Application of a reagent for overexpressing RNMT gene in promoting virus infection and recombinant LLC-PK1 cell line

Abstract

The application provides application of a reagent for overexpressing an RNMT gene in promoting virus infection and a recombinant LLC-PK1 cell line constructed by the reagent, and belongs to the technical field of genetic engineering. The application provides that an RNMT fragment is cloned into a lentivirus vector to construct a recombinant lentivirus plasmid, and then the lentivirus is packaged by virus rescue, LLC-PK1 cells are infected, and a recombinant LLC-PK1 cell line for expressing RNMT is obtained. The recombinant LLC-PK1 cell line for stably expressing RNMT can promote generation of PEDV offspring viruses, which provides a tool for studying a virus pathogenic mechanism and provides a basis for preparing a virus infection cell model subsequently.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to application of a reagent for overexpressing an RNMT gene in promoting virus infection and a recombinant LLC-PK1 cell line. BACKGROUND

[0002] RNA guanine-7 methyltransferase (RNMT), also known as mRNA 5' cap structure (guanine-N7)-methyltransferase, is a RNA binding protein (RBP). After RNA triphosphatase (TPase) removes the gamma-phosphate group, GMP group is transferred to the 5' end diphosphate site by RNA guanylyltransferase (GTase), and finally catalyzes the methylation of GpppN to form a mature cap structure (m7GpppN). The 5' cap structure of viral genomic RNA (gRNA) and subgenomic RNA (sgRNA) plays a key role in helping viruses evade immune system restrictions and promoting viral protein translation. The C-terminal of nsp14 protein of coronavirus (CoV) contains N7-methyltransferase domain (N7-MTase), which can catalyze the mRNA capping reaction; the N-terminal exonuclease domain (ExoN) is essential for N7-MTase activity. The protein interacts with nsp10 recruited by nsp9 and nsp12 to form a capping complex, which completes the addition of the cap structure at the 5' end of the precursor mRNA. It is worth noting that when rescuing coronaviruses using a reverse genetics system, the transcription of the viral genome needs to rely on host proteins to complete capping due to the lack of eukaryotic expression plasmids for non-structural proteins such as nsp9 / 10 / 12 / 14 of coronaviruses. As a key enzyme for mRNA capping in eukaryotic cells, RNMT may be involved in the formation of the cap structure of PEDV genomic RNA, affecting viral protein translation and immune regulation, but the specific process is not clear.

[0003] Porcine epidemic diarrhea virus (PEDV) is a single-stranded positive-strand enveloped RNA virus belonging to the Coronaviridae family. Its genome contains 7 open reading frames (ORFs) responsible for encoding 4 structural proteins [E], [M], [S], and [N], 2 polyproteins (pp1a and pp1ab), and 1 accessory protein (ORF3). PEDV nsp14 has N7-MTase activity, which is responsible for catalyzing the methylation reaction to form a mature cap structure. In the early stages of viral infection or certain cellular environments, PEDV may partially rely on the host's capping system. RNMT, as a host core capping enzyme, may provide compensatory function when viral nsp14 activity is insufficient, promoting the stability and translation efficiency of viral mRNA. At the same time, capped RNA is usually preferentially recognized by ribosomes, thereby enhancing the translation efficiency of viral proteins (such as spike protein S and nucleocapsid protein N), accelerating the assembly and release of virions. In summary, RNMT has certain research on promoting mRNA capping and translation, but the effect of RNMT on PEDV replication is still unclear. SUMMARY

[0004] Therefore, the purpose of the present application is to provide an application of a reagent for overexpressing RNMT gene in promoting viral infection.

[0005] Preferably, the nucleotide sequence of the RNMT gene is shown as SEQ ID NO: 1, and the amino acid sequence is shown as SEQ ID NO: 2.

[0006] Preferably, the reagent for overexpressing RNMT gene includes a recombinant lentivirus plasmid for overexpressing RNMT gene.

