Herpes simplex virus targeting IL13RA2 and anti-IL13RA2 antibody or antigen binding fragment thereof

Abstract

The present invention provides a herpes simplex virus targeting IL13RA2 that cues an anti-IL13RA2 antibody, or an antigen-binding fragment thereof, to the surface of the virus. Also provided is an anti-IL13RA2 antibody or an antigen-binding fragment thereof that can specifically recognize tumor cells.

Description

[Technical Field]

[0001] This invention relates to herpes simplex virus that can be specifically lysed by targeting tumor cells expressing IL13RA2 with an anti-IL13RA2 antibody on the viral surface. Additionally, this invention relates to an anti-IL13RA2 antibody or an antigen-binding fragment thereof that can specifically recognize the aforementioned tumor cells as targets. [Background Technology]

[0002] As a novel treatment for cancer, the development of therapies that effectively kill cancer cells is desired. Interleukin 13 receptor subunit α2 (IL13RA2) has been reported to be expressed in various solid tumors, including malignant gliomas and malignant melanomas, as well as cutaneous T-cell lymphomas and other hematologic malignancies, but its expression in normal cells is limited. Therefore, it is considered a promising target molecule for cancer treatment (Non-Patent Literature 1-3). The dissociation constants of IL13RA2 and its ligand, interleukin 13 (IL-13), are very low, less than 100 fM (Non-Patent Literature 4). Therefore, IL-13 has been explored as a drug delivery module (cancer targeting module) for developing cancer therapies targeting IL13RA2. For example, the development of a treatment for malignant gliomas using a recombinant protein (IL13-PE) that binds IL-13 to Pseudomonas aeruginosa exotoxin (PE) can be cited (Non-Patent Literature 5). However, unlike IL13RA2, interleukin13receptor subunit α1 (IL13RA1), which functions physiologically as an IL-13 receptor, is found in vascular endothelial cells and is expressed in a wide variety of normal cells (Non-Patent Document 6). Its dissociation constant is 1.69 nM, and it exhibits a higher binding affinity for IL-13 than IL13RA2 (Non-Patent Document 4). Furthermore, it has been reported that IL13RA1 forms a complex with interleukin 4 receptor (IL4R), resulting in an approximately five-fold increase in IL-13 binding energy (Non-Patent Document 7). Therefore, for therapies seeking to specifically kill cancer cells using IL-13 in cancer-targeting modules, concerns remain regarding the potential side effects of damaging normal cells expressing IL13RA1 (Non-Patent Document 8). Consequently, the need for alternative treatments that specifically identify only cancer cells persists.

[0003] Tumor-lysing viral therapy is a cancer treatment method that uses viruses that selectively proliferate cancer cells. Herpes simplex virus (HSV) was among the first viruses to be explored for tumor-lysing viral application. Several research groups, including the inventors of this invention, have reported receptor-targeted tumor-lysing HSV (RR-oHSV) (Non-Patent Literature 9-10), which makes it possible to target cancer cells with selectively expressed target molecules by altering the genes of HSV, bypassing the original HSV receptor. Specifically, by modifying the glycoprotein D (gD), essential for HSV intracellular invasion, and fusing a cancer-targeting module with gD to prevent binding to the herpesvirus entry mediator (HVEM), 3-OS-HS, and conjugation-1 (which are the original gD receptors), the method of selective HSV invasion by cancer cells can be altered. Using this method, Zhou et al. developed IL13RA2 targeting RR-oHSV by using IL-13 as the cancer-targeting module (Non-Patent Literature 11). However, the lack of investigation into the infectivity or in vivo antitumor effects of this IL-13 inserter RR-oHSV on IL13RA1-expressing cells is considered necessary for determining the feasibility of clinical development.

[0004] Previously, the inventors developed an RR-oHSV that only invades and spreads cells expressing target molecules by deleting amino acids 2 through 24 of gD to prevent binding to HVEM and 3-OS-HS, and by changing amino acid 38 from tyrosine to cysteine ​​to prevent binding to conjugin-1. This was achieved by inserting a single-chain antibody (scFv) as a cancer-targeting module into the deletion region from position 2 to 24 (Patent Document 1, Non-Patent Document 12). By replacing the single-chain antibody inserted into the altered gD with this RR-oHSV, it is possible to target and alter a wide variety of target molecules. Thus, the development of RR-oHSVs targeting epidermal growth factor receptor (EGFR), carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), and epiregulin (EREG) has been successful (Non-Patent Documents 12-14).

[0005] [Existing Technical Documents]

[0006] [Patent Documents]

[0007] [Patent Document 1] International Publication No. 2020 / 090871

[0008] [Non-patent literature]

[0009] [Non-Patent Literature 1] Liu, et al., Mol Cancer Ther. 2003 Aug; 2(8): 783-7 [Non-Patent Literature 2] Beard, et al., Clin Cancer Res. 2013 Sep 15; 19(18): 4941-50.

[0010] [Non-Patent Literature 3] Geskin, et al., Blood 2015 Apr 30; 125(18): 2798-805. [Non-Patent Literature 4] Lupardus, et al., Structure. 2010 Mar 10; 18(3): 332-42. [Non-Patent Literature 5] Kunwar, et al., J Clin Oncol 2007 Mar 1; 25(7): 837-44. [Non-Patent Literature 6] Akaiwa, et al., Cytokine 2001 Jan 21; 13(2): 75-84.

[0011] [Non-Patent Literature 7] Andrews, et al., J BiolChem 2002 Nov 29; 277(48): 46073-8. [Non-Patent Literature 8] Balyasnikova, et al., J BiolChem 2012 Aug 31; 287(36): 30215-27.

[0012] [Non-Patent Literature 9] Uchida, et al., Curr Cancer Drug Targets 2018; 18(2): 162-170.

[0013] [Non-Patent Literature 10] Menottiand Avitabile, Int J MolSci 2020Nov 5; 21(21): 8310.

[0014] [Non-Patent Literature 11] Zhou and Roizman, Proc Natl Acad Sci USA 2006 Apr 4; 103(14): 5508-13.

[0015] [Non-Patent Literature 12] Uchida, et al., Mol Ther. 2013 Mar; 21(3): 561-9.

[0016] [Non-Patent Literature 13] Shibata, et al., Gene Ther. 2016 23(6): 479-88.

[0017] [Non-Patent Literature 14] Ikeda, et al., J Virol 2021 Apr 12; 95(9): e01766-20. [Summary of the Invention]

[0018] [The problem the invention aims to solve]

[0019] The present invention aims to provide a herpes simplex virus that can specifically lyse tumor cells and has a high safety profile. Additionally, the present invention aims to provide novel antibodies or antigen-binding fragments thereof that can specifically recognize tumor cells.

[0020] [Methods used to solve problems]

[0021] When integrated into receptor-targeted tumor-lysing HSV (RR-oHSV), the specific recognition of tumor-associated antigens and the function of these antigens as viral receptors satisfy the conditions for completing the deduced molecular mechanism necessary for invasion into target cells, thus obtaining the necessary targeting module (e.g., antibody or its antigen-binding fragment) for the target antigen. However, for example, when multiple scFvs recognizing a single target antigen exist, it is extremely difficult to predict whether the integration of any scFv will lead to the establishment of the signaling cascade necessary for RR-oHSV invasion—namely, the activation of gD leading to the staged activation of other envelope glycoproteins, gH / gL heterodimers, and gB—and consequently, the establishment of invasion into target cells. In fact, previous studies by the inventors have reported that not all scFvs recognizing the target antigen may enable RR-oHSV invasion into target cells (Non-Patent Literature 14).

[0022] Therefore, the inventors attempted to obtain antibodies and antigen-binding fragments that specifically recognize IL13RA2, resulting in anti-IL13RA2 antibodies and their antigen-binding fragments. The inventors discovered that the obtained anti-IL13RA2 antibodies and their antigen-binding fragments can specifically bind to IL13RA2. Furthermore, surprisingly, it was found that the anti-IL13RA2 antibodies are internalized into effective tumor cells.

[0023] Further research by the inventors revealed that recombinant herpes simplex virus prepared by presenting the antigen-binding fragment of the aforementioned anti-IL13RA2 antibody to the surface, compared with recombinant herpes simplex virus prepared by presenting IL-13 as the original ligand to the surface, exhibits higher IL13RA2 selectivity in IL13RA2-positive cells, resulting in higher efficiency of infection and lysis.

[0024] That is, the present invention may include the following embodiments.

[0025] [1] Herpes simplex virus that targets IL13RA2 and presents anti-IL13RA2 antibodies or antigen-binding fragments to the surface of the virus.

[0026] [2] The heavy chain CDRs (HCDR1, HCDR2, HCDR3) and light chain CDRs (LCDR1, LCDR2, LCDR3) of the above-mentioned anti-IL13RA2 antibody or its antigen-binding fragment have the following amino acid sequences:

[0027] (i) HCDR1: RHGIH (SEQ ID NO: 1)

[0028] (ii)HCDR2: VIWAGGSTNY NSALMS (SEQ ID NO: 2)

[0029] (iii)HCDR3:DHFDSFDY (SEQ ID NO: 3)

[0030] (iv) LCDR1: TASSSVSSSY LH (SEQ ID NO: 4)

[0031] (v)LCDR2:STSNLAS (SEQ ID NO: 5), and

[0032] (vi)LCDR3: HQYHRSPLT (SEQ ID NO: 6), or

[0033] The herpes simplex virus described in Project 1 has one to several amino acid variations in these amino acid sequences.

[0034] [3] The above-mentioned anti-IL13RA2 antibody or its antigen-binding fragment contains:

[0035] Compared to V shown in SEQ ID NO: 8 L The amino acid sequence of the region shows more than 80% sequence identity, and is consistent with the V shown in SEQ ID NO: 10. H The amino acid sequence of the region shows more than 80% sequence identity with the herpes simplex virus described in item 1 or 2.

[0036] [4] The antigen-binding fragments mentioned above are Fab, Fab', F(ab')2, Fv, scFv, dsFv, bis-scFv, disodium antibody, trisodium antibody or tetrasodium antibody, and any one of the items 1 to 3 of the herpes simplex virus.

[0037] [5] The antigen-binding fragments mentioned above are scFv, the herpes simplex virus described in any one of items 1 to 4.

[0038] [6] The above antigen-binding fragment contains a sequence that shows more than 90% sequence identity with the sequence of SEQ ID NO: 7 (the sequence of scFv), and is the herpes simplex virus described in any one of items 1 to 5.

[0039] [7] The above-mentioned anti-IL13RA2 antibody or its antigen-binding fragment is a chimeric or humanized anti-IL13RA2 antibody or its antigen-binding fragment, and is the herpes simplex virus described in any one of items 1 to 6.

[0040] [8] The herpes simplex virus described in any one of items 1 to 7, wherein the above-mentioned anti-IL13RA2 antibody or its antigen-binding fragment is integrated into the envelope protein.

[0041] [9] The above-mentioned anti-IL13RA2 antibody or its antigen-binding fragment is integrated into the envelope protein gD, envelope protein gB, envelope protein gC or envelope protein gH, the herpes simplex virus described in item 8.

[0042]

[10] The above-mentioned anti-IL13RA2 antibody or its antigen-binding fragment is integrated into the envelope protein gD, the herpes simplex virus described in item 8.

[0043]

[11] The herpes simplex virus described in Project 8 is characterized in that the above-mentioned anti-IL13RA2 antibody or its antigen-binding fragment is integrated into the deletion portion of amino acids 2 to 24 of SEQ ID NO: 12, the deletion portion between the 24th and 25th positions of SEQ ID NO: 12, the deletion portion of amino acids 6 to 38, or the deletion portion of amino acids 61 to 218 of SEQ ID NO: 12.

[0044]

[12] The envelope protein gD has an amino acid variation that reduces infectivity to cells expressing Nectin-1, HVEM and / or 3-OS-HS, as described in any one of items 1 to 11 of the herpes simplex virus.

[0045]

[13] The herpes simplex virus described in item 12, wherein the above-mentioned amino acid variants that reduce infectivity to cells expressing Nectin-1 are selected from one or more of the following: all deletions of amino acids 6 to 38 of SEQ ID NO: 12, all deletions of amino acids 61 to 218 of SEQ ID NO: 12, variants of amino acids 3 and / or 38 of SEQ ID NO: 12, and variants of amino acids 222 and 223 of SEQ ID NO: 12.

[0046]

[14] The herpes simplex virus described in item 13 is characterized in that the amino acid variation at position 3 of the above SEQ ID NO: 12 is a deletion or substitution for cysteine, the amino acid variation at position 38 is a substitution for cysteine, the amino acid variation at position 222 is a substitution for asparagine, and the amino acid variation at position 223 is a substitution for isoleucine.

[0047]

[15] The herpes simplex virus according to any one of items 12 to 14 is characterized in that, among the amino acid variations of the above-mentioned envelope protein gD, the amino acid variations that weaken the infectivity to cells expressing HVEM and / or 3-OS-HS are all or part of the deletion of amino acids 2 to 38 of SEQ ID NO: 12, all of the deletion of amino acids 61 to 218 of SEQ ID NO: 12, the amino acid variation of SEQ ID NO: 12, the amino acid variation of SEQ ID NO: 12, and / or, the amino acid variation of SEQ ID NO: 12.

[0048]

[16] The herpes simplex virus described in item 15 is characterized in that the deletion of a portion of the amino acids at positions 2 to 38 of the above SEQ ID NO: 12 is any one of the deletion of amino acids at positions 2 to 24, positions 7 to 11, positions 7 to 32, or positions 6 to 38; the amino acid variation at position 27 is a substitution for alanine, proline, or arginine; the amino acid variation at position 29 is a substitution for alanine; and the amino acid variation at position 30 is a substitution for alanine.

[0049]

[17] The herpes simplex virus described in any one of items 1 to 16 has an amino acid variation that promotes invasion into target cells and / or an amino acid variation that promotes the formation of multinucleated giant cells.

[0050]

[18] The herpes simplex virus of item 16 is characterized in that the amino acid variations that promote invasion into target cells and / or the amino acid variations that promote the formation of multinucleated giant cells are the variations described in (a), (b), (c) and / or (d) below.

[0051] (a) Amino acid variations at positions 285, 549, 796, 800, 813, 817, 854, 855, and 858 of SEQ ID NO: 13; an insertion of an amino acid between positions 816 and 817; a nonsense variation at position 869; and / or a nonsense variation at position 877. (b) Amino acid variations at positions 33, 40, 86, 99, 111, 121, 243, 304, and / or 310 of SEQ ID NO: 14.

[0052] (c) Amino acid variations at position 49, positions 49, 50, and 51, position 209, positions 209, 212, and 213, and position 217 of SEQ ID NO: 15, and / or, complete deletion of the amino acid sequence represented by SEQ ID NO: 15.

[0053] (d) Amino acid variations at positions 62, 63, and 64 of SEQ ID NO: 16

[0054]

[19] The herpes simplex virus described in item 18 is characterized in that,

[0055] The amino acid variation at position 285 of SEQ ID NO: 13 is replaced with asparagine; the amino acid variation at position 549 of SEQ ID NO: 13 is replaced with threonine; the amino acid variation at position 796 of SEQ ID NO: 13 is replaced with cysteine; the amino acid variation at position 800 of SEQ ID NO: 13 is replaced with tryptophan; the amino acid variation at position 813 of SEQ ID NO: 13 is replaced with isoleucine; the amino acid variation at position 817 of SEQ ID NO: 13 is replaced with histidine or proline; the amino acid variation at position 854 of SEQ ID NO: 13 is replaced with phenylalanine; the amino acid variation at position 855 of SEQ ID NO: 13 is replaced with valine; and the amino acid variation at position 858 of SEQ ID NO: 13 is replaced with cysteine ​​or histidine.

[0056] The amino acid variation at position 33 of SEQ ID NO: 14 is replaced with serine; the amino acid variation at position 40 of SEQ ID NO: 14 is replaced with valine or threonine; the amino acid variation at position 86 of SEQ ID NO: 14 is replaced with proline; the amino acid variation at position 99 of SEQ ID NO: 14 is replaced with asparagine; the amino acid variation at position 111 of SEQ ID NO: 14 is replaced with valine; the amino acid variation at position 121 of SEQ ID NO: 14 is replaced with isoleucine; the amino acid variation at position 243 of SEQ ID NO: 14 is replaced with tyrosine; the amino acid variation at position 304 of SEQ ID NO: 14 is replaced with proline; and the amino acid variation at position 310 of SEQ ID NO: 14 is replaced with leucine.

[0057] The amino acid variation at position 49 of SEQ ID NO: 15 is a substitution for alanine; the amino acid variation at position 50 of SEQ ID NO: 15 is a substitution for alanine; the amino acid variation at position 51 of SEQ ID NO: 15 is a substitution for alanine; the amino acid variation at position 209 of SEQ ID NO: 15 is a substitution for alanine; the amino acid variation at position 212 of SEQ ID NO: 15 is a substitution for alanine; the amino acid variation at position 213 of SEQ ID NO: 15 is a substitution for alanine.

[0058] The amino acid variation at position 62 of SEQ ID NO: 16 is a substitution for glycine, the amino acid variation at position 63 is a substitution for valine, and the amino acid variation at position 64 is a substitution for serine.

[0059]

[20] Herpes simplex virus of any one of items 1 to 19 having a restricted proliferative alteration.

[0060]

[21] The above-mentioned restriction-proliferation alteration is a variant of functional ICP34.5 expression inactivation, as described in item 20 of the herpes simplex virus.

[0061]

[22] The nucleic acid of the herpes simplex virus as described in any one of items 1 to 21.

[0062]

[23] Cells that produce the herpes simplex virus described in any one of items 1 to 21.

[0063]

[24] A method for manufacturing the herpes simplex virus as described in any one of items 1 to 21.

[0064]

[25] A pharmaceutical composition comprising any one of the herpes simplex virus described in items 1 to 21.

[0065]

[26] is a therapeutic agent for tumors expressing IL13RA2, the pharmaceutical composition described in item 25.

[0066]

[27] The above-mentioned tumors are melanoma, osteosarcoma, leukemia, lymphoma, prostate cancer, lung cancer (including malignant mesothelioma), glioma, head and neck cancer, renal cancer, Kaposi's sarcoma, colorectal cancer, pancreatic cancer, adrenal cancer, breast cancer or ovarian cancer, and the pharmaceutical composition described in item 26.

[0067]

[28] The heavy chain CDRs (HCDR1, HCDR2, HCDR3) and the light chain CDRs (LCDR1, LCDR2, LCDR3) have the following amino acid sequences:

[0068] (i) HCDR1: RHGIH (SEQ ID NO: 1)

[0069] (ii)HCDR2: VIWAGGSTNY NSALMS (SEQ ID NO: 2)

[0070] (iii)HCDR3:DHFDSFDY (SEQ ID NO: 3)

[0071] (iv) LCDR1: TASSSVSSSY LH (SEQ ID NO: 4)

[0072] (v)LCDR2:STSNLAS (SEQ ID NO: 5), and

[0073] (vi)LCDR3: HQYHRSPLT (SEQ ID NO: 6), or

[0074] Anti-IL13RA2 antibodies or their antigen-binding fragments that have one to several amino acid variations in these amino acid sequences.

