was significantly superior to the original lysis buffer formulation (100mM acetate-sodium acetate, 1wt% polyethylene glycol 8000, 3.5M GTC, 5wt% Tween-20, and 0.5wt% sodium lauryl sulfate). Typically, the direct loading volume for whole blood samples is ≤2μl, but after optimizing the lysis buffer formulation, the loading volume increased to ≥200μl, maintaining stable internal standard detection while preserving the POCT procedure for direct whole blood sample loading.

[0060] Table 8 Example 8: Screening of Primer-Probe Compositions The goal is to screen for the optimal primer-probe combination for the detection of febrile thrombocytopenic syndrome virus (SFTSV), Ehrlichia, and Borrelia burgdorferi, providing key parameters for the development of highly sensitive and specific detection kits.

[0061] 8.1 Primer and probe design SFTSV-specific primers and probes (3 sets): designed for conserved regions of the M fragment gene, each set contains an upstream primer, a downstream primer, and a FAM-labeled probe; Ehrlich body-specific primers and probes (3 sets): designed for the conserved region of 2-C-methyl-D-erythritol 2,4-cyclic diphosphate synthase, each set containing an upstream primer, a downstream primer and a ROX-labeled probe; Lyme spirochete-specific primers and probes (3 sets): designed for the conserved region of the bmpB gene encoding nucleoside ABC, each set contains an upstream primer, a downstream primer, and a CY5-labeled probe; Internal standard primers and probes: Designed for artificially synthesized internal standard genes, including upstream primers, downstream primers, and HEX-labeled probes (used to distinguish target signals from internal standard signals).

[0062] Specific target genes and internal standard primer and probe information are shown in Tables 9-12: Table 9. Primer and probe information for SFTSV target genes. Table 10 Primer and probe information for Ehrlich body target genes Table 11 Primer and probe information for Lyme spirochete target genes Table 12 Internal Standard Primer and Probe Information 8.2 Experimental Methods The sensitivity of primer-probe combinations was evaluated by comparing the amplification performance of low-concentration samples (200 μL) in different cartridges: detection cartridges were prepared using three sets of primers and probes each of SFTSV, Ehrlich bodies, and Lyme spirochetes → the three sets of primers and probes for the same nucleic acid were added to the same low-concentration sample → detection was performed using a fully automated nucleic acid detection analyzer. Evaluation metrics: Ct value (cycle threshold; the lower the Ct value, the higher the amplification efficiency) and fluorescence growth curve (the greater the slope of the fluorescence signal rise, the stronger the amplification efficiency).

[0063] 8.3 Test Results (1) Amplification efficiency detection results The results of the SFTSV three-primer-probe combination fully automated nucleic acid detection analyzer are as follows: Figure 5 As shown, the detection results of the fully automated nucleic acid detection analyzer using three primer-probe combinations for Ehrlich bodies are as follows: Figure 6 As shown; the detection results of the fully automated nucleic acid detection analyzer using three primer-probe combinations for Lyme spirochetes are as follows. Figure 7 As shown; according to Figure 6 and Figure 7 The results showed that all three sets of primers and probes for SFTSV, Ehrlich, and Lyme spirochetes could detect low-concentration samples. Among them, the optimal primer-probe combination for each pathogen showed a significant advantage in amplification efficiency: SFTSV combination 1, Ehrlich combination 1, and Lyme spirochetes combination 2 all showed the highest target gene fluorescence growth value and the largest fluorescence growth slope, and the amplification efficiency of these three combinations was the best when combined with the internal standard.

[0064] 1. Ct value results The Ct values ​​of the fully automated nucleic acid detection analyzer are statistically analyzed as shown in Table 13. From the Ct value results, the target gene and internal standard Ct values ​​of SFTSV and Ehrlich body primer-probe combination 1 are the lowest, and the target gene and internal standard Ct values ​​of Lyme spirochete primer-probe combination 2 are the lowest. It can be seen that the amplification effect of these three primer-probe combinations with the internal standard is the best, and they are the optimal combinations.

[0065] Table 13 Through the above screening process, the optimal primer-probe combination for the combined detection kit of SFTSV, Ehrlich, and Lyme spirochetes can be determined, ensuring high sensitivity, specificity, and suitability for automated operation in clinical applications. Specifically, the optimal primer-probe combination for SFTSV and Ehrlich is Combination 1, and the optimal primer-probe combination for Lyme spirochetes is Combination 2.

[0066] The embodiments described above are merely preferred embodiments of this application and are not intended to limit this application. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of this application should be included within the scope of protection of this application.

Claims

1. A primer-probe composition for the detection of SFTSV, Ehrlich aspergillus, and Lyme disease spirochetes, characterized in that, The primers and probes used for SFTSV detection include: Forward primer: SEQ ID NO:1, Reverse primer: SEQ ID NO:2, Probe: SEQ ID NO:9; The primers and probes used for Ehrlich body detection include: Forward primer: SEQ ID NO:3, Reverse primer: SEQ ID NO:4, Probe: SEQ ID NO:10; The primers and probes used for Lyme disease treponemal detection include: Forward primer: SEQ ID NO:5, Reverse primer: SEQ ID NO:6, Probe: SEQ ID NO:

11.

2. The primer-probe composition according to claim 1, characterized in that, It also includes primers and probes for internal standards. The primers and probes for the internal standard include: Forward primer: SEQ ID NO:7, Reverse primer: SEQ ID NO:8, Probe: SEQ ID NO:

12.

3. The primer-probe composition according to claim 1 or claim 2, characterized in that, The 5' end of the probe contains a fluorescent reporter group, which is selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3 or CY5.

4. The primer-probe composition according to claim 1 or claim 2, characterized in that, The 3' end of the probe contains a fluorescence quenching group, which is selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, DABCYL, or MGB.

5. A reagent cartridge for detecting SFTSV, Ehrlich aspergillus, and Lyme disease spirochetes, characterized in that, The reagent cartridge is provided with a lysis buffer area, a washing buffer area, and an amplification area from top to bottom; the lysis buffer area contains lysis buffer, the washing buffer area contains washing buffer, and the amplification area contains PCR reaction solution and the primer and probe composition as described in any one of claims 1-4.

6. The reagent cartridge according to claim 5, characterized in that, The amplification region also includes an encapsulation region, which encapsulates the internal standard and Mn using a fusible material. 2+ The encapsulation fluid.

7. The reagent cartridge according to claim 6, characterized in that, The fusible material is selected from any one or more of paraffin, dodecane, tetradecane, and hexadecane.

8. The reagent cartridge according to claim 5, characterized in that, The lysis buffer includes GTC, NaAc, NaCl, SDS, NP-40, Triton X-100, and PEG8000.

9. The reagent cartridge according to claim 8, characterized in that, The concentration of GTC is 0.8M-1.5M.

10. The reagent cartridge according to claim 8, characterized in that, The lysis buffer consists of 0.8M GTC, 0.5M NaAc, 1.0M NaCl, 1% SDS, 5% NP-40, 1% Triton X-100 and 2% PEG8000.

Images