[0007] Preferably, the improvement of viral infectivity includes promoting the replication level of viral genes and progeny viruses.

[0008] The present application provides a recombinant cell line stably expressing RNMT, which overexpresses RNMT protein.

[0009] The present application provides a construction method of the recombinant cell line stably expressing RNMT, which includes the following steps:

[0010] 1) Constructing a recombinant lentivirus plasmid for overexpressing RNMT gene;

[0011] 2) Co-transfecting the recombinant lentivirus plasmid for overexpressing RNMT gene and the helper plasmid in step 1) into cells to rescue a recombinant lentivirus for overexpressing RNMT;

[0012] 3) Infecting LLC-PK1 cells with the rescued recombinant lentivirus to obtain a recombinant cell line stably expressing RNMT through screening.

[0013] Preferably, in step 1), the RNMT gene is amplified by a primer containing a BamH I enzyme cutting site, and the obtained amplified fragment and the lentiviral vector pLOV-CMV are cut by BamH I enzyme, the cut fragments and the linearized vector are connected, and identified to obtain a recombinant lentiviral plasmid overexpressing the RNMT gene.

[0014] The primer containing the BamH I enzyme cutting site includes a forward primer (containing a FLAG tag sequence) with a nucleotide sequence as shown in SEQ ID NO: 3 (TTCAGGTGTCGTGAGGATCCGCCACCATGGATTACAAGGATGACGACGATAAGGAAAATTCGGCAAAAGCA) and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 4 (AGCCGGCGCGGCCGCGGATCCTCACTGCTGCTTCTCAAATGC). The amplification conditions are preferably 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, and 72℃ extension for 1 min. The method of cutting and connection in the present application is not particularly limited, and the cutting and connection methods known in the art can be used.

[0015] The co-transfected cells preferably include components with a mass fraction of 4 parts of the recombinant lentiviral plasmid, 3 parts of the psPAX2 helper plasmid, and 1 part of the pMD2.G helper plasmid. The transfection reagent for co-transfecting the cells is preferably Lipofectamine 3000. The present application does not limit the type of cells, and the cells known in the art can be used. In the examples of the present application, HEK-293T cells are used as the infected cells.

[0016] The rescue of the RNMT recombinant lentivirus overexpressing is preferably screened by 3 μg / mL puromycin. After RT-qPCR detection, the RNMT mRNA level in the screened cell line is significantly increased, indicating that the RNMT overexpressing recombinant cell line is successfully constructed.

[0017] Through Western Blot analysis, the RNMT protein expression level of the recombinant LLC-PK1 cell line at the 5th and 20th generations of recombinant cell lines has no significant difference, indicating that the recombinant LLC-PK1 cell line can stably express the RNMT protein.

[0018] In the present application, the recombinant LLC-PK1 cell line stably expressing RNMT can promote PEDV gene replication and progeny virus production.

[0019] The application provides application of the recombinant LLC-PK1 cell line stably expressing RNMT or the recombinant LLC-PK1 cell line stably expressing RNMT obtained by the construction method in preparation of a virus-infected cell model.

[0020] Beneficial effects

[0021] The application provides application of a reagent overexpressing an RNMT gene in promoting virus infection. Experiments prove that an RNMT fragment is obtained by amplification through an RT-PCR technique, is cloned into a lentivirus vector to construct a recombinant lentivirus plasmid, is then packaged out of lentivirus through virus rescue, and then infects LLC-PK1 cells to obtain a recombinant LLC-PK1 cell line expressing RNMT. PEDV is used as a virus model to determine gene replication of PEDV on the recombinant LLC-PK1 cell and a level of progeny virus, and finally to evaluate the influence of the recombinant cell on the replication ability of PEDV. The results show that the recombinant LLC-PK1 cell stably expressing RNMT can promote gene replication of PEDV and generation of progeny virus. It can be seen that overexpression of the RNMT gene can promote infection of PEDV. This provides a tool for studying a virus pathogenic mechanism and provides a basis for subsequent preparation of a virus-infected cell model. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 RNMT gene amplification results;