[0075]

[29] The above-mentioned anti-IL13RA2 antibody or its antigen-binding fragment contains:

[0076] Compared to V shown in SEQ ID NO: 8 L The amino acid sequence of the region shows more than 80% sequence identity, and is consistent with the V shown in SEQ ID NO: 10. H The amino acid sequence of the region shows more than 80% sequence identity, of which the anti-IL13RA2 antibody or its antigen-binding fragment described in item 28.

[0077]

[30] The antigen-binding fragments mentioned above are Fab, Fab', F(ab')2, Fv, scFv, dsFv, bis-scFv, disodium antibody, trisodium antibody or tetrasodium antibody, the anti-IL13RA2 antibody or its antigen-binding fragments described in item 28 or 29.

[0078]

[31] The antigen-binding fragment of the above-mentioned antigen-binding fragment contains a sequence that shows more than 90% sequence identity with the sequence of SEQ ID NO: 7 (the sequence of scFv), the anti-IL13RA2 antibody or its antigen-binding fragment as described in any one of items 28 to 30.

[0079]

[32] Chimeric or humanized anti-IL13RA2 antibody or antigen-binding fragment thereof as described in any one of items 28 to 31.

[0080]

[33] The nucleic acid encoding any one of items 28 to 32 of the anti-IL13RA2 antibody or its antigen-binding fragment.

[0081]

[34] Cells containing the nucleic acid described in item 33 that produce anti-IL13RA2 antibody or its antigen-binding fragment.

[0082]

[35] Cells that produce the anti-IL13RA2 antibody or its antigen-binding fragment as described in any one of items 28 to 32.

[0083]

[36] Cells deposited under accession number NITE BP-03673.

[0084]

[37] A method for manufacturing an anti-IL13RA2 antibody or an antigen-binding fragment thereof as described in any one of items 34 to 36 using the cells described in any one of items 27 to 31.

[0085]

[38] A pharmaceutical composition comprising any one of the anti-IL13RA2 antibodies or antigen-binding fragments thereof as described in any one of items 28 to 32.

[0086]

[39] The pharmaceutical composition described in item 38 for the treatment of tumors expressing IL13RA2.

[0087]

[40] The above-mentioned tumors are melanoma, osteosarcoma, leukemia, lymphoma, prostate cancer, lung cancer (including malignant mesothelioma), glioma, head and neck cancer, renal cancer, Kaposi's sarcoma, colorectal cancer, pancreatic cancer, adrenal cancer, breast cancer or ovarian cancer, and the pharmaceutical composition described in item 39.

[0088]

[41] The pharmaceutical composition described in any one of items 38 to 40, wherein the above-mentioned anti-IL13RA2 antibody or its antigen-binding fragment is contained in the above-mentioned pharmaceutical composition in the form of an antibody-drug complex.

[0089] [The effects of the invention]

[0090] This invention can selectively and effectively dissolve / kill IL13RA2-positive cancer cells. Therefore, this invention provides a novel treatment method with fewer side effects, greater safety for the organism, and lower dosage.

[0091] [Brief explanation of the attached image]

[0092]

Figure 1

[0093]

Figure 2

[0094]

Figure 3

[0095]

Figure 4

[0096]

Figure 5

[0097]

Figure 6

[0098]

Figure 7

[0099]

Figure 8

[0100]

Figure 9

[0101]

Figure 10

[0102]

Figure 11

Detailed Implementation Methods

[0103] The specific embodiments of the present invention will now be described in detail. However, the present invention is not limited to the following embodiments and can be implemented in any form without departing from the spirit of the present invention.

[0104] Furthermore, all data information, including patent gazettes, patent application publications, non-patent documents, and serial numbers, cited in this disclosure are incorporated herein by reference in their entirety for all purposes.

[0105] In this disclosure, the term "~" when referring to numerical values ​​means a range of values ​​above and below a specified reference value. In this disclosure, "about" means ±10% of the subsequent numerical value.

[0106] In this specification, when describing variations of amino acids, unless otherwise specified, it refers to the substitution, deletion, or insertion of one or more amino acids (e.g., 1 to 10, preferably 1 to 5, more preferably about 1 to 3) between amino acids adjacent to the stated amino acid. For example, referring to a certain sequence, when described as "a variation of R21," it refers to the deletion, substitution, or insertion of one or more amino acids between the 21st amino acid in its amino acid sequence. Furthermore, regarding the above examples, for each HSV strain, the amino acid numbers described in this specification may be staggered by about 1 to 10. Therefore, in any HSV strain, for example, when the amino acid numbers are staggered by ±n (however, n is an integer between 1 and 10), R21 is read as R(21±n).

[0107] Herpes simplex virus targeting IL13RA2

[0108] In this specification, the term "IL13RA2-targeting herpes simplex virus" refers to a herpes simplex virus that is manipulated to specifically bind to and infect IL13RA2-positive cancer cells. The genes of IL13RA2-targeting herpes simplex virus undergo genetic engineering alterations.

[0109] The herpes simplex virus applicable to this invention is a tumor-lysing virus. As used in this specification, the term "tumor-lysing virus" refers to a modified virus that preferentially infects and kills cancer cells.

[0110] The present invention relates to an anti-IL13RA2 antibody or its antigen-binding fragment that targets IL13RA2 on the surface of the herpes simplex virus. To facilitate target targeting of desired cells, the anti-IL13RA2 antibody or its antigen-binding fragment can be integrated into a glycoprotein or the like, which is an envelope protein exposed on the viral surface. Methods for integrating the anti-IL13RA2 antibody or its antigen-binding fragment are well known, including methods using cross-linking agents such as glutaraldehyde, methods using tags (epitopes of biotin, glutathione, Myc, etc., 6×histidine, etc.) and their ligands, methods using multispecific antibodies (e.g., bispecific antibodies) that recognize the viral envelope protein and the anti-IL13RA2 antibody or its antigen-binding fragment as two antigens, and methods expressing a fusion protein of the envelope protein and the anti-IL13RA2 antibody or its antigen-binding fragment, with the method of expressing a fusion protein of the envelope protein being preferred. The anti-IL13RA2 antibody or its antigen-binding fragment is used to prepare a recombinant virus by protruding the anti-IL13RA2 antibody or its antigen-binding fragment onto the outer side of the viral envelope.

[0111] The term "IL-13," as used in this specification, refers to a cytokine primarily secreted by T helper 2 cells. IL-13 shares a receptor (IL-13Rα1 / IL-4Rα) with IL-4 and plays a crucial role in the induction of antibody-induced humoral immunity. IL-13 is a monomeric protein of a 13 kDa polypeptide, and its structure is further described, for example, in Moy, Diblasio et al. 2001, J Mol Biol 310, pp. 219-30.

[0112] IL13RA2 is known as a high-affinity receptor for IL-13 and has been reported to function as a decoy for IL-13 while inhibiting STAT6 signaling via IL-4, or recently associated with multiple signal transduction pathways (WNT / β-Catenin, MAPK / ERK, AKT / PKB, Src / FAK, PIP3K, etc.), and is believed to play a protective role against inflammatory diseases such as dermatitis (Sivaprasad et al., J Immunol. 2010; 185(11): 6802). For example, one embodiment of IL13RA2 is a precursor of human IL13RA2, which may be a polypeptide having the amino acid sequence shown in SEQ ID NO: 17 (NCBI accession number: NP_000631.1). Furthermore, the precursor of human IL13RA2 shown in SEQ ID NO: 17 contains a signal peptide (positions 1-26), and the mature human IL13RA2 corresponds to positions 27-380 of the amino acid sequence shown in SEQ ID NO: 17.

[0113] The anti-IL13RA2 antibody or its antigen-binding fragment targeting IL13RA2, as indicated by herpes simplex virus of the present invention, or, in one embodiment of the anti-IL13RA2 antibody or its antigen-binding fragment of the present invention, may have the following amino acid sequence in its heavy chain CDR (HCDR1, HCDR2, HCDR3) and light chain CDR (LCDR1, LCDR2, LCDR3):

[0114] (i)HCDR1: (SEQ ID NO: 1: RHGIH)

[0115] (ii) HCDR2: (SEQ ID NO: 2: VIWAGGSTNY NSALMS)

[0116] (iii) HCDR3: (SEQ ID NO: 3: DHFDSFDY)

[0117] (iv) LCDR1: (SEQ ID NO: 4: TASSSVSSSY LH)

[0118] (v)LCDR2: (SEQ ID NO: 5: STSNLAS), and (vi)LCDR3: (SEQ ID NO: 6: HQYHRSPLT), or

[0119] These amino acid sequences contain one to several amino acid variations. "CDR" refers to the variable region of an immunoglobulin molecule that forms the antigen-binding site, also known as the hypervariable region, which is the part of the amino acid sequence in each immunoglobulin molecule with particularly large variations. The heavy chain (HCDR) and light chain (LCDR) each have three CDRs (CDR1, CDR2, and CDR3). In this application, the CDRs of the immunoglobulin molecules are determined according to Kabat's numbering system (Kabat et al., 1987, Sequences of Proteins of Immunological Interest, USDA Department of Health and Human Services, NIH, USA).

[0120] One embodiment of the anti-IL13RA2 antibody or its antigen-binding fragment targeting IL13RA2, as indicated by herpes simplex virus of the present invention, may have a heavy chain CDR (HCDR1, HCDR2, HCDR3) having the following amino acid sequence:

[0121] (i)HCDR1: (SEQ ID NO: 1: RHGIH)

[0122] (ii) HCDR2: (SEQ ID NO: 2: VIWAGGSTNY NSALMS)

[0123] (iii)HCDR3: (SEQ ID NO: 3: DHFDSFDY), or

[0124] These amino acid sequences contain one to several (one, two, or three) amino acid variations.

[0125] One embodiment of the anti-IL13RA2 antibody or its antigen-binding fragment targeting IL13RA2, as indicated by herpes simplex virus of the present invention, may have a light chain CDR (LCDR1, LCDR2, LCDR3) having the following amino acid sequence:

[0126] (i) LCDR1: (SEQ ID NO: 4: TASSSVSSSY LH)

[0127] (ii) LCDR2: (SEQ ID NO: 5: STSNLAS), and

[0128] (iii) LCDR3: (SEQ ID NO: 6: HQYHRSPLT), or

[0129] These amino acid sequences contain one to several (one, two, or three) amino acid variations.

[0130] Additionally, one embodiment of the anti-IL13RA2 antibody or its antigen-binding fragment targeting IL13RA2, as indicated by herpes simplex virus of the present invention, may contain V as shown in SEQ ID NO: 8. L The amino acid sequence of the region shows 80% or more (e.g., 85%, 90%, 95%, 98%, 99%, or 100%) sequence identity and is identical to the V shown in SEQ ID NO: 10. H Anti-IL13RA2 antibodies or their antigen-binding fragments that exhibit 80% or more (e.g., 85%, 90%, 95%, 98%, 99%, or 100%) sequence identity in the amino acid sequence of the region.

[0131] In this specification, the amino acid variation referred to in CDR means "substitution" of an amino acid, "deletion" of an amino acid, "insertion" of an amino acid, and especially preferably "conservative amino acid substitution". Conservative amino acid substitution is based on the similarity of the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphiphilic properties of the relevant residues. For example, nonpolar (hydrophobic) amino acids include alanine (Ala, A), leucine (Leu, L), isoleucine (Ile, I), valine (Val, V), proline (Pro, P), phenylalanine (Phe, F), tryptophan (Trp, W), and methionine (Met, M); polar amino acids include glycine (Gly, G), serine (Ser, S), threonine (Thr, T), cysteine ​​(Cys, C), tyrosine (Tyr, Y), asparagine (Asn, N), and glutamine (Gln, Q); positively charged (basic) amino acids include arginine (Arg, R), lysine (Lys, K), and histidine (His, H); and negatively charged (acidic) amino acids include aspartic acid (Asp, D) and glutamic acid (Glu, E). The substitution, insertion, or deletion is preferably within the range of 1, 2, or 3 amino acids. Mutations can also be introduced by substituting amino acids in the polypeptide molecule system or randomly using recombinant DNA methods, and then measuring the activity of the resulting recombinant variants.

[0132] In an exemplary embodiment, the anti-IL13RA2 antibody targeting IL13RA2 and indicating herpes simplex virus of the present invention may also contain the mouse constant region (IgG1, IgG2a, IgG2b, IgG3, IgM, IgD, IgE, IgA). In some embodiments, the antibody may also be a chimeric antibody, humanized antibody, or human antibody having the human constant region (IgG1, IgG2, IgG3, IgG4, IgM, IgD, IgE, IgA1, IgA2). Additionally, mouse antibodies, chimeric antibodies, humanized antibodies, and human antibodies may, for example, only have heavy chains indicated on the viral surface. Furthermore, in some embodiments, the antibody may be a bispecific, triple specific, or multispecific antibody (bispecific antibody, trispecific antibody, multispecific antibody) to improve affinity or cohesion. In one embodiment, the antigen-binding fragment applicable in the present invention may also be an antigen-binding fragment of any of the antibodies described in this specification. The antigen-binding fragment may include Fab, Fab', F(ab')2, Fv, scFv, dsFv, bis-scFv, disodium antibodies, trisodium antibodies, or tetrasodium antibodies, etc., as long as it is derived from the antigen-binding fragment of the anti-IL13RA2 antibody, and is not limited to these. Disodium antibodies (dimers), trisodium antibodies (trimers), or tetrasodium antibodies (tetramers) are well known in the prior art. For example, see Kortt et al., Biomol. Eng. 2001, 18: 95-108, (2001) and Todorovska et al., J. Immunol Methods. 248: 47-66, (2001). In one embodiment, the antigen-binding fragment suitable for use in this invention is preferably scFv.

[0133] scFv consists of a synthetic peptide (linker) and a variable (V) region (V) of the antibody light chain. L The V region of the antibody heavy chain linked by the region (V) H The region is composed of [a specific structure / region], which can be generated using routine recombinant DNA techniques (see, for example, Janeway et al., Immunobiology, 2nd ed., Garl and Publishing, New York, (1996)). As an adapter, a flexible adapter such as (Gly4Ser)3 can be used, but is not limited to this. Additionally, in scFv, the V [a specific structure / region] is connected by the adapter. L Region and V H The order of region connection is not particularly restricted. Similarly, disulfide-stabilized variable region fragments (dsFv) can be modulated by recombinant DNA technology (e.g., Reiter et al., Protein Engineering, 7, 697-704 (1994)).

[0134] In one embodiment, the antigen-binding fragment applicable in this invention may be an antigen-binding fragment containing a sequence exhibiting 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity relative to the sequence shown in SEQ ID NO: 7. Specifically, the amino acid sequence shown in SEQ ID NO: 7 is a sequence containing the following amino acid sequence.

[0135] [Chemistry 1: SEQ ID NO: 7]

[0136]

[0137] As described above, the antigen-binding fragment having the amino acid sequence shown in SEQ ID NO: 7 includes a VL region (SEQ ID NO: 8) containing the above-mentioned LCDR1 to LCDR3 (SEQ ID NO: 4 to 6), a VH region (SEQ ID NO: 10) containing the above-mentioned HCDR1 to HCDR3 (SEQ ID NO: 1 to 3), and linker sequences 1 and 2 (SEQ ID NO: 9 and 11).

[0138] In some embodiments of this disclosure, the antigen-binding fragment of the present invention targeting IL13RA2 and suggested by herpes simplex virus may also be a heavy chain CDR (HCDR1, HCDR2, HCDR3) and a light chain CDR (LCDR1, LCDR2, LCDR3) having the following amino acid sequence:

[0139] (i)HCDR1: (SEQ ID NO: 1: RHGIH)

[0140] (ii) HCDR2: (SEQ ID NO: 2: VIWAGGSTNY NSALMS)

[0141] (iii) HCDR3: (SEQ ID NO: 3: DHFDSFDY)

[0142] (iv) LCDR1: (SEQ ID NO: 4: TASSSVSSSY LH)

[0143] (v)LCDR2: (SEQ ID NO: 5: STSNLAS), and (vi)LCDR3: (SEQ ID NO: 6: HQYHRSPLT), or

[0144] An antigen-binding fragment having one to several amino acid variations in these amino acid sequences and exhibiting 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, or 100% sequence identity relative to the sequence shown in SEQ ID NO: 7.

[0145] The "sequence identity" of this invention is defined as the percentage of amino acid residues in a candidate sequence that are identical to the amino acid residues of a specific reference polypeptide sequence, after which sequence alignment is performed, gaps are introduced as needed to obtain maximum sequence identity, and no conservative substitutions are considered part of the sequence identity. Alignment for the purpose of determining sequence identity can be achieved using various methods within the skill of those skilled in the art, such as publicly available computer software like BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR). Those skilled in the art can determine suitable parameters for sequence alignment, including any algorithm necessary to achieve maximum alignment relative to the full length of the sequences being compared. However, for its purposes, the sequence identity value in pairwise alignment is obtained using the sequence comparison computer program BLAST.

[0146] In the case of using amino acid sequence comparison BLAST, the sequence identity (%) between a given amino acid sequence A and a given amino acid sequence B is calculated as follows:

[0147] 100 times the fraction X / Y

[0148] Where X is the number of amino acid residues that are identified as identical by the BLAST sequence alignment program for sequences A and B, and Y is the total number of amino acid residues in sequence B. When the lengths of amino acid sequences A and B are different, the sequence identity of A with respect to B may differ from the sequence identity (%) of B with respect to A. Unless otherwise specified, the percentage of amino acid sequence identity values, as shown in the previous paragraph, are obtained using the BLAST computer program.

[0149] Among the amino acid variations involved in the antigen-binding fragment of SEQ ID NO: 7 of the present invention, there are "substitution" (replacing with another amino acid), "deletion" (excluding the amino acid), and "insertion" (addition of another amino acid). Additionally, as one embodiment of "substitution," there is "conservative amino acid substitution." Conservative amino acid substitution is based on the similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphiphilic properties of the relevant residues. For example, nonpolar (hydrophobic) amino acids include alanine (Ala, A), leucine (Leu, L), isoleucine (Ile, I), valine (Val, V), proline (Pro, P), phenylalanine (Phe, F), tryptophan (Trp, W), and methionine (Met, M); polar neutral amino acids include glycine (Gly, G), serine (Ser, S), threonine (Thr, T), cysteine ​​(Cys, C), tyrosine (Tyr, Y), asparagine (Asn, N), and glutamine (Gln, Q); positively charged (basic) amino acids include arginine (Arg, R), lysine (Lys, K), and histidine (His, H); and charged (acidic) amino acids include aspartic acid (Asp, D) and glutamic acid (Glu, E). The "substitution," "insertion," or "deletion" is preferably within the range of 1–25, 1–20, 1–15, 1–10, or 1–5 amino acids. Mutations can also be introduced by substituting amino acids randomly or in a polypeptide molecule system using recombinant DNA methods, and then measuring the activity of the resulting recombinant variants.

[0150] The herpes simplex virus (HSV) that can be used in this invention includes herpes simplex virus type 1 (HSV-1) (also referred to as "HHV-1") and herpes simplex virus type 2 (HSV-2) (also referred to as "HHV-2"). In embodiments of this invention, the HSV-1 and HSV-2 used, although classified as such, include all strains (e.g., KOS strain, F strain, 17 strain, VR3 strain, HF strain, HF10 strain, and SC16 strain, etc., classified as HSV-1, and 186 strain, G strain, and 333 strain, etc., classified as HSV-2) and substrains derived from these, including all. That is, for example, when explaining HSV-1, in addition to the KOS strain whose full-length genome sequence is disclosed in GenBank no. JQ673480.1 (https: / / www.ncbi.nlm.nih.gov / nuccore / JQ673480.1) (SEQ ID NO: 29), it can also refer to other strains classified as HSV-1 and HSV-1 belonging to these substrains. HSV has envelope glycoproteins (gB, gC, gD, gH, gL, gK, etc.), which cause membrane fusion between the host cell membrane and the viral envelope, and are important for intracellular invasion and intercellular transmission of the virus. First, HSV adsorbs onto the cell membrane by binding to heparan sulfate expressed on the cell membrane surface via gB and gC. Next, structural changes occur in gD via binding to the herpesvirus entry mediator (HVEM), conjugin-1, or 3-O-sulfated heparan sulfate (3-OS-HS) (Montgomery et al., Cell 1996; Geragehty et al., Science 1998; Shukla et al., Cell 1999) (Carfi et al., Mol Cell 2001; Fusco et al., Proc Natl Acad Sci USA 2005; Krummenacher et al., EMBO J 2005), and signal transduction to the gH / gL complex (Atanasiu et al., JVirol 2010; Atanasiu et al., Mbio 2013; Gianni et al., J Biol Chem 2009). Furthermore, the gH / gL complex activates gB, thus enabling membrane fusion (Atanasiu et al., Proc NatlAcad Sci USA 2007; Atanasiu et al., J Virol 2010; Chowdary et al., Nat Struct Mol Biol 2010).

[0151] In one embodiment, the herpes simplex virus targeting IL13RA2 of the present invention is an anti-IL13RA2 antibody or its antigen-binding fragment integrated into an envelope protein, targeting IL13RA2 expressed on the cell surface. Preferably, the anti-IL13RA2 antibody or its antigen-binding fragment is integrated into envelope protein gD (e.g., SEQ ID NO: 12), envelope protein gB (see, for example, SEQ ID NO: 13, or PLoS Pathog 2017; 13(4): e1006352, etc.), envelope protein gC (see, for example, Cancer GeneTher 2010; 17(9): 655-663, etc.), or envelope protein gH (see, for example, PLoS Pathog 2015; 11(5): e1004907, etc.), more preferably integrated into envelope protein gD. Furthermore, the amino acid sequences of the illustrated envelope proteins are illustrative and not limited to these.

[0152] In one embodiment, the herpes simplex virus targeting IL13RA2 of the present invention is an anti-IL13RA2 antibody or its antigen-binding fragment that can be integrated into the deletion portion of amino acids 2 to 24 of SEQ ID NO: 12, the deletion portion between amino acids 24 and 25 of SEQ ID NO: 12, the deletion portion of amino acids 6 to 38 of SEQ ID NO: 12, or the deletion portion of amino acids 61 to 218 of SEQ ID NO: 12.

[0153] In one embodiment, the herpes simplex virus targeting IL13RA2 of the present invention is one in which the envelope protein gD may have amino acid variations that reduce infectivity to cells expressing Nectin-1, HVEM and / or 3-OS-HS, or may, for example, have the variations described in International Publication No. 2020 / 090871.

[0154] In embodiments of the present invention, "gD mutation" refers to a nucleotide or amino acid variation in the gD gene or gD protein that is a glycoprotein of the HSV virus responsible for intracellular invasion, and that includes variations that cause loss (or reduction) of binding energy with HVEM, loss (or reduction) of binding energy with Nectin-1, loss (or reduction) of binding energy with 3-OS-HS, and variations that confer binding energy with tumor antigens (e.g., insertional variations in DNA encoding scFv or other tumor antigens). These variations result in reduced infectivity to cells expressing Nectin-1, HVEM, and / or 3-OS-HS compared to HSV viruses without these variations.

[0155] The amino acid sequence of the gD protein of the KOS strain shown in SEQ ID NO: 12 is displayed (excluding the signal peptide consisting of 25 amino acid residues from the N-terminus).

[0156] In this specification, the KOS strain will be used as an example to illustrate a specific case of "gD mutation," but the invention is equally applicable to other strains. The gD protein of the KOS strain is encoded in a right-hand direction at nucleotide numbers 138279…139463 of the KOS strain genome sequence registered in GenBank no. JQ673480.1.

[0157] For gD variants that lose the binding energy of HVEM, conjugant-1, 3-OS-HS and gD, suitable variants can be appropriately selected by those skilled in the art, as disclosed in numerous well-known publications such as Yoon et al., JVirol.77:9221-9231 2003, Spear et al., Virology 344:17-24 2006, Connolly et al., JVirol.79:1282-1295 2005, Uchida et al., J Virol.83:2951-2961 2009, Uchida et al., JVirol.84:12200-12209 2010, and Shibata et al., Gene Ther.23:479-488 2016. Not specifically limited, but if examples must be given, when the position of the amino acid variation that causes loss of binding energy to Nectin-1, i.e., weakens infectivity to cells expressing Nectin-1, is represented by the amino acid number of SEQ ID NO: 12 for the gD protein, examples include Δ6-38 (deletion of amino acids 6-38) (Menotti et al., J Virol. 82: 10153-10161 2008), Δ61-218 (deletion of amino acids 61-218) (Menotti et al., Proc Natl Acad SciUSA. 106: 9039-9044 2009), and R222N / F223I (Uchida et al., J Virol. 83: 2951-2961). Variations of R222 and F223 (variations of amino acids at positions 222 and 223) such as Y38C, A3C or ΔA3 / Y38C (Connolly et al., J Virol. 79: 1282-1295 2005, Uchida et al., J Virol. 83: 2951-2961 2009) and A3 and / or Y38 (variations of amino acids at positions 3 and / or 38, for example, a mutation at position 3 is a deletion or substitution for cysteine, and a mutation at position 38 is a substitution for cysteine).

[0158] When the amino acid position of the mutation that causes loss of binding energy to HVEM, i.e., weakens infectivity to HVEM-expressing cells, is represented by the amino acid number of SEQ ID NO: 12 in the gD protein, examples include Δ7-32 (deletion of amino acids 7-32) (Yoon et al., J Virol. 77: 9221-9231 2003), Δ2-24 (deletion of amino acids 2-24) (Shibata et al., Gene Ther. 23: 479-488 2016), Δ7-11 (deletion of amino acids 7-11) (Uchida et al., J Virol. 84: 12200-12209 2010), and Δ6-38 (Menotti et al., J Virol. 82: 10153-10161). The deletions of all or part of amino acids at positions 2-38 (e.g., Δ61-218, deletions of amino acids at positions 61-218) (Menotti et al., Proc Natl Acad Sci USA. 106: 9039-9044 2009), and variations in Q27, T29, and D30 (e.g., Q27A, Q27P, Q27R, T29A, D30A, etc., Spear et al., Virology 344: 17-24 2006) (e.g., variations at amino acid position 27, amino acid position 29, and amino acid position 30).

[0159] Furthermore, most variants that inhibit the binding of HVEM also show inhibition of invasion into cells via 3-OS-HS (Yoon and Spear, Proc Natl Acad Sci USA. 101: 17252-17257 2004).

[0160] Sequences showing 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, or 100% sequence identity with respect to the amino acid sequence of the gD protein of the KOS strain shown in SEQ ID NO: 12, and sequences containing variations thereof as defined above, may also be included within the scope of this invention.

[0161] In one embodiment, the herpes simplex virus of the present invention has envelope proteins gB, gK, UL20, and / or UL24 proteins having amino acid variations that promote invasion into target cells and / or amino acid variations that promote the formation of multinucleated giant cells.

[0162] Amino acid variations that promote multinucleated giant cell formation are variations introduced into the HSV gB gene (or gB protein), gK gene (or gK protein), UL20 gene (or UL20 protein: envelope protein UL20), and / or UL24 gene (or UL24 protein: nuclear protein UL24), thereby promoting HSV-induced membrane fusion activity. Additionally, amino acid variations that promote invasion into target cells refer to variations introduced into the HSV gB gene (or gB protein), thereby enhancing the efficiency of HSV invasion into target cells. SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16 respectively show the amino acid sequences of the gB protein, gK protein, UL20 protein, and UL24 protein of the KOS strain.

[0163] In this specification, using the KOS strain as an example, specific examples of amino acid variations that promote invasion into target cells and / or promote the formation of multinucleated giant cells will be described. These variations are equally applicable to other strains. The gB protein of the KOS strain is encoded in reverse (left-handed) direction at nucleotide numbers 53022…55736 of the genomic sequence registered in GenBank no. JQ673480.1; the gK protein is encoded in forward (right-handed) direction at nucleotide numbers 112101…113117; the UL20 protein is encoded in reverse (left-handed) direction at nucleotide numbers 40763…41431; and the UL24 protein is encoded in forward (right-handed) direction at nucleotide numbers 47678…48487. Amino acid variations that promote invasion into target cells and / or promote the formation of multinucleated giant cells are disclosed in numerous public documents, and those skilled in the art can appropriately select suitable variations.

[0164] When the amino acid variation that promotes the invasion of the target cell of the major gB protein is represented by the amino acid number of SEQ ID NO: 13 as the amino acid position of the gB protein, examples include the variation of D285 such as D285N and the variation of A549 such as A549T. In addition, when the amino acid variation that promotes the formation of multinucleated giant cells of the major gB protein is taken as the amino acid position of the gB protein and indicated by the amino acid number of SEQ ID NO: 13, examples include the variation of R796 such as R796C, the variation of R800 such as R800W, the variation of T813 such as T813I, the variation of L817 such as L817H and L817P, the variation of S854 such as S854F, the variation of A855 such as A855V, the variation of R858 such as R858C and R858H, the insertion between E816 and L817 (VN (2 amino acid insertion) and VNVN (4 amino acid insertion)), the nonsense variation of S869, the nonsense variation of T877, etc.

[0165] When the amino acid variation that promotes the formation of multinucleated giant cells of the major gK protein is taken as the amino acid position of the gK protein and represented by the amino acid number of SEQ ID NO: 14, examples include variations of P33 such as P33S, variations of A40 such as A40V and A40T, variations of L86 such as L86P, variations of D99 such as D99N, variations of A111V such as A111, variations of T121 such as T121I, variations of C243 such as C243Y, variations of L304 such as L304P, and variations of R310 such as R310L.

[0166] When amino acid variations that promote the formation of multinucleated giant cells of the major UL20 protein are represented by the amino acid number of SEQ ID NO: 15 as the amino acid position of the UL20 protein, examples include the Y49A variant alone, variations of Y49, S50 and R51 such as Y49A / S50A / R51A, the R209A variant alone, variations of R209, T212 and R213 such as R209A / T212A / R213A, deletion of the C-terminus after N217, and deletion of the entire length of the UL20 protein.

[0167] When amino acid variations that promote the formation of multinucleated giant cells of the major UL24 protein are represented by the amino acid number of SEQ ID NO: 16 as the amino acid position of the UL24 protein, examples include variations such as T62G / R63V / V64S, which represent T62, R63, and V64.

[0168] Table 1 summarizes the amino acid variations that promote invasion into the main target cells and / or promote the formation of multinucleated giant cells.

[0169] Table 1

[0170]

[0171] Sequences showing 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, or 100% sequence identity with respect to the amino acid sequences of the KOS strain gK protein shown in SEQ ID NO: 14, the KOS strain gB protein shown in SEQ ID NO: 13, the KOS strain UL20 protein shown in SEQ ID NO: 15, or the KOS strain UL24 protein shown in SEQ ID NO: 16, and sequences containing variations determined above may also be included within the scope of this application.

[0172] The herpes simplex virus of the present invention, in addition to maintaining the aforementioned syn variant, can also be maintained in a state in which it expresses a foreign gene that promotes HSV membrane fusion (hereinafter also referred to as "membrane fusion promoting foreign gene"). The location on the HSV genome where the foreign gene is integrated is not particularly limited, and can be any location on the HSV genome as long as it does not inhibit the function of HSV as a tumor-lysing virus.

[0173] The aforementioned membrane fusion-promoting foreign gene is not particularly limited, and examples include, for instance, fusogenic membrane glycoproteins (FMGs) derived from gibberish leukemia virus (GALV). The creation of HSVs that remain on the genome in a state capable of expressing the GALV FMG gene can be readily performed by those skilled in the art, for example, by referring to Simpson et al., Cancer Res. 66: 4835-4842 (2006) and Nakamori et al., Clin Cancer Res. 9: 2727-2733 (2003).

[0174] The herpes simplex virus of the present invention may be a variant that attenuates proliferation in normal cells, or, in addition to the variants described above (also referred to in this specification as a "proliferation-restricting alteration"), instead of the aforementioned variants. A proliferation-restricting alteration may be, for example, a variant that inactivates the expression of functional ICP34.5. ICP34.5 (e.g., the amino acid sequence of SEQ ID NO: 30 (KOS strain)) is a neurotoxic factor present in herpes simplex virus. In cancer cells, there are abnormalities in the signal transduction system related to the activation of protein kinase R (PKR), resulting in a higher tolerance for viruses compared to normal cells, and in some cases, resistance to exogenous interferon. On the one hand, herpes simplex virus and the like retain the ICP34.5 protein as an active viral gene product that deactivates PKR. It is known that herpes simplex virus variants with inactivation of functional ICP34.5 expression significantly inhibit proliferation in normal cells and proliferate well in cancer cells with almost no effect. Therefore, the herpes simplex virus with a variant that inactivates the expression of functional ICP34.5 proliferates only in cancer cells and inhibits proliferation in normal cells, thus further enhancing safety is expected. In one embodiment, the herpes simplex virus of the present invention may have a variant that inactivates the expression of functional ICP34.5, for example, any variant that makes ICP34.5 nonfunctional (e.g., nonsense variant), deletion or substitution, or partial or complete deletion of the gene encoding ICP34.5, resulting in the inactivation of functional ICP34.5 expression. It may also have, for example, the variants of ICP34.5 described in International Publication No. 2020 / 090871, Japanese Patent Application Publication No. 2006-528484, Chou et al. 1990, Science 250:1262-1266; and Maclean et al. 1991, J. Gen. Virol. 72:631-639. The expression inactivation is not limited to, for example, the expression inactivation of a functional ICP34.5 protein showing 70%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity relative to the amino acid sequence of the KOS strain shown in SEQ ID NO: 30. It can also refer to any nonfunctional variation (e.g., nonsense variation), deletion, or substitution in these amino acid sequences, or the deletion of part or all of the genes encoding these proteins, resulting in the expression inactivation of functional ICP34.5. Furthermore, in this specification, "functional ICP34.5" refers to an ICP34.5 protein that performs the functions of wild-type ICP34.5 (e.g., the function of PKR deactivation), and "inactivation of functional ICP34.5 expression" means not performing the function of PKR deactivation, or its function being weakened compared to wild-type ICP34.5.In addition to ICP34.5 mentioned above, other restrictive proliferative alterations applicable in this invention application may be introduced using various methods listed in Peters et al.'s paper (Mol Ther Oncolytics. 2015; 2. pii: 15010. Epub 2015 Jul 22) and other papers further cited therein, such as one or more gene alterations (variations, deletions, and / or substitutions) selected from ICP6 / UL39, Thymidine kinase / UL23, UL2 / UNG, ICP47 / Us12 and Us11, Us3, ICP0, UL56, VP16 / UL48, and UL24.

[0175] Furthermore, the HSV of the present invention can also be integrated into its genome in a state capable of expressing reporter genes and any therapeutic genes (e.g., genes that enhance the killing effect on cancer cells, genes that inhibit tumor angiogenesis, and genes that promote anti-tumor immune responses, etc.) (specifically, see Peters et al., MolTher Oncolytics. 2015; 2. pii: 15010. Epub 2015 Jul 22, etc.). The location of the integrated gene on the HSV genome is not particularly limited, and can be any location on the HSV genome as long as it does not inhibit the function of HSV as a tumor-lysing virus.

[0176] As a reporter gene, there are no particular limitations, and examples include the LacZ gene (Mineta et al., Nat Med. 1: 938-943 1995), the Luc gene (Yamamoto et al., Gene Ther. 13: 1731-1736 2006), the GFP gene (Adusumilli et al., FASEB J. 20: 726-728 2006), and the NIS gene (Li et al., Cancer Gene Ther. 20: 478-485 2013), etc.

[0177] In addition, therapeutic genes are not particularly limited. Examples include genes encoding cell damage molecules such as the CD gene (Nakamura et al., Cancer Res. 61: 5447-5452 2001) and the TRAIL gene (Tamura et al., Mol Ther. 21: 68-77 2013); genes encoding immune-activating molecules such as the GM-CSF gene (Liu et al., Gene Ther. 10: 292-303 2003) and the IL-12 gene (Roth et al., Ther Clin Dev. 25: 16-27 2014); and genes encoding microenvironment control molecules such as the Angiostatin gene (Zhang et al., Mol Ther. 20: 37-45 2012), the PF4 gene (Liu et al., Mol Ther. 14: 789-797 2006), and the Chondroitinase-ABC gene (Dmitrieva et al., Clin...). CancerRes.17:1362-1372 (2011), etc.

[0178] This invention also includes the nucleic acid (nucleic acid molecule) encoding the herpes simplex virus described in this specification.

[0179] The herpes simplex virus of the present invention can be manufactured by standard methods known to those skilled in the art of HSV virology. However, in order to facilitate the manipulation of the HSV genome and the manufacture of the vector of the present invention, the present invention also provides a vector having the genomic nucleic acid of the recombinant virus of the present invention. The preferred vector is a bacterial artificial chromosome (“BAC”) having the genome of the recombinant virus of the present invention, which facilitates the manipulation of HSV in bacterial systems. As an HSV-BAC construct, for example, KOS-37BAC (Even et al., 2006 Virus Res. 119(2): 195) can be used, and various variants can be introduced by homologous recombination (e.g., Red homologous recombination: Tischer et al., 2006. Biotechniques. 40(2): 191).

[0180] HSV-based vectors and methods for constructing them, for example, are described in U.S. Patent Nos. 7,078,029, 6,261,552, 5,998,174, 5,879,934, 5,849,572, 5,849,571, 5,837,532, 5,804,413, and 5,658,724, and International Patent Application Nos. WO91 / 02788, WO96 / 04394, WO98 / 15637, and WO99 / 06583, which are incorporated herein by reference in their entirety. The HSV sequence has been published (see also NCBI accession number NC_001806, McGoechetal., J. Gen. Virol, 69(PT7), 1531(1988)), which facilitates the design of the vector for the recombinant virus of the present invention. Depending on the circumstances, the tumor-lysing recombinant virus of the present invention is herpes simplex virus (HSV-1), containing a gD gene with Δ2-24 and Y38C variants, a gB gene with D285N / A549T variants (NT variants) and R858H variants, a gK gene with A40T variants, and a nucleic acid sequence encoding an anti-IL13RA2 antibody or its antigen-binding fragment fused to the gD gene (e.g., the Δ2-24 portion).

[0181] The genome of the herpes simplex virus of the present invention may further contain reporter proteins such as green fluorescent protein (GFP), luciferase, or non-viral genes (exogenous expression cassettes) of payload molecules. Reporter proteins facilitate the identification of target cells infected with the recombinant virus of the present invention. In addition, reporter proteins released from lysed tumor cells can be used as an indicator to monitor tumor lysis.