[0023] Figure 2 RNMT recombinant lentivirus plasmid expression results in HEK-293T cells;

[0024] Figure 3 RNMT protein expression analysis results in the LLC-PK1-RNMT recombinant cell strain;

[0025] Figure 4 RNMT mRNA level detection results in the LLC-PK1-RNMT recombinant cell strain;

[0026] Figure 5 RNMT indirect immunofluorescence results in the LLC-PK1-RNMT recombinant cell strain;

[0027] Figure 6 RNMT protein expression level comparison results of the 5th and 20th generations of recombinant cell lines;

[0028] Figure 7 Western Blot test detection results of the influence of the LLC-PK1-RNMT recombinant cell on PEDV protein expression at different time points;

[0029] Figure 8The detection results of PEDV mRNA levels in the recombinant LLC-PK1 cells stably expressing RNMT at different time points;

[0030] Figure 9 The detection results of virus content on the recombinant LLC-PK1 cells stably expressing RNMT at different time points. DETAILED DESCRIPTION

[0031] The technical solutions of the present application will be described clearly and completely below in combination with the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the present application.

[0032] Example 1: A method for constructing a recombinant lentiviral plasmid overexpressing RNMT gene

[0033] Primer design and synthesis

[0034] The primers were designed according to the sequence of RNMT gene on NCBI for RT-PCR amplification of RNMT gene in LLC-PK1 cells. The upstream primer was 5'- TTCAGGTGTCGTGAGGATCCGCCACCATGGATTACAAGGATGACGACGATAAGGAAAATTCGGCAAAAGCA-3' (SEQ ID NO: 3), and the downstream primer was 5'- AGCCGGCGCGGCCGCGGATCCTCACTGCTGCTTCTCAAATGC-3' (SEQ ID NO: 4). The above primers were synthesized by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd.

[0035] The RNMT gene was amplified using the above designed and synthesized primers. The PCR reaction conditions were as follows: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; and 72℃ extension for 10 min again. The agarose gel electrophoresis result showed that the LLC-PK1 gene in LLC-PK1 cells was successfully amplified. The electrophoretogram was as shown in Figure 1 , and the size of the amplified product band was about 1437 bp. The PCR product was subjected to 1% agarose gel electrophoresis and then DNA agarose gel recovery. The recovered product was sent to Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. for sequencing.

[0036] Construction of recombinant lentiviral plasmid overexpressing RNMT

[0037] The lentiviral vector pLOV-CMV was digested by BamH I, and a 8500 bp fragment was recovered. The recovered fragment and the RNMT amplified fragment were ligated to construct a recombinant lentiviral plasmid, which was named pLOV-Flag-RNMT. The pLOV-Flag-RNMT plasmid was preliminarily identified by enzyme digestion, and the positive plasmid was sent to Shanghai SunGene Biological Engineering Technology Service Co., Ltd. for sequencing. Normal HEK-293T cells were plated in a 12-well plate, and when the cells were in good condition and the density reached 70%, the positive plasmid with correct sequencing was transfected with Lipofectamine 3000 transfection reagent. After the cells were fully grown, the expression level of RNMT in the cells was detected by Western Blot. As shown in Figure 1, the Western Blot results showed that the positive plasmid successfully expressed RNMT protein. Figure 2 A large amount of correct positive recombinant plasmid, as well as helper plasmids pMD2.G and psPAX2, were extracted and identified for future use.

[0038] Example 2: Construction method of recombinant LLC-PK1 cell line

[0039] Rescue of RNMT overexpression recombinant lentivirus

[0040] Normal HEK-293T cells were plated in a T25 cell culture flask, and when the cells were in good condition and the density reached 70%, plasmid transfection was performed using Lipofectamine 3000 transfection reagent (2.0 μg recombinant lentivirus plasmid + 1.5 μg psPAX2 helper plasmid + 0.5 μg pMD2.G helper plasmid). After 6 h, 4 ml of high-glucose DMEM complete medium was gently added to the cell culture flask, which was placed in a 37°C incubator for culture. After 72 h, the cell supernatant was collected and filtered with a 0.45 um filter. The filtered lentivirus liquid was stored at -80°C for future use.