[0182] This invention also includes a method for manufacturing the herpes simplex virus described in this specification. The herpes simplex virus of this invention is used to infect producing cells, and the herpes simplex virus can be recovered from its culture supernatant or the producing cells. Examples of producing cells include RPMI7951, U87, CHO, 293, COS, BHK, HeLa, or Vero cells, or substrains expressing IL13RA2 in these cell lines (e.g., Vero-IL13RA2 cells), or substrains expressing gD in these cell lines (e.g., VD60 cells), but are not limited thereto. The herpes simplex virus can be purified by methods such as centrifugation.

[0183] This invention also includes cells that produce the herpes simplex virus described in this specification. Cells producing the herpes simplex virus may be cells that temporarily produce the herpes simplex virus by introducing nucleic acid (nucleic acid molecule) encoding the herpes simplex virus, as described in this specification, or cells that continue to produce the herpes simplex virus by integrating the nucleic acid (nucleic acid molecule) encoding the herpes simplex virus as described in this specification into the cell's genome. Examples of cells that produce the herpes simplex virus as described in this specification include RPMI7951, U87, CHO, 293, COS, BHK, HeLa, or Vero cells, or substrains expressing IL13RA2 in these cell lines (e.g., Vero-IL13RA2 cells), or substrains expressing gD in these cell lines (e.g., VD60 cells), but are not limited thereto. Some specific embodiments of this invention relate to herpes simplex virus-containing storage products and compositions as described in this specification. In several embodiments, this invention relates to virus storage products containing recombinant virus as described in this specification. In several embodiments, the viral reservoir is a homologous reservoir. The preparation and analysis of viral reservoirs are well known in the art. For example, the viral reservoir can be prepared using a roller bottle containing cells transduced with the viral vector. The viral reservoir can then be purified using a continuous Nycodenz gradient, aliquoted, and stored as needed. The potency of viral reservoirs varies considerably, depending heavily on the viral genotype used to prepare them, the process employed, and the cell line. In certain embodiments, the viral reservoirs attempted in this specification (e.g., a viral reservoir of herpes simplex virus) have a potency of at least about 10. 5 Plaque formation units (pfu) / mL, for example, at least about 10 6 pfu / mL or more preferably at least about 10 pfu / mL 7 pfu / mL. In a particular embodiment, the potency may be at least about 10. 8 pfu / mL, or preferably at least about 10 pfu / mL. 9 At least approximately 10 pfu / mL. 10 pfu / mL or at least about 10 11 High-potency storage medium with pfu / mL.

[0184] Pharmaceutical Compositions

[0185] This invention also aims to include pharmaceutical compositions containing the herpes simplex virus described in this specification and a pharmaceutically permissible carrier. The term "pharmaceutically permissible" refers to molecular entities and compositions that do not cause allergic reactions or similar adverse reactions when administered to a subject (e.g., a human). As used in this specification, the term "pharmaceutical composition" refers to a formulation containing one or more of the herpes simplex viruses described in this specification that can be administered or delivered to a subject and / or cells. Typically, a formulation contains the herpes simplex virus described in this specification as an active ingredient, and any physiologically permissible carrier, diluent, and / or excipient. A "pharmaceutical composition" is a composition of one or more agents that can be administered or delivered to a patient and / or subject and / or cells for the treatment of a specific disease or disorder. As a pharmaceutical composition, a nucleic acid molecule encoding the herpes simplex virus described in the specification may be used instead of the herpes simplex virus of this invention.

[0186] The compositions disclosed in this specification can be formulated in neutral or salt form. "Pharmaceutically permissible salts" include both acid addition salts and base addition salts. Pharmaceutically permissible salts include acid addition salts (formed from the free amino groups of proteins), which are composed of inorganic acids, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, etc., and organic acids, such as, but not limited to, acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamide benzoic acid, camphoric acid, camphor-10-sulfonic acid, decanoic acid, hexanoic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclohexane, dodecyl sulfate, ethane-1,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactopyric acid, gentianic acid, etc. Salts formed from glucoheponic acid, glucuronic acid, glucuronic acid, glutamic acid, glutamate, 2-oxoglutamate, glycerophosphate, diol acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucinic acid, naphthalene-1,5-disulfonic acid, naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, dihydroxynaphthoic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanate, p-toluenesulfonic acid, trifluoroacetic acid, undecenoic acid, etc. Salts formed from free carboxyl groups can also be derived from inorganic bases, such as sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, and aluminum salts. Salts derived from organic bases, not limited to these, include primary, secondary, and tertiary amines, substituted amines containing naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, such as salts of ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, dianophenoxylate, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, heparin, choline, betaine, phenethylbenzylamine, benzathine penicillin, ethylenediamine, glucosamine, methylglucosamine, theobromine, triethanolamine, tromethamine, purine, piperazine, piperidine, N-ethylpiperidine, polyamine resins, etc. Particularly preferred organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine. After formulation, the solution is administered in a therapeutically effective amount using a method suitable for application. This formulation can be easily administered in a variety of dosage forms, such as injections and drug-release capsules.

[0187] The term "carrier" as used in this specification includes all solvents, dispersants, media, coatings, diluents, antibacterial and antifungal agents, isotropic and absorption-retarding agents, buffers, carrier solutions, suspensions, colloids, etc. The use of pharmaceutically active substances in the media and pharmaceuticals involved is well known in the art. Except where any conventional media or pharmaceuticals are unsuitable for the active ingredient, the intention is to use it in a therapeutic composition. Additional active ingredients may also be incorporated into the composition.

[0188] As used in this specification, "medically permitted carriers" may include, but are not limited to, any pharmaceutically permitted cell culture media and / or physiologically suitable adjuvants containing emulsifiers that are approved by the U.S. Food and Drug Administration (FDA) for use in humans and / or livestock. Examples of pharmaceutically permissible carriers include sugars, such as lactose, glucose, and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; gum arabic; malt; gelatin; talc; cocoa butter; waxes; animal and vegetable fats; paraffin wax; silicones; bentonite; silicic acid; zinc oxide; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols, such as propylene glycol; polyols, such as glycerol, sorbitol, mannitol, and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffers, such as magnesium hydroxide and aluminum hydroxide; alginic acid; water without pyrogenic substances; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffer; and any other suitable substances used in pharmaceutical preparations, but not limited to these. Except where any conventional media and / or pharmaceutical agents are not suitable for the pharmaceutical agents disclosed herein, an attempt is made to use it in a therapeutic composition. An adjunct active ingredient may also be incorporated into the composition.

[0189] Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as colorants, release agents, coating agents, sweeteners, flavorings and fragrances, preservatives and antioxidants may also be included in the composition. Examples of pharmaceutically permissible antioxidants include (1) water-soluble antioxidants, such as ascorbic acid, cysteine ​​hydrochloride, sodium bisulfite, sodium metabisulfite, sodium sulfite, etc., (2) oil-soluble antioxidants, such as palmitic acid ascorbic acid group, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, α-growth phenol, etc., (3) metal chelating agents, such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, etc.

[0190] In one embodiment, the carrier-containing pharmaceutical composition is suitable for non-oral administration, for example, intravascular (intravenous or intra-arterial), intrathoracic, intraperitoneal, intracerebral, intra-organ, intratumoral, subcutaneous, or intramuscular administration. Pharmaceutically permissible carriers include sterile aqueous solutions or dispersions for immediate preparation of sterile injectable solutions or dispersions, and sterile powders. The use of media and agents related to pharmaceutically active substances is well known in the art. Except where any conventional media or agents are unsuitable for the recombinant virus or the nucleic acid molecule, the use of them in the pharmaceutical compositions of the present invention is intended.

[0191] The compositions of the present invention can be formulated containing one or more polypeptides, polynucleotides, carriers containing them, cells infected with the recombinant virus of the present invention, alone or in combination with one or more other therapeutic agents, in a pharmaceutically or physiologically permissible solution for administration to cells or subjects (e.g., humans). It is also understood, as needed, that the compositions of the present invention can be administered in combination with other agents, such as antibodies, cytokines, growth factors, hormones, small molecules, or various pharmaceutically active agents. Essentially, the additional agents can be included in the other components of the composition without limitation, provided they do not adversely affect the ability of the composition to achieve the intended treatment.

[0192] In the pharmaceutical compositions of the present invention, the formulation of pharmaceutically permissible excipients and carrier solutions is as well known to those skilled in the art as the development of suitable administration and treatment plans for the use of the specific compositions described herein in a variety of treatment regimens. After formulation, the solution is administered in a manner suitable for the administration of the formulation and in an amount that brings about improvement of the symptoms or a therapeutic effect. The formulation is readily administered in a variety of dosage forms, such as ingestible solutions, drug-release capsules, etc. The dosage may vary slightly depending on the state of the subject during treatment. The dosage suitable for each subject can be determined by the administering agent. Furthermore, in the case of human administration, the formulation meets the criteria for sterility, general safety, and purity required by the standards of the Center for Biological Products Evaluation and Research of the U.S. Food and Drug Administration (FDA).

[0193] In certain specific circumstances, as described in, for example, U.S. Patent Nos. 5,543,158, 5,641,515, and 5,399,363 (each expressly incorporated herein by reference in its entirety), the pharmaceutical compositions, recombinant viruses, and nucleic acid molecules disclosed herein are preferably delivered non-orally (e.g., intravascular (intravenous or intra-arterial), intrathoracic, intraperitoneal, intracerebral, other organ, intratumoral, subcutaneous, or intramuscular). Solutions of the active compound as a free base or pharmaceutically permissible salt can be prepared in water suitable for mixing with a surfactant, such as hydroxypropyl cellulose. Dispersions can also be prepared similarly in glycerol, liquid polyethylene glycol, and mixtures thereof, as well as in oils. Under normal storage and use conditions, these preparations contain preservatives to prevent microbial growth.

[0194] In pharmaceutical formulations suitable for injection, sterile aqueous solutions or dispersions and sterile powders for immediate preparation (US Patent No. 5,466,468, expressly incorporated herein by reference in their entirety) are included. In all cases, the formulation shall be sterile and fluid to the extent that it allows for easy needle penetration. It shall be stable under manufacturing and storage conditions and shall be protected against contamination by microorganisms, such as bacteria and fungi. The carrier may be, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and / or solvents or dispersants containing vegetable oils. Suitable fluidity may be maintained, for example, by coating, for example, by the use of lecithin, by maintaining the necessary particle size in the case of dispersions, and by the use of surfactants. Prevention of microbial action may be promoted by a variety of antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In most cases, isotonic agents, such as sugar or sodium chloride, are preferred. Sustained absorption of the injectable composition can be achieved by the use of agents that delay absorption, such as aluminum monostearate and gelatin, in the composition. The formulation of aqueous compositions containing proteins as active ingredients is well understood in the art. Typically, the composition is formulated as either a liquid solution or a suspension for injection; a solid form suitable for use as a liquid solution or suspension prior to injection may also be prepared. The formulation may also be emulsified.

[0195] In cases of non-oral administration of aqueous solutions, for example, to adequately buffer the solution as needed, the liquid diluent should initially be isotonic with sufficient physiological saline or glucose. These specific aqueous solutions are particularly suitable for non-oral administration (e.g., intravascular (intravenous or intra-arterial), intrathoracic, intraperitoneal, intracerebral, other organ, intratumoral, subcutaneous, or intramuscular administration). Related sterile aqueous media that may be used are known to those skilled in the art with reference to this disclosure. For example, a single administration dose may be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous injection solution for injection at the intended injection site (see, for example, Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, MD: Lippincott Williams & Wilkins, 2000). Variations in the dosage will inevitably occur corresponding to the condition of the patient being treated. The person responsible for administration can determine the appropriate dosage for each patient. Furthermore, when administered to humans, the formulation must meet the standards for sterility, pyrogenicity, and general safety and purity required by the Bureau of Biological Products of the U.S. Food and Drug Administration (FDA).

[0196] Sterile injectable solutions can be prepared by integrating the necessary amount of the active compound, as needed, along with various other components listed above, into a suitable solvent, followed by filtration and sterilization. Generally, dispersions are prepared by integrating various sterile active ingredients from a basic dispersant and the others listed above into a sterile medium containing the necessary other components. In the case of sterile powders used to prepare sterile injectable solutions, preferred preparation methods include vacuum drying and freeze-drying techniques, whereby, in addition to the powder of the active ingredient, any further desired components are obtained from the pre-sterilized and filtered solution.

[0197] In a particular embodiment, the composition may be delivered by nasal spray, inhalation, and / or other aerosol delivery media. Methods for direct delivery of polynucleotide and peptide compositions to the lungs via nasal aerosol spray are described, for example, in U.S. Patent Nos. 5,756,353 and 5,804,212 (each expressly incorporated herein by reference in its entirety). Similarly, delivery of pharmaceuticals using nasal microparticle resins (Taken aga et al., 1998) and lysophosphatidylglycerol compounds (U.S. Patent No. 5,725,871, expressly incorporated herein by reference in its entirety) are also known in the pharmaceutical industry. Likewise, transmucosal delivery of pharmaceuticals in the form of a polytetrafluoroethylene support matrix is ​​described in U.S. Patent No. 5,780,045 (expressly incorporated herein by reference in its entirety).

[0198] In a particular embodiment, delivery, for introducing the composition of the present invention into suitable host cells, may be carried out by mixing liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, etc., with CPP peptides. In particular, the composition of the present invention may be formulated by encapsulation into any of lipid particles, liposomes, vesicles, nanospheres, nanoparticles, etc., during delivery. The formulation and use of the delivery medium may be carried out using known conventional techniques. The formulations and compositions of the present invention may contain one or more peptides, polynucleotides, and small molecules described in this specification, alone or in combination with one or more other therapeutic agents, in a pharmaceutically permissible or physiologically permissible solution (e.g., culture medium) for administration to cells or subjects (e.g., humans). It is also understood that, as needed, the compositions of the present invention may be administered in combination with, for example, cells, other proteins or peptides, or various pharmaceutically active agents.

[0199] In certain embodiments, the formulations or pharmaceutical compositions of the present invention contain cells in contact with various polynucleotides or combinations of herpes simplex viruses described herein.

[0200] Ex vivo delivery formulations for delivering various polynucleotides containing viral vectors to cells may also include a variety of transfection agents known in the art, such as calcium phosphate, electroporation, heat shock, and various liposome formulations (i.e., lipid-mediated transfection). Liposomes are lipid bilayers encapsulated in aqueous fluid fractions. DNA spontaneously binds to the outer surface of cationic liposomes (due to their charge), and these liposomes interact with the cell membrane.

[0201] Specific embodiments of the present invention may also include other formulations, for example, those known in the pharmaceutical field, such as those described in Remington: The Science and Practice of Pharmacy, 20th Edition, Baltimore, MD: Lippincott Williams & Wilkins, 2000.

[0202] In a particular embodiment, the present invention provides a pharmaceutically approved composition containing a therapeutically effective amount of one or more viral vectors or polynucleotides described herein, formulated together with one or more pharmaceutically approved carriers (additives) and / or diluents (e.g., pharmaceutically approved cell culture media). As used herein, "therapeutically effective amount" refers to the amount of the composition or recombinant virus described herein necessary to achieve the desired physiological and / or biological results. The "therapeutically effective amount" of a virus, viral reservoir, or composition may correspond to changes in factors such as an individual's symptoms, age, sex, weight, and the ability of stem cells and precursor cells in that individual to induce a desired response. Additionally, the therapeutically effective amount may also have a therapeutic benefit that outweighs any toxic or harmful effects. The term "therapeutically effective amount" includes an amount effective for the "treatment" target (e.g., a patient). Therapeutically effective amounts may consist of plaque-forming units (pfu) (e.g., at least about 10). 1 ~At least about 10 20 Specifically, about 10 4 ~ Approximately 10 15 More specifically, about 10 6 ~ Approximately 10 12 The total number of pfu (pfu) or the number of viral genomes (e.g., at least about 10). 1 ~At least about 10 20 Specifically, about 10 4 ~ Approximately 10 15 More specifically, about 10 6 ~ Approximately 10 12Quantification of the viral genome. Those skilled in the art will understand that the effective therapeutic dose varies depending on the type of virus administered, the nature of the preparation, the route of administration, the nature and / or severity of the disease being treated, and / or the general condition and health of the subject.

[0203] Several embodiments of the present invention include a method for killing cancerous cells, comprising exposing the cancerous cells to the herpes simplex virus or a combination thereof as described herein under conditions sufficient for infection and replication of the herpes simplex virus within the cancerous cells, wherein replication of the herpes simplex virus within the cancerous cells leads to cell death. In several embodiments, the cancerous cells are killed in vivo using this method. In a particular embodiment, the cancerous cells killed by this method are located within a tumor.

[0204] "Administration" in this specification means, as an embodiment, bringing the herpes simplex virus, viral reservoir, or combination thereof, or nucleic acid molecule or composition encoding the recombinant virus that targets IL13RA2 into contact with cells and / or tissues by introducing the herpes simplex virus, viral reservoir, or combination thereof, or nucleic acid molecule or composition encoding the virus as described in the specification into contact with the subject. Administration can be performed by injection, perfusion, inhalation, diet, electroosmosis, hemodialysis, iontophoresis, and other methods known in the art. The pathways for application vary depending on the location and nature of the disease being treated, and may include, for example, the ear, buccal side, conjunctiva, skin, teeth, cervical canal, cavity, trachea, intestine, epidural, interstitium, joint, artery, abdominal cavity, ear, bile duct, bronchus, sac, cavity, brain, alveolar fossa, cornea, cranium, dental crown, coronary artery, intracranial, skin, intervertebral disc, canal, duodenum, dura mater, epicardium, epidermis, esophagus, stomach, gums, liver, ileum, fossa, tongue, cavity, lymph nodes, breast, bone marrow, medullary membrane, muscle, nasal cavity, nodule, eye, retinas, ovary, pericardium, pleural cavity, prostate, lung, rumen, and spinal cord. Intrasynovial, intratendinous, intratesticular, intracapsular, intrathoracic, intratumoral, intrauterine, intravascular, intravenous, intrabladder, intravesical, intravenous, intravenous, intravenous, intravitreal, larynx, nose, nasal cavity, stomach, oral, eye, oral cavity, pharynx, non-oral, percutaneous, periarticular, epidural, perineurial, periodontal, respiratory, vascular tissue, rectum, spinal cord, subarachnoid, subconjunctival, subcutaneous, subdermal, subgingival, sublingual, submucosal, subretinal, local, transdermal, transendocardial, transmucosal, transplacental, transtracheal, transtympanic membrane, ureter, urethra, and / or vaginal infusion, irrigation, direct injection, and oral administration.

[0205] As used in this specification, the terms "treatment" and "treatment" refer to the administration of a therapeutically effective amount of the virus or its composition described herein to a subject in a manner that improves the subject's disease or condition, or the symptoms of the disease or condition. This improvement may also be any improvement or cure of the disease or condition, or the symptoms of the disease or condition. This improvement may be a visible or measurable improvement, or an improvement in the subject's overall sense of well-being. Therefore, those skilled in the art will understand that treatment may improve symptoms, or it may not completely cure the disease. "Prophylactic effective amount" refers to the amount of virus, viral stock, or composition effective in achieving the desired preventative effect. As may be used in this specification, "prevention" means complete prevention of the symptoms of a disease, delay in the expression of the symptoms of a disease, or mitigation of the severity of subsequently expressed symptoms. Generally, not necessarily, the preventative effective amount is less than the therapeutic effective amount, intended for use on a subject before or during the initial stages of a disease.

[0206] The pharmaceutical composition containing herpes simplex virus targeting IL13RA2 disclosed in this application can serve as a therapeutic agent for tumors expressing IL13RA2. Examples of tumors expressing IL13RA2 include, for instance, melanoma, osteosarcoma, leukemia, lymphoma, prostate cancer, lung cancer (including malignant mesothelioma), gliomas (e.g., glioblastoma, astrocytoma, myeloma (medulloblastoma)), head and neck cancer, renal cancer, Kaposi's sarcoma, colorectal cancer, pancreatic cancer, adrenal cancer, breast cancer, or ovarian cancer. Thus, these cancer types become the therapeutic targets of this invention.

[0207] [Antibody or its antigen-binding fragment]

[0208] One embodiment of the anti-IL13RA2 antibody or its antigen-binding fragment of the present invention is an antibody or its antigen-binding fragment that specifically recognizes tumor cells expressing IL13RA2.

[0209] One embodiment of the anti-IL13RA2 antibody or its antigen-binding fragment of the present invention has the following amino acid sequence in which the heavy chain CDR (HCDR1, HCDR2, HCDR3) and the light chain CDR (LCDR1, LCDR2, LCDR3):

[0210] (i)HCDR1: (SEQ ID NO: 1: RHGIH)

[0211] (ii) HCDR2: (SEQ ID NO: 2: VIWAGGSTNY NSALMS)

[0212] (iii) HCDR3: (SEQ ID NO: 3: DHFDSFDY)

[0213] (iv) LCDR1: (SEQ ID NO: 4: TASSSVSSSY LH)

[0214] (v)LCDR2: (SEQ ID NO: 5: STSNLAS), and (vi)LCDR3: (SEQ ID NO: 6: HQYHRSPLT), or

[0215] These amino acid sequences contain one to several amino acid variations.

[0216] In addition, one embodiment of the anti-IL13RA2 antibody or its antigen-binding fragment of the present invention has the following amino acid sequence in the heavy chain CDR (HCDR1, HCDR2, HCDR3):

[0217] (i)HCDR1: (SEQ ID NO: 1: RHGIH)

[0218] (ii) HCDR2: (SEQ ID NO: 2: VIWAGGSTNY NSALMS)

[0219] (iii)HCDR3: (SEQ ID NO: 3: DHFDSFDY), or

[0220] These amino acid sequences contain one to several (one, two, or three) amino acid variations.

[0221] In addition, one embodiment of the anti-IL13RA2 antibody or its antigen-binding fragment of the present invention has the following amino acid sequence in the light chain CDRs (LCDR1, LCDR2, LCDR3):

[0222] (i) LCDR1: (SEQ ID NO: 4: TASSSVSSSY LH)

[0223] (ii) LCDR2: (SEQ ID NO: 5: STSNLAS), and

[0224] (iii) LCDR3: (SEQ ID NO: 6: HQYHRSPLT), or

[0225] These amino acid sequences contain one to several (one, two, or three) amino acid variations.

[0226] Additionally, one embodiment of the anti-IL13RA2 antibody or its antigen-binding fragment of the present invention may contain V as shown in SEQ ID NO: 8. LThe amino acid sequence of the region shows 80% or more (e.g., 85%, 90%, 95%, 98%, 99%, or 100%) sequence identity and is identical to the V shown in SEQ ID NO: 10. H Anti-IL13RA2 antibodies or their antigen-binding fragments that exhibit 80% or more (e.g., 85%, 90%, 95%, 98%, 99%, or 100%) sequence identity in the amino acid sequence of the region.

[0227] In exemplary embodiments, the anti-IL13RA2 antibody of the present invention may also contain mouse constant regions (IgG1, IgG2a, IgG2b, IgG3, IgM, IgD, IgE, IgA). In some embodiments, the antibody may also be a chimeric antibody, humanized antibody, or human antibody having human constant regions (IgG1, IgG2, IgG3, IgG4, IgM, IgD, IgE, IgA1, IgA2). Furthermore, in some embodiments, to improve affinity or cohesion, the antibody may also be an antibody with bispecificity, trispecificity, or multispecificity (bispecific antibody, trispecific antibody, multispecific antibody).

[0228] In some embodiments, the anti-IL13RA2 antibody or its antigen-binding fragment of the present invention is a humanized antibody. The term "humanized" is used in connection with the use of the antibody to refer to an antibody having at least a CDR region derived from a non-human source, operated in a manner that is more similar in structure and immune function to an actual human antibody than the original source antibody. For example, in humanization, this relates to the transplantation of a CDR from a non-human antibody source, such as a mouse antibody, into a human antibody. Additionally, in humanization, as is known in the art, it may also relate to the selection of amino acid substitutions that transform a non-human sequence into a human-like sequence.

[0229] In some embodiments of this disclosure, the present invention relates to an antigen-binding fragment of an anti-IL13RA2 antibody. The antigen-binding fragment may also be an antigen-binding fragment of any of the antibodies described in this specification. The antigen-binding fragment includes Fab, Fab', F(ab')2, Fv, scFv, dsFv, disodium antibodies, trisodium antibodies, and bis-scFv, etc., and is not limited to these as long as it is derived from an anti-IL13RA2 antibody. Disodium antibodies (dimers), trisodium antibodies (trimers), or tetrasodium antibodies (tetramers) are known in the art. For example, see Kortt et al., Biomol. Eng. 2001, 18: 95-108, (2001) and Todorovska et al., J. Immunol Methods. 248: 47-66, (2001).

[0230] scFv can be constructed from the V domain of an antibody heavy chain linked to a variable (V) domain of the antibody light chain via a synthetic peptide (linker), and can be generated using common recombinant DNA techniques (see, for example, Janeway et al., Immunobiology, 2nd ed., Garland Publishing, New York, (1996)). As the linker, a flexible linker containing (Gly4Ser)3 can be used, for example. Furthermore, in scFv, the V domain linked by the linker... L Region and V H The order of region connection is not particularly restricted. Similarly, disulfide-stabilized variable region fragments (dsFv) can be modulated by recombinant DNA technology (e.g., Reiter et al., Protein Engineering, 7, 697-704 (1994)).

[0231] In some embodiments of this disclosure, the antigen-binding fragment of the anti-IL13RA2 antibody of the present invention may be an antigen-binding fragment containing, for example, a sequence exhibiting 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity relative to the sequence shown in SEQ ID NO: 7. Additionally, in some embodiments of this disclosure, the antigen-binding fragment of the anti-IL13RA2 antibody of the present invention may also be a fragment containing heavy chain CDRs (HCDR1, HCDR2, HCDR3) and light chain CDRs (LCDR1, LCDR2, LCDR3) having the following amino acid sequence:

[0232] (i)HCDR1: (SEQ ID NO: 1: RHGIH)

[0233] (ii) HCDR2: (SEQ ID NO: 2: VIWAGGSTNY NSALMS)

[0234] (iii) HCDR3: (SEQ ID NO: 3: DHFDSFDY)

[0235] (iv) LCDR1: (SEQ ID NO: 4: TASSSVSSSY LH)

[0236] (v)LCDR2: (SEQ ID NO: 5: STSNLAS), and (vi)LCDR3: (SEQ ID NO: 6: HQYHRSPLT), or

[0237] These are antigen-binding fragments that have one to several amino acid variations in their amino acid sequences and exhibit 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, or 100% sequence identity relative to the sequence shown in SEQ ID NO: 7.

[0238] As an antigen-binding fragment having the amino acid sequence shown in SEQ ID NO: 7 in one embodiment of the present invention, its amino acid variations include "substitution" (replacing with other amino acids), "deletion" (excluding the amino acid), and "insertion" (addition of other amino acids). Additionally, as an embodiment of "substitution," there is "conservative amino acid substitution." Conservative amino acid substitution is based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphiphilic properties of the relevant residues. For example, nonpolar (hydrophobic) amino acids include alanine (Ala, A), leucine (Leu, L), isoleucine (Ile, I), valine (Val, V), proline (Pro, P), phenylalanine (Phe, F), tryptophan (Trp, W), and methionine (Met, M); polar neutral amino acids include glycine (Gly, G), serine (Ser, S), threonine (Thr, T), cysteine ​​(Cys, C), tyrosine (Tyr, Y), asparagine (Asn, N), and glutamine (Gln, Q); positively charged (basic) amino acids include arginine (Arg, R), lysine (Lys, K), and histidine (His, H); and charged (acidic) amino acids include aspartic acid (Asp, D) and glutamic acid (Glu, E). The "substitution," "insertion," or "deletion" can preferably be in the range of 1 to 25, 1 to 20, 1 to 15, 1 to 10, or 1 to 5 amino acids. Mutations can also be introduced by substituting amino acids in a polypeptide molecule system or randomly using recombinant DNA methods, and then measuring the activity of the resulting recombinant variants.

[0239] One embodiment of the anti-IL13RA2 antibody or its antigen-binding fragment of the present invention is that, in the binding of the above-mentioned anti-IL13RA2 antibody or its antigen-binding fragment to human IL13RA2, it at least partially competes with the anti-IL13RA2 antibody or its antigen-binding fragment containing the amino acid sequences of the heavy chain CDR (HCDR1, HCDR2, HCDR3) and light chain CDR (LCDR1, LCDR2, LCDR3) described in SEQ ID NO: 1 to 6. The term "competitive binding" of the antibody or its antigen-binding fragment to the target protein refers to, for example, when the IL13RA2 protein is reacted with the antibody or its antigen-binding fragment to the target protein, and subsequently reacted with an anti-IL13RA2 antibody or antigen-binding fragment containing the amino acid sequences of the heavy chain CDRs (HCDR1, HCDR2, HCDR3) and light chain CDRs (LCDR1, LCDR2, LCDR3) shown in SEQ ID NO: 1-6, the antibody or its antigen-binding fragment to the target protein reduces the binding of the anti-IL13RA2 antibody or antigen-binding fragment containing the amino acid sequences of the heavy chain CDRs (HCDR1, HCDR2, HCDR3) and light chain CDRs (LCDR1, LCDR2, LCDR3) shown in SEQ ID NO: 1-6 to the IL13RA2 protein. Whether the antibody or its antigen-binding fragment competitively binds to an anti-IL13RA2 antibody or antigen-binding fragment containing the amino acid sequences of the heavy chain CDRs (HCDR1, HCDR2, HCDR3) and light chain CDRs (LCDR1, LCDR2, LCDR3) described in SEQ ID NO: 1-6 can be verified by common methods such as ELISA, RIA, FACS, and Biacore (trademark) method.

[0240] The anti-IL13RA2 antibody and its antigen-binding fragment of the present invention can have any level of affinity or binding activity for IL13RA2. The dissociation constant (KD) can also be any of the dissociation constants of the binding units described herein. The binding constant containing the dissociation constant is determined by methods known in the art, for example, methods utilizing the principle of surface plasmon resonance, or methods utilizing the Biacore (trademark) system.

[0241] In the exemplary embodiments, KD is between about 0.0001 nM and about 1000 nM. In some embodiments, KD is above about 0.0001 nM, above about 0.001 nM, above about 0.01 nM, above about 0.1 nM, above about 1 nM, or above about 10 nM, or below about 1000 nM, below about 10 nM, below about 1 nM, below about 0.1 nM, below about 0.01 nM, or below about 0.001 nM.

[0242] In the exemplary embodiments, the antibody may be any type of immunoglobulin known in the art. For example, the antibody may be any isotype, such as IgA, IgD, IgE, IgG, or IgM. The antibody may be monoclonal or polyclonal. The antibody may be a naturally occurring antibody, for example, an isolated and / or purified antibody from mammals such as mice, rabbits, goats, horses, chickens, hamsters, camels, humans, etc. In this regard, the antibody may also be a mammalian antibody, for example, mouse antibodies, rabbit antibodies, goat antibodies, horse antibodies, chicken antibodies, hamster antibodies, human antibodies, etc. The term "isolated" means, as used in this specification, removed from the natural environment. The term "purified," as used in this specification, relates to the isolation of molecules or compounds that are substantially free of impurities in the form commonly associated with molecules or compounds in the natural environment, and refers to an increase in purity resulting from the separation from other components of the original composition. "Purity" is a relative term and should be understood not necessarily to mean absolute purity, absolute concentration, or absolute selectivity. In some embodiments, the purity is at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% (e.g., at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or approximately 100%). In a preferred embodiment, the anti-IL13RA2 antibody or its antigen-binding fragment of the present invention is internalized into tumor cells expressing IL13RA2. Internalization into IL13RA2-expressing tumor cells can be achieved using a directly or indirectly labeled anti-IL13RA2 antibody or its antigen-binding fragment, such as fluorescently labeled... The study involved contact with tumor cells expressing IL13RA2 and observation using (phase contrast) microscopy. Alternatively, internalization into IL13RA2-expressing tumor cells could be evaluated using DT3C, a protein combining the catalytic region of diphtheria toxin (DT) and the antibody-binding region of protein G. DT3C specifically binds to the Fc region of the antibody and is stably absorbed into the cell, inducing cell death through protein synthesis inhibition. This system allows for simultaneous observation of antibody internalization and the cell-killing effect caused by immunotoxins, enabling the screening of antibodies with internalization potential (Yamaguchi, M., Hamada, H., et al., Biochemical and Biophysical Research Communications 454 (2014) 600-603). The amount of the anti-IL13RA2 antibody or its antigen-binding fragment internalized into IL13RA2-expressing cells according to the present invention is at least 5-fold, at least 10-fold, or at least 50-fold more internalized to the same cells that do not express IL13RA2.

[0243] As described above, the anti-IL13RA2 antibody or its antigen-binding fragment of the present invention not only specifically recognizes tumor cells expressing IL13RA2, but also, due to its property of internalizing into tumor cells expressing IL13RA2, is suitable for use in drug delivery systems (DDS) for delivering anticancer agents into tumor cells. Specifically, the anti-IL13RA2 antibody or its antigen-binding fragment of the present invention can be used in antibody-drug conjugates (ADCs). Thus, in one embodiment, the present invention relates to antibody-drug conjugates (ADCs) containing an anti-IL13RA2 antibody or its antigen-binding fragment.

[0244] Suitable methods for producing antibodies are known in the art. For example, the standard hybridoma method is described, for instance, in Harlow and Lane (eds.), Antibodies: A Laboratory Manual, CSP Press, (1988), and CA. Janeway et al. (eds.), Immunobiology, 5th edition, Garland Publishing, New York, NY (2001).

[0245] The monoclonal antibodies used in this invention may also be modulated using any technique that produces antibody molecules from continuous cell lines provided by culture. Among these are, but are not limited to, the hybridoma method originally described by Koehler and Milstein (Nature, 256: 495-497, 1975), the human B-cell hybridoma method (Kosbor et al., Immunol. Today, 4: 72, 1983; Cote et al., Proc. Natl. Acad. Sci. 80: 2026-2030, 1983) and the EBV-hybridoma method (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R Liss Inc., New York, NY, pp. 77-96, (1985).

[0246] In short, polyclonal antibodies can be prepared by immunizing animals with a desired immunogen (e.g., a recombinant human IL13RA2 polypeptide (e.g., a polypeptide having the amino acid sequence shown in SEQ ID NO: 17 or a portion thereof (e.g., excluding the signal peptide)); a membrane fraction of cells expressing human IL13RA2 (e.g., A375 cells); etc.) and collecting antiserum from the immunized animals. A wide range of animal species can be used in the production of the antiserum. In one embodiment, the animals used in the production of the anti-IL13RA2 antiserum are non-human animals including rabbits, mice, rats, hamsters, goats, sheep, camels, pigs, or horses. Rabbits are preferred for the production of polyclonal antibodies in one of the exemplary embodiments. In an example of a method for producing an immunoreactive polyclonal antiserum for selecting and generating IL13RA2 epitopes, 50 μg of IL13RA2 antigen is emulsified with Freund's complete adjuvant for rabbit immunization. For additional immunization, for example, 50 μg of the epitope can be emulsified with Freund's incomplete adjuvant at 21-day intervals. After the expected antibody production time, polyclonal antiserum can also be obtained troublelessly by collecting blood from the animal and preparing serum samples from whole blood.

[0247] In short, in the exemplary embodiment, in the generation of monoclonal antibodies, in contrast, the desired immunogen for antibody generation (e.g., a recombinant human IL13RA2 polypeptide (e.g., a polypeptide having the amino acid sequence shown in SEQ ID NO: 17 or a portion thereof (e.g., excluding the signal peptide)); membrane fractionation of mice immunized with cells expressing human IL13RA2 (e.g., A375 cells) (e.g., Freund's complete adjuvant may also be used). Cells derived from the spleen of the immunized mouse (1 × 10⁻⁶ cells) 8 Hybridomas (e.g., NS-1 cells, P3U1 cells, etc.) are fused with myeloma cells via PEG cell fusion. Hybridomas that produce the desired monoclonal antibody in the culture supernatant are screened by methods such as ELISA. For example, the isotype of the monoclonal antibody produced by the hybridoma can be determined using the Isostrip system (Boehringer Mannheim, Indianapolis, Ind.). Furthermore, for myeloma cells, P3-X63 / Ag8, P3-X63-Ag8.653, NS1 / 1.Ag41, Sp210-Ag14, FO, NSO / U, MPC-11, MPC11-X45-GTG1.7, and S194 / 15×X0Bul can be used for mouse spleen cells; for rats, R210.RCY3, Y3-Ag1.2.3, IR983F, and 4B210 can be used; and U-266, GM1500-GRG2, LICR-LON-HMy2, and UC729-6 are all useful when fused with cells.

[0248] Depending on the host species, various adjuvants can be used to enhance the immune response. Examples of such adjuvants include Freund's adjuvant, minerals such as aluminum hydroxide, and surfactants such as lysophosphatidylcholine, Pluronic (registered trademark) polyols, polyanionic surfactants, peptides, oily emulsions, hemocyanin from *Cypripedium spp.*, and dinitrophenol, but are not limited to these. BCG (Bacillus Calmette-Guérin) and *Corynebacterium parvum* are potential useful human adjuvants.

[0249] Alternatively, other methods known in the prior art may be used, such as the EBV-hybridoma method (Haskard and Archer, J. Immunol. Methods, 74(2), 361-67 (1984), and Roder et al. Methods Enzymol., 121, 140-67 (1986)) and phage vector expression lines (see, for example, Huse et al., Science, 246, 1275-81 (1989)). Furthermore, methods for generating antibodies using non-human animals may be employed, for example, as described in U.S. Patent Nos. 5,545,806, 5,569,825, and 5,714,352, and U.S. Patent Application Publication No. 2002 / 0197266A1.

[0250] Antibodies can also be produced in vivo by inducing production with lymphocyte groups, or by screening libraries or groups of highly specific recombinant immunoglobulins disclosed by Orlandi et al. (Proc. Natl. Acad. Sci. 86: 3833-3837; 1989) and Winter and Milstein (Nature, 349: 293-299, 1991).