[0041] Determination of the screening concentration of puromycin

[0042] LLC-PK1 cells were plated in a six-well plate, and when the cell density reached 90%, 1, 2, 3, 4, 5, and 6 μg / mL of puromycin were added to the cells, respectively, and the cells were re-treated with the drug every 24 h. After 7 d, the survival of the cells in the six-well plate was observed, and the lowest drug concentration without cell survival was the optimal concentration for puromycin screening. LLC-PK1 cells were treated with gradient concentrations of puromycin, and it was observed that after one week of screening with the minimum concentration of 3 μg / mL of puromycin, the cells were all dead. The optimal puromycin concentration for screening the LLC-PK1 recombinant cell line was finally determined to be 3 μg / mL.

[0043] Construction of recombinant LLC-PK1 cell line stably expressing RNMT

[0044] The lentivirus and complete cell culture medium were mixed at a ratio of 1:1 by volume to make a mixed culture medium. Normal LLC-PK1 cells were plated in a six-well plate and cultured with the mixed culture medium. After 24 h, the cells infected with the lentivirus were treated with the optimal concentration of puromycin, and the complete culture medium with puromycin was replaced every 24 h. After 7 d, the surviving LLC-PK1 cells were almost all recombinant cells carrying the recombinant lentivirus plasmid. The recombinant LLC-PK1 cells overexpressing RNMT were counted and diluted to a single cell, which was added to a 96-well plate. After the cells grew into a group, whether it was a single clone was observed under a microscope. After the cells grew, the single clone recombinant cells were expanded and cryopreserved, and the expression level of RNMT in the single clone recombinant cells was detected by Western Blot and real-time fluorescent quantitative PCR (RT-qPCR). Figure 3 The Western Blot results showed that the recombinant cell line LLC-PK1-RNMT successfully expressed RNMT protein compared with normal LLC-PK1 cells. Figure 4 The RT-qPCR results showed that the RNMT mRNA level in LLC-PK1-RNMT was significantly increased compared with normal LLC-PK1 cells. Figure 5 The indirect immunofluorescence results showed that LLC-PK1-RNMT cells all expressed RNMT protein, and the recombinant cell line LLC-PK1-RNMT had high purity. The above results showed that the recombinant LLC-PK1 cell line overexpressing RNMT was successfully established.

[0045] Example 3 Stability analysis of RNMT protein expression in recombinant LLC-PK1 cells stably expressing RNMT

[0046] To analyze the stability of RNMT protein expression in the recombinant cell line, protein samples were collected from the 5th and 20th passages of cells to detect whether the expression of RNMT protein was stable. The stability of RNMT protein expression in the LLC-PK1-RNMT recombinant cells during the passage was analyzed by Western Blot. Figure 6 There was no significant difference in the expression level of RNMT protein between the 5th and 20th passages of recombinant cell lines, indicating that RNMT protein could be stably expressed in the recombinant cell line.

[0047] Example 4 Effect of recombinant LLC-PK1 cells stably expressing RNMT on PEDV gene replication and viral protein expression