[0251] Furthermore, antibodies disclosed herein can be generated using phage display. In this regard, standard molecular biology and recombinant DNA techniques can be used (see, for example, Sambrook et al., eds., Molecular Cloning, A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, New York (2001)) to generate a phage library encoding antigen-binding variable (V) domains for antibodies. Phages encoding variable regions with desired specificity are selected for specific binding to desired antigens, and then reconstituted into complete or partial antibodies containing the selected variable domains. Antibodies exhibiting the characteristics of monoclonal antibodies are secreted by the cells by introducing the nucleic acid sequence encoding the reconstituted antibody into a suitable cell line, such as myeloma cells used in hybridoma production (e.g., Janeway et al., above; Huse et al., above; and U.S. Patent No. 6,265,150). Related methods are also described in U.S. Patent Nos. 5,403,484, 5,571,698, 5,837,500, and 5,702,892. Techniques described in U.S. Patent Nos. 5,780,279, 5,821,047, 5,824,520, 5,855,885, 5,858,657, 5,871,907, 5,969,108, 6,057,098, and 6,225,447 are also considered useful for the modulation of the antibodies involved in this disclosure.

[0252] Antibodies can be produced by transgenic mice with genes introduced for specific heavy and light chain immunoglobulin genes. Such methods are known in the art, for example, as described in U.S. Patent Nos. 5,545,806 and 5,569,825, and Janeway et al., as described above.

[0253] Methods for generating humanized antibodies are well known in the prior art, for example, as detailed in Janeway et al. above, U.S. Patent Nos. 5,225,539, 5,585,089, 5,693,761, European Patent No. 0239400B1, and British Patent No. 2,188,638. Humanized antibodies can also be generated using the antibody resurfacing method described in U.S. Patent Nos. 5,639,641 and Pedersen et al., J. Mol. Biol., 235:959-973 (1994).

[0254] Techniques developed for the production of "chimeric antibodies" can utilize splicing of mouse antibody genes into human antibody genes to obtain molecules with appropriate antigen specificity and biological activity (Morrison et al., Proc. Natl. Acad. Sci. 81: 6851-6855, 1984; Neuberger et al., Nature, 312: 604-608, 1984; and Takeda et al., Nature, 314: 452-454; 1985). Alternatively, the described techniques for producing single-chain antibodies (US Patent No. 4,946,778) can be applied to produce single-chain antibodies specific to IL13RA2.

[0255] Methods for producing “humanized antibodies” are well known in the art (see U.S. Patent Nos. 5,585,089 and 5,693,762). Generally, humanized antibodies have one or more amino acid residues introduced from a non-human source into the CDR region and / or its framework region. Humanization can be carried out by using, for example, at least a portion of the complementarity-determining region (CDR) of rodents instead of the corresponding region of a human antibody, as described in Jones et al. (Nature, 321: 522-525, 1986), Riechmann et al. (Nature, 332: 323-327, 1988), and Vepeeyen et al. (Science, 239: 1534-1536, 1988). Most techniques for modulating antibodies are described, for example, in Owens and Young, J. Immunol. Meth., 168: 149-165 (1994). Next, further modifications can be introduced into the antibody framework to modulate affinity or immunogenicity.

[0256] The frame region (FR) of the mouse antibody was humanized by replacing suitable human frame regions selected from a large database of variable sequences of human antibodies containing over 1200 human VH sequences and over 1000 VL sequences. The database of antibody sequences used for comparison was downloaded from Andrew C.R. Martin's KabatMan webpage (http: / / www.rubic.rdg.ac.uk / abs / ). The Kabat method for determining the CDR provides a general CDR and frame region for tandem human antibodies, and for similarity, a means of determining the CDR and FR by comparing the mouse antibody sequence. The most consistent human VH and VL sequences were selected based on high overall frame consistency, similar CDR length, and minimal inconsistency of standard residues and VH / VL contact residues. The human frame region most similar to the mouse sequence was inserted between the mouse CDRs. Alternatively, the mouse frame region could be modified by making all or part of the amino acid substitutions of a native frame region that is even more closely similar to the frame region of the human antibody.

[0257] "Conservative" amino acid substitution is based on similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphiphilicity of the relevant residues. For example, nonpolar (hydrophobic) amino acids include alanine (Ala, A), leucine (Leu, L), isoleucine (Ile, I), valine (Val, V), proline (Pro, P), phenylalanine (Phe, F), tryptophan (Trp, W), and methionine (Met, M); polar neutral amino acids include glycine (Gly, G), serine (Ser, S), threonine (Thr, T), cysteine ​​(Cys, C), tyrosine (Tyr, Y), asparagine (Asn, N), and glutamine (Gln, Q); positively charged (basic) amino acids include arginine (Arg, R), lysine (Lys, K), and histidine (His, H); and charged (acidic) amino acids include aspartic acid (Asp, D) and glutamic acid (Glu, E). The number of "substitutions," "insertions," or "deletions" is preferably in the range of 1 to 25, 1 to 20, 1 to 15, 1 to 10, or 1 to 5. Amino acid substitutions can also be systematically performed using a polypeptide molecule via recombinant DNA methods, and variations can be introduced by measuring the activity of the resulting recombinant variants. Nucleic acid alterations can be performed at different sites (variable positions) or in highly conserved regions (constant regions) compared to nucleic acids from different species.

[0258] The anti-IL13RA2 antibody and its antigen-binding fragment of the present invention exhibit high affinity for IL13RA2. The antibody and its antigen-binding fragment are demonstrated to be suitable for targeting tumor cells expressing IL13RA2 in vivo by recognizing antigens expressed on the cell surface of cells expressing IL13RA2. Due to the specific recognition of tumor cells expressing IL13RA2, the side effects of damaging normal cells can be reduced. The anti-IL13RA2 antibody and its antigen-binding fragment are also expected to be effective and cost-efficient in imaging diagnosis of tumors overexpressing various types of IL13RA2, delivery of antibody-radioactive nuclear conjugates, bioassays for the detection of IL13RA2, and as carriers for therapeutic agents. In addition to the aforementioned affinity for IL13RA2, the anti-IL13RA2 antibody and its antigen-binding fragment of the present invention possess the property of internalization into tumor cells expressing IL13RA2, enabling reliable delivery of therapeutic agents to target tumor cells. Therefore, the anti-IL13RA2 antibody and its antigen-binding fragment of the present invention can be effectively utilized as a drug delivery system (DDS), for example, in the form of an ADC. This is because the reliable delivery of the therapeutic agent to the target tumor cells is expected to improve therapeutic efficacy.

[0259] In one embodiment, the present invention relates to cells that produce anti-IL13RA2 antibodies or antigen-binding fragments thereof. In one embodiment, said cells are hybridoma cells deposited internationally on July 4, 2022, by the Patent and Microbial Collection Center of the Biotechnology Center, Japan Product Evaluation Technology Base (NPMD) (address: Room 122, 2-5-8 Kamisamaashi, Kisarazu City, Chiba Prefecture, Japan) under accession number NITE BP-03673. Alternatively, in another embodiment, the present invention relates to cells that produce anti-IL13RA2 antibodies or antigen-binding fragments thereof, or cells containing nucleic acids thereof, that encode or contain nucleic acids of anti-IL13RA2 antibodies or antigen-binding fragments thereof.

[0260] In one embodiment, the present invention relates to a method for manufacturing the aforementioned anti-IL13RA2 antibody or its antigen-binding fragment. Preferably, the aforementioned cells are used in the manufacturing method.

[0261] In one embodiment, the present invention relates to a pharmaceutical composition comprising the aforementioned anti-IL13RA2 antibody or its antigen-binding fragment. In one embodiment, the pharmaceutical composition comprises an antibody-drug complex (ADC) comprising an anti-IL13RA2 antibody or its antigen-binding fragment. That is, the anti-IL13RA2 antibody or its antigen-binding fragment is contained in the pharmaceutical composition in the form of an antibody-drug complex (ADC). As an antibody-drug complex (ADC), it is not particularly limited to substances that can bind to the anti-IL13RA2 antibody or its antigen-binding fragment; examples include drugs that can exert the desired therapeutic effect (e.g., anticancer agents (e.g., low molecular weight compounds, proteins, etc.)), compounds containing radioactive isotopes, or liposomes, etc., which can also be used as ADCs.

[0262] Preferably, the pharmaceutical composition is a therapeutic composition for tumors expressing IL13RA2. The tumor is selected from melanoma, osteosarcoma, leukemia, lymphoma, prostate cancer, lung cancer (including malignant mesothelioma), glioma, head and neck cancer, renal cancer, Kaposi's sarcoma, colorectal cancer, pancreatic cancer, adrenal cancer, breast cancer, and ovarian cancer.

[0263] The pharmaceutical compositions containing anti-IL13RA2 antibody or its antigen-binding fragments described in this embodiment may be applicable to pharmaceutical compositions containing antibodies, including those with known ingredients, formulations, and administration methods in the art, or they may be applicable to pharmaceutical compositions containing herpes simplex virus as described in this specification.

[0264]

Example

[0265] The invention will now be further described in detail with reference to the embodiments. However, the invention is not limited thereto.

[0266] <Example 1>

[0267] 【1. Materials and Methods】

[0268] 【1-1. Cell】

[0269] Human malignant melanoma cell lines A2058 (ATCC CRL-11147) and A375 (ATCC CRL-1619), as well as PLAT-A cells (provided by Toshio Kitamura, University of Tokyo), were cultured in 10% FBS (Thermo Fisher Scientific, MA, USA) supplemented with Dulbecco modified Eagle medium (DMEM, Thermo Fisher Scientific). Monkey kidney cell line Vero (ATCC CCL-81) and gD-supplemented Vero cell subline VD60 (Ligaset al., J Virol. 1988 May; 62(5): 1486-94.) (provided by David Johnson, Oregon Health and Science University) were cultured in 5% FBS supplemented with DMEM. Vero cells expressing human IL13RA2 modulated by pMXc-puro-hIL13RA2 were infected with a retroviral vector into PLAT-A cells via transfection with a substrain of human IL13RA2 (Vero-IL13RA2). The cells were selected using DMEM supplemented with 5% FBS and 4 μg / mL puromycin (Thermo Fisher Scientific). pMXc-puro-hIL13RA2 was created by inserting a human IL13RA2 ORF into the multiple cloning site of pMXc-puro (provided by Toshio Kitamura, University of Tokyo). Human malignant glioma cell line U87 (ATCC HTB-14) and its substrain, as well as human malignant melanoma cell line RPMI7951 (ATCC HTB-66), were cultured in Eagle Minimum Essential Medium (E-MEM; FUJIFILM Wako PureChemical Corporation, Osaka, Japan) supplemented with 10% FBS. U87 cells were separated into U87(+) and U87(-) cells by using a cell sorter (BD Biosciences, NJ, USA) to separate cells bound to the anti-IL13RA2 antibody SHM38 (BioLegend, CA, USA) and cells not bound to it. Mouse myeloma cell line P3U1 (ATCC CRL-1597) and human non-small cell lung cancer cell line H1299 (ATCC CRL-5803) were cultured in 10% FBS supplemented with Roswell Park Memorial Institute 1640 medium (RPMI 1640, Thermo Fisher Scientific).H1299(+) and H1299(-) cells were established from H1299 cells using the same method as U87(+) and U87(-) cells. Human umbilical vein endothelial cells (HUVECs) (PromoCell, Heidelberg, Germany) were cultured using Endothelial Cell Growth Medium 2 (PromoCell) or KBM VEC-1 (KOHJIN BIO, Saitama, Japan). CHO-K1, CHO-HVEM, CHO-conjugating-1, J1.1-2, J-HVEM, and J-conjugating-1 cells were cultured using previously reported methods (Okubo et al., J Virol. 2016 Nov 28; 90(24): 11096-11105.). J-13R2 cells were established by selecting J1.1-2 cells transfected with pcDNA3.1-puro-hIL13RA2 in DMEM medium supplemented with 10% FBS and 16 μg / mL puromycin, and then separating high-expression IL13RA2 groups using FACSAria. pcDNA3.1-puro-hIL13RA2 was created by inserting the multiple cloning site of pcDNA3.1-puro (Thermo Fisher Scientific) into the ORF of human IL13RA2 by replacing the G418 resistance gene of pcDNA3.1 with the puromycin resistance gene. CHO-13R2 cells were established by selecting CHO-K1 cells transfected with pCAcc-puro-hIL13RA2 in F-12K medium (Thermo Fisher Scientific) supplemented with 10% FBS and 4 μg / mL puromycin, and then separating high-expression IL13RA2 groups using FACSAria. J-13R1 / 4R cells and CHO-13R1 / 4R cells were selected by co-transfecting J1.1-2 cells with pCAcc-puro-hIL13RA1 and pCAcc-puro-hIL4R and by culturing CHO-K1 cells with J-13R2 and CHO-13R2 cells in the same manner. The cells were then separated using FACSAria to form a group that highly expressed IL13RA1 and IL4R.pCAcc-puro-hIL13RA2, pCAcc-puro-hIL13RA1, and pCAcc-puro-hIL4R were created by inserting human IL13RA2, human IL13RA1, and human IL4R into the multiple cloning site of pCAcc-puro, which is made by inserting the expression cassette of the phomycin resistance gene into pCAcc (Yoshida et al., Biochem Biophys Res Commun. 230, 426-430 (1997)).

[0270] [1-2. Preparation of hybridomas producing anti-IL13RA2 antibodies]

[0271] A375 cells were recovered using 2 mM EDTA, washed with PBS(-), and then prepared into 5 × 10⁵ cells using a hypotonic buffer (20 mM Tris-HCl, 50 mM NaCl, 2 mM EDTA). 7 Cell suspensions of 1000 cells / mL were prepared. Cells were lysed on ice using a Dounce homogenizer, centrifuged at 1,000×g for 10 minutes at 4°C, and the supernatant was collected. The collected supernatant was centrifuged at 80,000×g for 1 hour at 4°C, and the supernatant was removed. The supernatant was then resuspended in RPMI 1640 to prepare a cell membrane fraction. This was administered subcutaneously to female BALB / c mice (Tokyo Laboratory Animals, Tokyo, Japan) six times, along with 12 μg of AbISCO-100 (Funagoshi, Tokyo, Japan). 7A cell membrane fractionation solution was prepared for each cell. Three days after final administration, mice were euthanized, and the spleen was removed. Spleen cells and P3U1 cells were mixed and fused using polyethylene glycol (PEG1500, Roche, Basel, Switzerland). The resulting hybridomas were cultured for 6 days in 10% Super Low IgG-FBS (Thermo Fisher Scientific), 1×HATMedia Supplement Hybri-Max (Sigma, MO, USA), 5% Briclone (NICB, Dublin, Ireland), and 128 μM 2-mercaptoethanol (NACALAI TESQUE, Kyoto, Japan) supplemented with RPMI 1640 medium, followed by medium replacement. Two days after the culture medium was replaced, the culture supernatant was added to a 96-well plate along with an equal volume of 4 μg / mL antibody-conjugated diphtheria toxin (DT3C) (Yamaguchi, et al., Biochem Biophys Res Commun. 2014 Nov 28; 454(4): 600-3.) and incubated at room temperature for 30 minutes. An equal volume of A375 cell suspension was added to the culture supernatant-DT3C mixture, and the morphology was observed after three days of culture. Cells from wells containing culture supernatant with high cellular damage were subjected to three limiting dilutions and monoclonalized. The antibody (4E6 antibody) produced from these hybridoma cells was purified, and the subclass was confirmed to be IgG1 and κ using IsoStrip (Roche). Furthermore, the hybridoma cells that produced the 4E6 antibody were internationally deposited on July 4, 2022, at the Patent and Microbial Collection Center of the Technical Base for Product Evaluation of Japan (NPMD) (address: 2-5-8 122, Kazusa-Kamazu, Kisarazu City, Chiba Prefecture, Japan) under accession number NITE BP-03673.

[0272] [1-3. Construction of anti-IL13RA2 single-chain antibody]

[0273] RNA extracted from hybridomas that produce 4E6 antibodies was used as a template in the RNeasy Mini Kit (QIAGEN, CA, USA). The light and heavy chains of the antibody gene were amplified by RT-PCR using the SuperScriptIII One-step RT-PCR System with Platinum Taq High Fidelity DNA polymerase (Thermo Fisher Scientific). Primers 5′-GGAAGATCTG AYATTGTGMT SACMCARWCT MCA-3′ (SEQ ID NO: 18) and 5′-CCGAATTCGG ATACAGTTGG TGCAGCATC-3′ (SEQ ID NO: 19) were used for amplification of the light chain, while primers 5′-GGAAGATCTS ARGTNMAGCT GSAGSAGTC-3′ (SEQ ID NO: 20), 5′-GGAAGATCTSARGTNMAGCT GSAGSAGTCW GG-3′ (SEQ ID NO: 21), and 5′-CCGAATTCAT AGACAGATGGGGGTGTCGTT TTGGC-3′ (SEQ ID NO: 22) (Wang et al., J Immunol Methods 233 2000. 167-177). The fragment obtained by RT-PCR was cloned into the pTAC-2 vector (Biokinetics Institute, Tokyo, Japan), and the sequences of the light and heavy chains were determined by sequence analysis. The determined sequences were then ligated with a spacer sequence containing (Gly4Ser)3 (adapter sequence) to construct an scFv. Furthermore, in the primer sequences described above, Y represents T or C, M represents A or C, S represents G or C, R represents G or A, W represents A or T, and N represents A, G, C, or T.

[0274] [1-4. HSV-BAC Recombination]

[0275] All HSV-BAC constructs used in this study were derived from KOS-37BAC (provided by David Leib of Dartmouth Medical School) (Gierasch et al., J Virol Methods. 2006 Aug; 135(2): 197-206). All recombination operations were performed using the Red homologous recombination system (Tischer et al., Biotechniques. 2006 Feb; 40(2): 191-7.). pKGN-sc13R2, pKGN-IL13, and pKGN-IL13zr were modified in the same way as previously reported methods by using PCR-modulated transfer constructs with pgD:224 / Y38C-sc13R2kan, pgD:224 / Y38C-IL13kan, and pgD:dSP-32 / V34S-IL13kan as templates to alter the production of pKGN gD (Shibata, et al., Gene Ther. 2016 23(6):479-88). pgD:224 / Y38C-sc13R2kan, pgD:224 / Y38C-IL13kan, and pgD:dSP-32 / V34S-IL13kan were prepared by inserting the same 50 bp sequence for I-SceI recognition, kanamycin resistance gene, and kanamycin resistance gene removal at the AflII site of pgD:224 / Y38C-sc13R2, pgD:224 / Y38C-IL13, and pgD:dSP-32 / V34S-IL13 using the same method as previously reported (Shibata, et al., Gene Ther. 2016 23(6): 479-88). pgD:224 / Y38C-sc13R2 was prepared by inserting amino acids from the deletion region of gD at positions 2 to 24 of pgD:224 / Y38C (Uchida, et al., Mol Ther. 2013 Mar; 21(3): 561-9.) using the same method as previously reported (Shibata, et al., Gene Ther. 2016 23(6): 479-88).pgD:224 / Y38C-IL13 was prepared by inserting a pGEM-TEasy-hIL13 template (which encodes the ORF for human IL13) into the deletion region of amino acids 2 to 24 of the gD in pgD:224 / Y38C, using primers 5′-AAGAATTCGC TAGCGGTGGT GGTGGATCCG GCCCTGTGCCTCCCTCTA-3′ (SEQ ID NO: 23) and 5′-CCGGGATCCT GAACCTCCAC CACCGTTGAA CTGTCCCTCGCGAAAAAG-3′ (SEQ ID NO: 24) to amplify a BamHI fragment of DNA. pgD:dSP-32 / V34S-IL13 was amplified by inserting the sequence of the AflII to BspEI sites on the N-terminus of gD in pgD:224 / Y38C. Using the ORF of IL13 as a template, primers 5′-CCCTTAAGGT CTCTTTTGTG TGGTGCGTTC CGGTATGGCG CTTTTGTTGACCACGGTCAT TGCTCTCACT TGCCTTGGCG GCTTTGCCTC CCCAGGCCCT GTGCCTCCCT CTAC-3' (SEQ ID NO: 25) and 5′-TTGGATCCGG TACCGTTGAA CTGTCCCTCG CGAAAAAGTT-3' (SEQ ID NO: 26) were used to amplify the AflII to BspEI sites of the DNA. Using the ORF of wild-type gD as a template, primers 5′-ATCGGATCCC GGCGCGTGTA CCACATCCAG G-3' (SEQ ID NO: 26) were used to amplify the DNA. Fragments of DNA amplified from the BamHI to BspEI sites of NO: 27 and 5′-TCCGGACGTC TTCGGAGGCCCC-3′ (SEQ ID NO: 28) were prepared. pKGN-sc13R2-BhKt was prepared by changing the anti-EGFR single-chain antibody insert gD of pKGNE-BhKt to the 4E6-derived single-chain antibody insert gD using the same method as when changing pKGN to pKGN-sc13R2.

[0276] 【1-5. Viruses】

[0277] An EGFP expression cassette was inserted between the UL3 and UL4 genes, and KGN with intracellular invasion-promoting double variants (gB: D285N / A549T) was used in a previously reported manner (Shibata, et al., Gene Ther. 2016 23(6): 479-88). KGN was then infected with... Figure 2 and Figure 3 The KGN, KGN-IL13, and KGN-IL13zr used were modulated by transfection of VD60 cells or by co-transfection of pKGN-IL13 or pKGN-IL13zr with the Cre recombinase expression plasmid pxCANCre (provided by Izumu Saito, University of Tokyo). These viruses supplemented with wild-type gD were used to inactivate the extracellular virus by infecting Vero cells with acidic treatment using glycine buffer at pH 3.0. The virus was then purified using the same method as previously reported to remove the wild-type gD virus derived from VD60 (Uchida, et al., J Virol. 2009 Apr; 83(7): 2951-61). Viral genome titration (gc / mL) was performed using the previously reported qPCR assay for the gD gene (Miyagawa et al., Proc Natl Acad Sci US A. 2015 Mar 31; 112(13): E1632-41.). In addition to... Figure 2 and Figure 3 In addition, pKGN-IL13, pKGN-sc13R2, or pKGN-sc13R2-BhKt were co-transfected with pxCANCre into Vero-IL13RA2 cells using KGN-IL13, KGN-sc13R2, and KGN-sc13R2-BhKt. These viruses were monocloned twice using Vero-IL13RA2 cells. The BAC sequences of the monocloned clones were confirmed using previously reported methods (Miyagawa et al., Proc Natl Acad Sci U SA. 2015 Mar 31; 112(13): E1632-41.). The viruses were purified by propagating these monocloned viruses using Vero-IL13RA2 and KGN using the methods described above. Plaque formation titration (pfu / mL) of purified virus was determined using Vero-IL13RA2 according to a previously reported method (Uchida et al., J Virol. 2013 Feb; 87(3): 1430-42.).

[0278] [1-6. Analysis of Flow Cytometry]

[0279] Flow cytometry analysis was performed using an LSR Fortessa (BD Biosciences). The primary antibodies used were 4E6 antibody, mouse anti-IL13RA2 monoclonal antibody SHM38 (BioLegend), mouse anti-IL13RA1 monoclonal antibody GM-1E7 (Santa Cruz Biotechnology, Dallas, TX), mouse anti-IL4R monoclonal antibody G077F6 (BioLegend), and isotype-identical control antibodies MG1-45 and MOPC-173 (BioLegend). The secondary antibody used was Alexa Fluor 488-labeled goat anti-mouse IgG (H+L) polyclonal antibody (Thermo Fisher Scientific).

[0280] 【1-7. Entry assay, infectious center assay, plaque formation assay, and cell-killing assay】 The entry assay (Shibata, et al., Gene Ther. 2016 23(6): 479-88.), infectious center assay (Uchida, et al., JVirol. 2009 Apr; 83(7): 2951-61), plaque formation assay (Shibata, et al., Gene Ther. 2016 23(6): 479-88.), and cell-killing assay (Uchida, et al., Mol Ther. 2013 Mar; 21(3): 561-9.) were performed using the same methods as previously reported.

[0281] [1-8. Animal Experiments]

[0282] All animal experiments were approved by the animal experiment committees of the University of Tokyo or Tokyo University of Pharmaceutical Sciences, and were conducted in accordance with their respective institutional implementation rules and manuals. Severely immunodeficient female SCID-Beige(CB17.Cg-Prkdc) mice aged 6–8 weeks were used. scid Lyst bg -J / CrlCrlj; Charles River, Kanagawa, Japan) 1×10-10 U87(+) or H1299(+) cells were suspended subcutaneously in Hanks' balanced salt solution (Thermo Fisher Scientific) on the left abdomen. 7 Transplanted per 100 μL. The average tumor volume reached approximately 290 mm². 3(U87(+)) or approximately 150mm 3 Mice were grouped based on the average tumor volume at the (H1299(+)) time point. Viral suspension in PBS or PBS was administered intratumorally in 30 μL or intravenously via the tail vein in 200 μL. Tumor volume was calculated as (major diameter × minor diameter²) / 2 (Tomayko et al., Cancer Chemother Pharmacol. 1989; 24(3): 148-54.). Mice with tumor volumes exceeding 10% of body weight were considered tumor dead and euthanized.

[0283] 【1-9. Statistical Analysis】

[0284] Statistical analysis of plaque formation assays was performed using a two-sided Mann-Whitney U test. Statistical analysis of tumor volume was performed using a binary configuration repeated measurements dispersion analysis. A p-value less than 0.05 was considered statistically significant in all statistical analyses.

[0285] 【2. Results】

[0286] [2-1. Fabrication of HSV for inserting IL-13 into the gD platform]

[0287] Zhou and Roizman developed an RR-oHSV (R5141) that can be infected via IL13RA2 by replacing the signal peptide of gD and its 1st to 32nd amino acids with IL-13 and changing valine to serine at position 34 (Zhou and Roizman, Proc Natl Acad Sci USA 2006 Apr 4; 103(14): 5508-13.). To investigate the difference in target specificity for intracellular invasion based on the differences in gD constructs with inserted IL-13, a virus (KGN-IL13) targeting the gD platform reported by Uchida et al. of the same research group, which involves the deletion of amino acids 2nd to 24th and the mutation of tyrosine to cysteine ​​at position 38, was created as a comparison with a virus (KGN-IL13zr) with an IL-13-inserted gD variant reported by Zhou and Roizman (KGN-IL13zr). Figure 1 ).

[0288] [2-2. KGN-IL13 that enters cells via IL13RA2 has almost no intracellular invasion via HVEM or conjugin-1]

[0289] J1.1-2 cells, one of the cell lines lacking gD receptor expression, and subspecies of J1.1-2 forcibly expressing gD receptor or IL13RA2 (J-HVEM cells, J-bindin-1 cells, and J-13R2 cells), along with two IL-13 inserter HSVs (KGN-IL13 and KGN-IL13zr) and their parental strains, were infected with a non-targeted HSV (KGN) possessing the same EGFP expression cassette and an enhanced intracellular invasion variant (gB:NT variant). The presence or absence of intracellular viral invasion was evaluated using the EGFP fluorescence signal 8 hours after infection. Figure 2 KGN invaded two cell types expressing the gD receptor, but not J1.1-2 or J-13R2 cells. Intracellular invasion of KGN-IL13zr was detected in J-13R2 cells at a very low rate of only 300 gc / cell. However, no intracellular invasion was detected in J-HVEM cells. On the other hand, more intracellular invasion was detected in J-bindin-1 cells than in J-13R2 cells. Our observations are inconsistent with the report by Zhou and Roizman, who confirmed that R5141, which has the same gD construct as KGN-IL13zr with an IL-13 insert, invades J-13R2 cells but almost never invades J-bindin-1 cells. This deviation is presumed to be due to the substitution of the N-terminal region of gC responsible for HSV adsorption to cells in R5141 with IL-13, similarly lacking the point of the polylysine (pK) region responsible for adsorption of gB (Zhou and Roizman, Proc Natl Acad Sci USA 2006 Apr 4; 103(14): 5508-13.). That is, the IL13RA2 selectivity of R5141 may be conferred mainly during the adsorption phase.

[0290] Compared to KGN-IL13zr, KGN-IL13 was more effective at penetrating J-13R2 cells. Furthermore, it was confirmed that KGN-IL13 not only failed to penetrate J-HVEM cells, but also showed almost undetectable penetration in J-bindin-1 cells at a rate of 300 gc / cell. Similar results were observed using CHO-K1 cells and its sublines, which are deficient in gD receptor expression. Figure 3 These results suggest that KGN-IL13 is more suitable for targeting IL13RA2 compared to KGN-IL13zr.

[0291] [2-3. KGN-IL13 also invades cells expressing IL13RA1, while KGN-sc13R2 specifically invades cells expressing only IL13RA2.]

[0292] IL-13 has a lower affinity than IL13RA2, but it also binds to IL13RA1. It has also been reported that IL13RA1 binds with a higher affinity to IL4R when forming a complex (IL13RA1 / IL4R) than IL13RA1 alone. Therefore, this study investigated whether IL13RA1 / IL4R functions as a receptor for KGN-IL13. As a control virus, KGN-sc13R2 was prepared by inserting a single-chain anti-IL13RA2 antibody (sc13R2) that the research group independently prepared using the method described below into the same gD-targeting platform as KGN-IL13.

[0293] First, a hybridoma cell bank was constructed by fusing spleen cells extracted from mice immunized with cell membrane fractions of the A375 malignant melanoma cell line known to express IL13RA2 with the mouse myeloma cell line P3U1. Hybridoma cells producing antibodies that showed high cytotoxicity against A375 cells were screened from the hybridoma cell bank using antibodies conjugated with altered diphtheria toxin (DT3C) as reported by Yamaguchi et al. (Yamaguchi, et al., Biochem Biophys ResCommun. 2014 Nov 28; 454(4): 600-3.), and then monocloned. Protein extracts were prepared from A375 cells, and immunoprecipitation was performed using the antibody produced by this clone (4E6 antibody). Mass spectrometry analysis of the precipitate revealed the presence of peptide fragments believed to be derived from IL13RA2. Based on the results, when the 4E6 antibody was introduced into CHO-K1 cells and the binding of the IL13RA2 substrain (CHO-13R2) to CHO-K1 cells was confirmed by flow analysis, the 4E6 antibody did not bind to CHO-K1 cells but bound to CHO-13R2 cells. From these results, the antigen of the 4E6 antibody was determined to be IL13RA2. KGN-sc13R2 was constructed by integrating a gD variant with a sequence derived from its scFv into the gD platform from the hybridoma clone antibody gene that produced the 4E6 antibody. In addition... Figure 2 In addition to the J-13R2, J-HVEM, and J-bindin-1 cells used, an entry assay was performed in J1.1-2 cells using a substrain (J-13R1 / 4R) that forcibly expresses IL13RA1 / IL4R. The intracellular invasion specificity of KGN-sc13R2 was compared with that of KGN-IL13. Figure 4Both KGN-IL13 and KGN-sc13R2 invaded J-13R2 cells. Of these two viruses, only KGN-IL13 was confirmed to invade J-13R1 / 4R cells. Furthermore, at MOI 10, KGN-IL13 invaded J-bindin-1 cells in extremely small amounts, while KGN-sc13R2 did not invade at all. Neither of these two viruses invaded J-HVEM cells. Similar results were observed in entry assays using CHO-K1 cells and its substrains. Figure 5 These results suggest that KGN-IL13 utilizes not only IL13RA2, but also IL13RA1 / IL4R as receptors for intracellular invasion, while KGN-sc13R2 utilizes only IL13RA2 as a receptor for intracellular invasion.

[0294] [2-4. KGN-IL13 kills vascular endothelial cells, while KGN-sc13R2 does not show cytotoxicity]

[0295] Vascular endothelial cells are considered to be among the normal cells exposed to the virus immediately after intravenous administration of oHSV. Therefore, this study compared the infectivity of KGN-IL13 and KGN-sc13R2 in vascular endothelial cells. First, flow analysis was used to investigate the expression of IL-13 receptor and IL4R in human umbilical vein endothelial cells (HUVECs). The results showed that anti-IL13RA1 and anti-IL4R antibodies bound to HUVECs, while anti-IL13RA2 antibody did not bind to HUVECs. Figure 6 (a)). The results indicate that IL13RA1 and IL4R are expressed in HUVECs, while IL13RA2 is not expressed.

[0296] KGN-IL13 was used to investigate the invasion of HUVECs and to determine whether it caused cell damage, both entry and cell killing assays were performed. Figure 6 (b) and Figure 6 As shown in (c), among the three viruses used in the study, KGN invaded HUVECs with the highest efficiency, demonstrating significant cellular damage. Figure 6 (b) Figure 6(c) KGN-IL13 invaded HUVECs under relatively high MOI plus viral conditions and also showed cellular damage. KGN-sc13R2, under maximum MOI plus viral conditions in its respective experiments, did not invade HUVECs and did not show cellular damage. On the other hand, for Vero-IL13RA2 cells used as a positive control, KGN-sc13R2 invaded intracellularly with the same efficiency as KGN-IL13, showing the same or greater cellular damage. These results suggest that systemic administration of KGN-IL13 can kill vascular endothelial cells, while the likelihood for KGN-sc13R2 is low.

[0297] Based on the above results, it is deemed appropriate to insert an anti-IL13RA2 single-chain antibody into our gD platform as a gD construct for developing IL13RA2 targeting RR-oHSV with higher target specificity.

[0298] 2-5. KGN-sc13R2 only targets the invasion and spread of cells expressing IL13RA2.

[0299] To evaluate the infectivity of human cancer cells against the anti-IL13RA2 single-chain antibody-inserted RR-oHSV, the expression of IL13RA2 in several human cancer cell lines was confirmed by flow analysis using a commercially available anti-IL13RA2 antibody (SHM38 antibody). Among the cell lines investigated, the malignant glioma cell line U87 and the non-small cell lung cancer cell line H1299 consisted of two groups: those expressing IL13RA2 on the cell surface and those not expressing it. Figure 7 To individually investigate the infectivity of anti-IL13RA2 single-chain antibody-inserted RR-oHSV for each cell line, the IL13RA2-high expression and non-expression groups were separately screened using a pool using the SHM38 antibody. The high expression groups were designated U87(+) or H1299(+), and the non-expression groups were designated U87(-) or H1299(-). Flow analysis was used to investigate the binding affinity of these cell lines, as well as the malignant melanoma cell line RPMI7951, to the 4E6 antibody against A2058. Figure 8 (a)). The results showed that the 4E6 antibody bound to U87(+), H1299(+), and RPMI7951 cells, but not to U87(-), H1299(-), and A2058 cells. The confirmation that the 4E6 antibody only binds to IL13RA2-positive cell clusters selected by the SHM38 antibody suggests that the 4E6 antibody has high antigen specificity.

[0300] Recently, we developed a virus (RRsyn-oHSV) that integrates syncytial variants that induce multinucleated giant cell formation in infected cells into two different glycoproteins, gB and gK, of RR-oHSV (Okubo et al., JVirol. 2016 Nov 28; 90(24): 11096-11105.). Since these syncytial variants (gB: R858H / gK: A40T, BhKt) do not impair the target specificity of EGFR targeting RR-oHSV while enhancing its intercellular transmission efficiency and cell damage, they are considered to maintain the safety of RR-oHSV while enhancing its efficacy. Therefore, we prepared KGN-sc13R2-BhKt, which introduces BhKt into KGN-sc13R2, and compared it with KGN-sc13R2 to explore its target specificity and infection efficiency.

[0301] First, to investigate the target specificity of intracellular invasion of cancer cells, an entry assay was performed on IL13RA2-positive or negative human cancer cell lines. Figure 8 (b)). As a control, KGN invaded all cells, while KGN-sc13R2 and KGN-sc13R2-BhKt only invaded IL13RA2-positive cancer cell lines. Next, to evaluate the specificity of intercellular transmission, an infection center assay was performed. Figure 8 (c) KGN formed plaques in all cell lines, while KGN-sc13R2 and KGN-sc13R2-BhKt only formed plaques in IL13RA2-positive cells. Furthermore, the plaques formed by KGN-sc13R2-BhKt in these cell lines exhibited a multinucleated giant cell morphology. These results suggest that the anti-IL13RA2 single-chain antibody inserter RR-oHSV, regardless of the presence or absence of BhKt, possesses high target specificity in intracellular invasion and intercellular transmission.

[0302] 2-6. Cellular dissemination and cytotoxicity of anti-IL13RA2 single-chain antibody-inserted RR-oHSV in cancer cells increased by BhKt introduction. To investigate the effectiveness of anti-IL13RA2 single-chain antibody-inserted RR-oHSV in vitro, plaque areas in IL13RA2-positive cancer cell lines were compared. Results indicated that the plaque area in any IL13RA2-positive cancer cell line was significantly larger than that of KGN-sc13R2-BhKt (approximately 7-fold in U87(+) cells, approximately 50-fold in H1299(+) cells, and approximately 9-fold in RPMI7951 cells), and KGN-sc13R2-BhKt was more effective at dissemination than KGN-sc13R2. Figure 9(a)). When using a cell killing assay to investigate the cell damage effect on IL13RA2-positive cancer cell lines, it was noted that KGN-sc13R2-BhKt showed a lower ED50 than KGN-sc13R2 in all cell lines. 50 The cell-damaging energy of KGN-sc13R2-BhKt is higher than that of KGN-sc13R2 (approximately 1 / 4 in U87(+) cells, approximately 1 / 200 in H1299(+) cells, and approximately 1 / 10 in RPMI7951 cells). Figure 9 (b)).

[0303] Based on the above findings, since the introduction of BhKt does not impair the target specificity of RR-oHSV and can enhance the intercellular transmission and cytotoxicity of KGN-sc13R2, KGN-sc13R2-BhKt is considered to be the virus with the highest safety and efficacy among the IL13RA2-targeted RR-oHSV explored in this study.

[0304] 2-7. KGN-sc13R2-BhKt exerts a strong anti-tumor effect on IL13RA2-positive tumors in vivo.

[0305] To investigate whether KGN-sc13R2-BhKt exerts a potent antitumor effect in vivo, this study evaluated its antitumor efficacy against a subcutaneous tumor model derived from U87 cells, commonly used in pre-clinical trials of tumor-lysing HSV. Nine days after subcutaneous transplantation of U87(+) cells into severely immunodeficient SCID-Beige mice, a single intratumoral administration of 10 mg / L of KGN-sc13R2-BhKt was performed. 2 pfu KGN-sc13R2-BhKt( Figure 10 (a) Tumor enlargement was observed in all individuals in the PBS administration group, while complete tumor regression was observed in all individuals in the KGN-sc13R2-BhKt administration group 17 days after viral administration (p < 0.0001). From the results, KGN-sc13R2-BhKt was 10 2 PFU, even when administered in extremely small amounts, is known to exert an extremely powerful anti-tumor effect.