[0048] The recombinant LLC-PK1 cells were inoculated with viruses at MOI of 1 and placed in a 37 °C incubator, and cell samples were collected at 14 and 16 h, respectively. (1) Part of the cell samples were added with RNA lysis solution, and RNA was extracted and the N mRNA level of PEDV was detected by RT-qPCR method. The upstream primer for amplifying PEDV N gene in RT-qPCR was 5'-GAGGGTGTTTTCTGGGTTG-3'(SEQ ID NO: 5), and the downstream primer was 5'-CGTGAAGTAGGAGGTGTGTTAG-3'(SEQ ID NO: 6); the primers for amplifying the internal reference gene ACTIN internal reference gene were: the upstream primer was 5'-TCCCTGGAGAAGAGCTACGA-3'(SEQ ID NO: 7), and the downstream primer was 5'-AGCACTGTGTTGGCGTACAG-3'(SEQ ID NO: 8). The reverse transcription program was 37 °C for 15 min and 85 °C for 5 s. The amplification reaction program of the RT-qPCR method was pre-denaturation at 95 °C for 30 s; 95 °C for 5 s, 60 °C for 30 s, 40 cycles; 95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s. The relative mRNA copy number of PEDV N was calculated by 2 -ΔΔCT method.

[0049] The effect of LLC-PK1-RNMT recombinant cells on the expression of PEDV protein was detected by Western Blot experiment. As shown in Figure 2, for different time point samples, compared with normal LLC-PK1 cells, the PEDV protein level in the recombinant LLC-PK1 cells stably expressing RNMT was significantly increased. Figure 7 The effect of LLC-PK1-RNMT recombinant cells on the replication of PEDV gene was detected by RT-qPCR experiment. As shown in Figure 3, for different time point samples, compared with normal LLC-PK1 cells, the PEDV mRNA level in the recombinant LLC-PK1 cells stably expressing RNMT was significantly increased. Figure 8 The above results show that the recombinant LLC-PK1 cells stably expressing RNMT improve the gene replication and virus protein expression of PEDV.

[0050] Example 5 Effect of recombinant LLC-PK1 cells stably expressing RNMT on the propagation of offspring PEDV

[0051] MOI of 1 of PEDV to stably express RNMT recombinant LLC-PK1 cells and normal LLC-PK1 cells, placed in a 37°C incubator, 6, 12, 18, 24, 32 and 36 h after the sample was collected, half of the tissue cell infectious dose (TCID 50 ) test to determine the PEDV virus content in the sample. The samples of PEDV infected recombinant LLC-PK1 cells and normal LLC-PK1 cells were collected at different time, and the progeny PEDV was quantified by TCID 50 test. As Figure 9 , the virus content on the recombinant LLC-PK1 cells stably expressing RNMT was significantly higher than that on the normal LLC-PK1 cells at all time points. The above results showed that the recombinant LLC-PK1 cells stably expressing RNMT enhanced the propagation of the progeny PEDV.

[0052] From the above examples, it can be seen that the RNMT fragment is amplified by RT-PCR technology, cloned into pLOV-CMV vector to construct a recombinant lentivirus plasmid, and then the recombinant lentivirus plasmid pLOV-Flag-RNMT is transfected into HEK-293T cells with the helper plasmids pMD2.G and psPAX2 using lipofectamine transfection technology, and the lentivirus packaged by the HEK-293T cells is harvested, and then the LLC-PK1 cells are infected, and the recombinant LLC-PK1 cell line expressing RNMT is obtained after 10 days of puromycin continuous screening. The single clone recombinant LLC-PK1 cell strain stably expressing RNMT is screened by limiting dilution method. The genetic stability of RNMT protein expression in the 5th and 20th generation of recombinant LLC-PK1 cells is also detected, and it is found that the positive single clone recombinant LLC-PK1 cell selected can continuously and stably express RNMT protein, which indicates that the RNMT gene has been stably integrated into the LLC-PK1 cells, and also indicates that the target cells obtained have good genetic stability. In general, the recombinant LLC-PK1 cell line stably expressing RNMT is successfully established.

[0053] Using the established recombinant LLC-PK1 cells stably expressing RNMT, PEDV as a virus model, the gene replication of PEDV on the recombinant LLC-PK1 cells and the level of progeny virus were determined, and finally the effect of the recombinant cells on the replication ability of PEDV was evaluated. The results showed that the recombinant LLC-PK1 cells stably expressing RNMT would promote the gene replication of PEDV and the generation of progeny virus. In general, the recombinant LLC-PK1 cells stably expressing RNMT improved the replication ability of PEDV.