[0306] To investigate whether a high antitumor effect could be confirmed in a subcutaneous tumor model using a cell line different from U87(+) cells, a single intratumoral administration of 10 mg of H1299(+) cells was performed 9 days after subcutaneous transplantation of H1299(+) cells into SCID-Beige mice. 2 Or 10 4 pfu KGN-sc13R2-BhKt( Figure 10 (b)). In this model, 10 individuals had completely regressed tumors. 4In the PFU administration group, only one animal showed a dose-dependent antitumor effect dependent on KGN-sc13R2-BhKt, with a value of 10. 2 Even with extremely small amounts of PFU, significant antitumor effects were confirmed (p < 0.0001). These results suggest that, although the degree of effect varies depending on the type of cancer cell, KGN-sc13R2-BhKt may exert a strong antitumor effect against a wide variety of cancers even with extremely small amounts of virus.

[0307] The above observations refer to the fact that infection with KGN-sc13R2-BhKt, which occurs in a very small subset of cancer cells within a tumor, can spread to the entire tumor. Therefore, considering the possibility that this virus can exert a potent anti-tumor effect even when administered intravenously, this study will explore its potential. Figure 10 (c)). For the above-mentioned U87(+) cell subcutaneous tumor model, a single intravenous administration of 10 6 When KGN-sc13R2-BhKt was administered via pfu, tumors completely shrank in all individuals within 17 days (p < 0.0001). These results indicate that KGN-sc13R2-BhKt exerts a potent antitumor effect even when administered intravenously.

[0308] The results above suggest that KGN-sc13R2-BhKt has high target specificity for IL13RA2 and could be a potent anti-tumor drug for cancer treatment.

[0309] 3. Inspection

[0310] This study revealed that, when comparing gD platforms used to insert IL-13 as a cancer-targeting module into gD for targeting IL13RA2, the gD construct developed by Uchida et al. in our research group showed superior intracellular invasion target specificity and invasion efficiency via the target molecule compared to the gD construct previously developed by Zhou and Roizman. However, it was also found that the IL-13-intercalated gD variant also achieved intracellular invasion via IL13RA1 / IL4R, infecting normal cells expressing IL13RA1 / IL4R. On the one hand, the anti-IL13RA2 single-chain antibody-intercalated gD variant did not achieve intracellular invasion via IL13RA1 / IL4R, but only via IL13RA2. Furthermore, the BhKt mutation did not result in loss of infection specificity, but enhanced the plaque-forming and cell-damaging capabilities of KGN-sc13R2. It was learned that KGN-sc13R2-BhKt exerted an anti-tumor effect when administered intratumorally to multiple IL13RA2-positive human cancer cell lines in mouse models with cancer, and also exhibited a strong anti-tumor effect when administered intravenously.

[0311] Since KGN-IL13 invades cells expressing IL13RA1, it is known that IL13RA1 functions as a receptor for HSV when used as a cancer-targeting module for inserting IL-13 into gD cells. This suggests that multiple research groups have found that introducing amino acid variations such as E13K or E13Y into IL-13 can reduce the binding energy between IL-13 and IL13RA1 (Debinski, et al., Nat Biotechnol. 1998 May; 16(5): 449-53.; Kahlon, et al., Cancer Res. 2004 Dec 15; 64(24): 9160-6.). Therefore, creating RR-oHSVs with IL-13 containing these variations as a cancer-targeting module integrated into gD cells might evade infection of normal cells expressing IL13RA1. However, when practically applying it to cancer treatment, it is necessary to consider the possibility that the virus may acquire mutations that restore its binding energy to IL13RA1 during proliferation, resulting in the infection of normal cells expressing IL13RA1. From this perspective, anti-IL13RA2 single-chain antibodies are considered more suitable than IL-13 as a cancer-targeting module for developing RR-oHSV that specifically targets IL13RA2.

[0312] KGN-sc13R2-BhKt is 10 2 A single administration of a very small viral load of PFU exerted an antitumor effect in immunodeficient cancer-carrying mice, and no significant toxicity was confirmed. This suggests that KGN-sc13R2-BhKt could be a highly effective and safe cancer treatment agent, not only for intratumoral administration but also for intravenous administration. This characteristic is considered particularly beneficial in the treatment of cancer patients with distant metastases.

[0313] <Example 2>

[0314] A virus (KGΔN-sc13R2-BhKt) with the ICP34.5 gene deleted from KGN-sc13R2-BhKt prepared in Example 1 was also prepared. The method for preparing the virus with the ICP34.5 gene deleted from KGN-sc13R2-BhKt, which is a proviral virus, was performed with reference to the method described in International Publication No. 2020 / 090871. Specifically, since there are two copies of the ICP34.5 gene on the herpesvirus genome, the deletion of the two copies was performed in two stages, one copy each, using the method described in detail in Suzuki et al. (Mol Ther Oncolytics. 2021; 22: 265-276.). Using pKGΔN-sc13R2-BhKt as the constructed virus, it was modulated by co-transfection with pxCANCre, similar to the method described in Example 1 (refer to “1-5. Virus”). These viruses were monocloned using Vero-IL13RA2 with two limiting dilutions. The BAC sequences of the monocloned clones were confirmed using a previously reported method (Miyagawa et al., Proc Natl AcadSci US A. 2015 Mar 31; 112(13): E1632-41.). The purified viruses were prepared by propagating these viruses monocloned using Vero-IL13RA2 and purifying them using the methods described above. Plaque formation titration (pfu / mL) of the purified viruses was determined using Vero-IL13RA2 and a previously reported method (Uchida et al., J Virol. 2013 Feb; 87(3): 1430-42.).

[0315] As a proviral agent, KGN-sc13R2-BhKt and the prepared KGΔN-sc13R2-BhKt were administered to a U87-IL13RA2+ subcutaneous tumor model, and each was administered intratumorally in a single dose (10). 2 When PFU was administered, significant antitumor effects were also observed in any viral administration group. Figure 11 Furthermore, tumor regression was observed in the vast majority of individuals in the KGΔN-sc13R2-BhKt administration group. This suggests that adding ICP34.5 deletion, i.e., restricting proliferative alterations, to KGN-sc13R2-BhKt does not substantially impair its excellent antitumor efficacy.

[0316] Table 2

[0317]

[0318]

[0319]

[0320]

[0321] [Collection Number] NITE BP-03673

[0322]

Claims

1. Herpes simplex virus targeting IL13RA2, wherein anti-IL13RA2 antibodies or their antigen-binding fragments are indicated on the viral surface.

2. The herpes simplex virus of claim 1, wherein the heavy chain CDR (HCDR1, HCDR2, HCDR3) and light chain CDR (LCDR1, LCDR2, LCDR3) of the anti-IL13RA2 antibody or its antigen-binding fragment have the following amino acid sequence: (i) HCDR1: RHGIH (SEQ ID NO: 1) (ii)HCDR2: VIWAGGSTNY NSALMS (SEQ ID NO: 2) (iii)HCDR3:DHFDSFDY (SEQ ID NO: 3) (iv) LCDR1: TASSSVSSSY LH (SEQ ID NO: 4) (v)LCDR2:STSNLAS (SEQ ID NO: 5), and (vi)LCDR3: HQYHRSPLT (SEQ ID NO: 6), or These amino acid sequences contain one to several amino acid variations.

3. The herpes simplex virus of claim 1 or 2, wherein the anti-IL13RA2 antibody or its antigen-binding fragment comprises: Compared to V shown in SEQ ID NO: 8 L The amino acid sequence of the region shows more than 80% sequence identity, and Compared to V shown in SEQ ID NO: 10 H The amino acid sequences in the region show more than 80% sequence identity.

4. The herpes simplex virus according to any one of claims 1 to 3, wherein the antigen-binding fragment is Fab, Fab', F(ab')2, Fv, scFv, dsFv, bis-scFv, disodium antibody, trisodium antibody, or tetrasodium antibody.

5. The herpes simplex virus according to any one of claims 1 to 4, wherein the antigen-binding fragment is scFv.

6. The herpes simplex virus according to any one of claims 1 to 5, wherein the antigen-binding fragment contains a sequence that shows more than 90% sequence identity with respect to the sequence of SEQ ID NO: 7 (the sequence of scFv).

7. The herpes simplex virus according to any one of claims 1 to 6, wherein the anti-IL13RA2 antibody or its antigen-binding fragment is a chimeric or humanized anti-IL13RA2 antibody or its antigen-binding fragment.

8. The herpes simplex virus according to any one of claims 1 to 7, wherein the anti-IL13RA2 antibody or its antigen-binding fragment is integrated into the envelope protein.

9. The herpes simplex virus of claim 8, wherein the anti-IL13RA2 antibody or its antigen-binding fragment is integrated into envelope protein gD, envelope protein gB, envelope protein gC or envelope protein gH.

10. The herpes simplex virus of claim 8, wherein the anti-IL13RA2 antibody or its antigen-binding fragment is integrated into the envelope protein gD.

11. The herpes simplex virus according to claim 8, characterized in that, The anti-IL13RA2 antibody or its antigen-binding fragment is integrated into the envelope protein gD by the deletion of amino acids 2 to 24 of SEQ ID NO: 12, the deletion between amino acids 24 and 25 of SEQ ID NO: 12, the deletion of amino acids 6 to 38 of SEQ ID NO: 12, or the deletion of amino acids 61 to 218 of SEQ ID NO:

12.

12. The herpes simplex virus according to any one of claims 1 to 11, wherein the envelope protein gD has an amino acid variation that reduces infectivity to cells expressing Nectin-1, HVEM and / or 3-OS-HS.

13. The herpes simplex virus of claim 12, wherein the amino acid variation that reduces infectivity to cells expressing Nectin-1 is selected from one or more of the following: deletion of all amino acids from position 6 to position 38 of SEQ ID NO: 12, deletion of all amino acids from position 61 to position 218 of SEQ ID NO: 12, variation of amino acid position 3 and / or position 38 of SEQ ID NO: 12, and variation of amino acids position 222 and position 223 of SEQ ID NO:

12.

14. The herpes simplex virus of claim 13, characterized in that, The amino acid variation at position 3 of SEQ ID NO: 12 is a deletion or substitution for cysteine, the amino acid variation at position 38 is a substitution for cysteine, the amino acid variation at position 222 is a substitution for asparagine, and the amino acid variation at position 223 is a substitution for isoleucine.

15. The herpes simplex virus according to any one of claims 12 to 14, characterized in that, Among the amino acid variations of the envelope protein gD, the amino acid variations that reduce infectivity to cells expressing HVEM and / or 3-OS-HS are the deletion of all or part of amino acids 2 to 38 of SEQ ID NO: 12, the deletion of all amino acids 61 to 218 of SEQ ID NO: 12, the amino acid variation at position 27 of SEQ ID NO: 12, the amino acid variation at position 29 of SEQ ID NO: 12, and / or the amino acid variation at position 30 of SEQ ID NO:

12.

16. The herpes simplex virus of claim 15, characterized in that, The deletion of a portion of amino acids 2 to 38 of SEQ ID NO: 12 is any one of the deletion of amino acids 2 to 24, 7 to 11, 7 to 32, or 6 to 38; the amino acid variation at position 27 is a substitution with alanine, proline, or arginine; the amino acid variation at position 29 is a substitution with alanine; and the amino acid variation at position 30 is a substitution with alanine.

17. The herpes simplex virus according to any one of claims 1 to 16, wherein the envelope protein gB, envelope protein gK, UL20 protein and / or UL24 protein of the herpes simplex virus have amino acid variations that promote invasion into target cells and / or amino acid variations that promote the formation of multinucleated giant cells.

18. The herpes simplex virus of claim 17, characterized in that, The amino acid variations that promote invasion into target cells and / or promote the formation of multinucleated giant cells are the variations described in (a), (b), (c) and / or (d) below: (a) Amino acid variations at positions 285, 549, 796, 800, 813, 817, 854, 855, and 858 of SEQ ID NO: 13; insertions of amino acids between positions 816 and 817; nonsense variations at position 869 and / or at position 877. (b) Amino acid variations at positions 33, 40, 86, 99, 111, 121, 243, 304, and / or 310 of SEQ ID NO:

14. (c) Amino acid variations at position 49, positions 49, 50, and 51, position 209, positions 209, 212, and 213, and position 217 of SEQ ID NO: 15, and / or, complete deletion of the amino acid sequence represented by SEQ ID NO:

15. (d) Amino acid variations at positions 62, 63, and 64 of SEQ ID NO:

16.

19. The herpes simplex virus of claim 18, characterized in that, The amino acid variation at position 285 of SEQ ID NO: 13 is replaced with asparagine; the amino acid variation at position 549 of SEQ ID NO: 13 is replaced with threonine; the amino acid variation at position 796 of SEQ ID NO: 13 is replaced with cysteine; the amino acid variation at position 800 of SEQ ID NO: 13 is replaced with tryptophan; the amino acid variation at position 813 of SEQ ID NO: 13 is replaced with isoleucine; the amino acid variation at position 817 of SEQ ID NO: 13 is replaced with histidine or proline; the amino acid variation at position 854 of SEQ ID NO: 13 is replaced with phenylalanine; the amino acid variation at position 855 of SEQ ID NO: 13 is replaced with valine; and the amino acid variation at position 858 of SEQ ID NO: 13 is replaced with cysteine ​​or histidine. The amino acid variation at position 33 of SEQ ID NO: 14 is replaced with serine; the amino acid variation at position 40 of SEQ ID NO: 14 is replaced with valine or threonine; the amino acid variation at position 86 of SEQ ID NO: 14 is replaced with proline; the amino acid variation at position 99 of SEQ ID NO: 14 is replaced with asparagine; the amino acid variation at position 111 of SEQ ID NO: 14 is replaced with valine; the amino acid variation at position 121 of SEQ ID NO: 14 is replaced with isoleucine; the amino acid variation at position 243 of SEQ ID NO: 14 is replaced with tyrosine; the amino acid variation at position 304 of SEQ ID NO: 14 is replaced with proline; and the amino acid variation at position 310 of SEQ ID NO: 14 is replaced with leucine. The amino acid variation at position 49 of SEQ ID NO: 15 is a substitution for alanine; the amino acid variation at position 50 of SEQ ID NO: 15 is a substitution for alanine; the amino acid variation at position 51 of SEQ ID NO: 15 is a substitution for alanine; the amino acid variation at position 209 of SEQ ID NO: 15 is a substitution for alanine; the amino acid variation at position 212 of SEQ ID NO: 15 is a substitution for alanine; the amino acid variation at position 213 of SEQ ID NO: 15 is a substitution for alanine. The amino acid variation at position 62 of SEQ ID NO: 16 is a substitution for glycine, the amino acid variation at position 63 is a substitution for valine, and the amino acid variation at position 64 is a substitution for serine.

20. The herpes simplex virus according to any one of claims 1 to 19, having a restricted proliferative alteration.

21. The herpes simplex virus of claim 20, wherein the restricted proliferation alteration is a variant that inactivates the expression of functional ICP34.

5.

22. A nucleic acid encoding the herpes simplex virus as described in any one of claims 1 to 21.

23. A cell that produces the herpes simplex virus as claimed in any one of claims 1 to 21.

24. A method for manufacturing the herpes simplex virus according to any one of claims 1 to 21.

25. A pharmaceutical composition comprising the herpes simplex virus as described in any one of claims 1 to 21.

26. The pharmaceutical composition of claim 25, which is a therapeutic agent for tumors expressing IL13RA2.

27. The pharmaceutical composition of claim 26, wherein the tumor is melanoma, osteosarcoma, leukemia, lymphoma, prostate cancer, lung cancer (including malignant mesothelioma), glioma, head and neck cancer, kidney cancer, Kaposi's sarcoma, colorectal cancer, pancreatic cancer, adrenal cancer, breast cancer, or ovarian cancer.

28. Anti-IL13RA2 antibody or its antigen-binding fragment, wherein the heavy chain CDRs (HCDR1, HCDR2, HCDR3) and light chain CDRs (LCDR1, LCDR2, LCDR3) have the following amino acid sequences: (i) HCDR1: RHGIH (SEQ ID NO: 1) (ii)HCDR2: VIWAGGSTNY NSALMS (SEQ ID NO: 2) (iii)HCDR3:DHFDSFDY (SEQ ID NO: 3) (iv) LCDR1: TASSSVSSSY LH (SEQ ID NO: 4) (v)LCDR2:STSNLAS (SEQ ID NO: 5), and (vi)LCDR3: HQYHRSPLT (SEQ ID NO: 6), or These amino acid sequences contain one to several amino acid variations.

29. The anti-IL13RA2 antibody or its antigen-binding fragment according to claim 28, wherein the anti-IL13RA2 antibody or its antigen-binding fragment comprises: Compared to V shown in SEQ ID NO: 8 L The amino acid sequence of the region shows more than 80% sequence identity, and Compared to V shown in SEQ ID NO: 10 H The amino acid sequences in the region show more than 80% sequence identity.

30. The anti-IL13RA2 antibody or its antigen-binding fragment according to claim 28 or 29, wherein the antigen-binding fragment is Fab, Fab', F(ab')2, Fv, scFv, dsFv, bis-scFv, disodium antibody, trisodium antibody or tetrasodium antibody.

31. The anti-IL13RA2 antibody or its antigen-binding fragment according to any one of claims 28 to 30, wherein the antigen-binding fragment contains a sequence that shows more than 90% sequence identity with respect to the sequence of SEQ ID NO: 7 (the sequence of scFv).

32. The anti-IL13RA2 antibody or its antigen-binding fragment according to any one of claims 28 to 31, wherein the antibody is chimeric or humanized.

33. A nucleic acid encoding an anti-IL13RA2 antibody or an antigen-binding fragment thereof as described in any one of claims 28 to 32.

34. Cells that produce anti-IL13RA2 antibodies or antigen-binding fragments thereof, comprising the nucleic acid of claim 33.

35. A cell that produces the anti-IL13RA2 antibody or an antigen-binding fragment thereof as claimed in any one of claims 28 to 32.

36. Cells, deposited under accession number NITE BP-03673.

37. A method for manufacturing an anti-IL13RA2 antibody or an antigen-binding fragment thereof according to any one of claims 28 to 32, wherein the cell described in any one of claims 33 to 35 is used.

38. A pharmaceutical composition comprising the anti-IL13RA2 antibody or its antigen-binding fragment as described in any one of claims 28 to 32.

39. The pharmaceutical composition of claim 38, for treating tumors expressing IL13RA2.

40. The pharmaceutical composition of claim 39, wherein the tumor is melanoma, osteosarcoma, leukemia, lymphoma, prostate cancer, lung cancer (including malignant mesothelioma), glioma, head and neck cancer, kidney cancer, Kaposi's sarcoma, colorectal cancer, pancreatic cancer, adrenal cancer, breast cancer, or ovarian cancer.

41. The pharmaceutical composition according to any one of claims 38 to 40, wherein the anti-IL13RA2 antibody or its antigen-binding fragment is contained in the pharmaceutical composition in the form of an antibody-drug complex.

Images