[0054] The foregoing description of the embodiments has been presented for the purpose of illustration and description. It is not intended to be exhaustive or to limit the application to the precise form disclosed. Many modifications and variations are possible in light of the above teaching. It is intended that the scope of the application be limited not with this detailed description, but rather by the claims appended hereto.

Claims

1. Application of recombinant LLC-PK1 cell line stably expressing RNMT in the preparation of a porcine epidemic diarrhea virus (PEDV) infection cell model, wherein the application is to improve PEDV infectivity, including promoting PEDV infection gene replication and progeny virus replication levels, and the method for constructing the recombinant LLC-PK1 cell line stably expressing RNMT includes the following steps: 1) Construct a recombinant lentiviral plasmid overexpressing the RNMT gene, wherein the nucleotide sequence of the RNMT gene is shown in SEQ ID NO:1 and the amino acid sequence is shown in SEQ ID NO:2; 2) The recombinant lentiviral plasmid overexpressing the RNMT gene described in step 1) and the helper plasmid were co-transfected into cells to rescue the recombinant lentivirus overexpressing the RNMT gene; 3) The rescued recombinant lentivirus was used to infect LLC-PK1 cells, and a recombinant LLC-PK1 cell line that stably expresses RNMT was obtained through screening; In step 1), the construction method involves amplifying the RNMT gene using primers containing the BamHI restriction site, and then combining the amplified fragment with the lentiviral vector pLOV. CMV was digested with BamHI, the digested fragments were ligated with a linearized vector, identified, and a recombinant lentiviral plasmid overexpressing the RNMT gene was obtained; the primers containing the BamHI restriction site include a forward primer with a nucleotide sequence as shown in SEQ ID NO:3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:

4. The co-transfected cells in step 2) include the following components by weight: 4 portions of recombinant lentiviral plasmid, 3 portions of psPAX2 helper plasmid, and 1 portion of pMD2.G helper plasmid; The transfection reagent used for co-transfecting cells was Lipofectamine 3000; Among them, HEK 293T cells were used as infecting cells; The rescue of the overexpressing RNMT recombinant lentivirus was screened using 3 μg / mL puromycin.

2. Application of recombinant LLC-PK1 cell line stably expressing RNMT in promoting porcine epidemic diarrhea virus infection, wherein the method for constructing the recombinant LLC-PK1 cell line stably expressing RNMT includes the following steps: 1) Construct a recombinant lentiviral plasmid overexpressing the RNMT gene, wherein the nucleotide sequence of the RNMT gene is shown in SEQ ID NO:1 and the amino acid sequence is shown in SEQ ID NO:2; 2) The recombinant lentiviral plasmid overexpressing the RNMT gene described in step 1) and the helper plasmid were co-transfected into cells to rescue the recombinant lentivirus overexpressing the RNMT gene; 3) The rescued recombinant lentivirus was used to infect LLC-PK1 cells, and a recombinant LLC-PK1 cell line that stably expresses RNMT was obtained through screening; In step 1), the construction method involves amplifying the RNMT gene using primers containing the BamHI restriction site, and then combining the amplified fragment with the lentiviral vector pLOV. CMV was digested with BamHI, the digested fragments were ligated with a linearized vector, identified, and a recombinant lentiviral plasmid overexpressing the RNMT gene was obtained; the primers containing the BamHI restriction site include a forward primer with a nucleotide sequence as shown in SEQ ID NO:3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:

4. The co-transfected cells in step 2) include the following components by weight: 4 portions of recombinant lentiviral plasmid, 3 portions of psPAX2 helper plasmid, and 1 portion of pMD2.G helper plasmid; The transfection reagent used for co-transfecting cells was Lipofectamine 3000; Among them, HEK 293T cells were used as infecting cells; The rescue of the overexpressing RNMT recombinant lentivirus was screened using 3 μg / mL puromycin.

Images