Application of DNA fragment in specific silencing of OsPT4 gene expression
By specifically silencing the OsPT4 gene in rice grains and constructing an amiRNA expression vector using the Ole18 promoter, the problem of elevated phytic acid content in rice grains was solved, achieving efficient reduction of phytic acid while maintaining a balance between yield and vegetative growth.
Patent Information
- Application Number
- CN202511084474.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-04
- Publication Date
- 2025-11-04
AI Technical Summary
Existing technologies, such as CRISPR-Cas9 or T-DNA insertion, silence phosphate transport proteins, leading to increased phosphorus and phytic acid content in rice grains. This affects yield and vegetative growth, making it difficult to meet the agricultural demand for low phytic acid and high yield.
By using a DNA fragment that specifically silences the OsPT4 gene, an amiRNA expression vector was constructed using the Ole18 promoter to inhibit OsPT4 gene expression only in rice grains, thus avoiding global interference with phosphorus metabolism in vegetative organs.
It significantly reduces the phytic acid content in rice grains while maintaining phosphorus transport capacity, avoiding negative impacts on vegetative growth and yield, and achieving a balance between phytic acid reduction and growth potential and yield.
Smart Images

Figure CN120888591A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of genetic engineering, and particularly relates to application of a DNA fragment in specific silencing of OsPT4 gene expression. BACKGROUND
[0002] Phosphorus is a core nutrient element essential for crop growth, but long-term excessive application of phosphorus fertilizer leads to imbalance of phosphorus in farmland, which on one hand leads to excessive accumulation of phosphorus in rice grains, accompanied by a significant increase in the content of anti-nutritional substance phytic acid; on the other hand, after the rice with high phosphorus and high phytic acid is used as staple food or feed, the unabsorbed phosphorus is excreted in large amounts through human and animal excrement, further aggravating the eutrophication of rivers, lakes and other water bodies.
[0003] In the prior art, the gene knockout method through CRISPR-Cas9 or T-DNA insertion, or the constitutive silencing method such as RNA interference technology using small molecule RNA to specifically bind to the RNA of the target gene, all have significant defects: traditional T-DNA insertion and other global silencing technologies will interfere with the phosphorus metabolism of organs such as roots, stems and leaves, leading to hindered development of lateral roots, reduced phosphorus accumulation in the aboveground part, and finally causing a substantial decrease in yield indicators such as effective tillering, seed setting rate and thousand-grain weight, which is difficult to meet the dual demands of "low phytic acid-high yield" in agricultural production. SUMMARY
[0004] The purpose of the present application is to provide application of a DNA fragment in specific silencing of OsPT4 gene expression, so as to reduce the content of phosphorus and phytic acid in rice grains.
[0005] The technical solution adopted by the present application is as follows: The present application provides application of a DNA fragment in specific silencing of OsPT4 gene expression, wherein the base sequence of the DNA fragment is shown as SEQ ID NO. 1.
[0006] The DNA fragment according to the present application refers to Ole18 a promoter.
[0007] Preferably, the specific silencing vector of the DNA fragment is constructed, and the specific silencing vector is transduced into rice to inhibit OsPT4 expression of the gene in rice grains.
[0008] Preferably, the preparation method of the specific silencing vector comprises the following steps: The DNA fragment is synthesized and connected to a plant expression vector to obtain a specific basic vector; amplification of a target OsPT4amiRNA targeting OsPT4 The sequence of amiRNA targeting The sequence of amiRNA targeting OsPT4 The sequence of amiRNA targeting
[0009] Preferably, the process of amplifying the amiRNA targeting OsPT4 The process of amplifying the amiRNA targeting The product 1 is amplified by using primer set 1 with pNW55 plasmid as template; the primer set 1 is SEQ ID NO. 4 and SEQ ID NO. 7; The product 2 is amplified by using primer set 2 with pNW55 plasmid as template; the primer set 2 is SEQ ID NO. 6 and SEQ ID NO. 9; The product 3 is amplified by using primer set 3 with pNW55 plasmid as template; the primer set 3 is SEQ ID NO. 5 and SEQ ID NO. 8; The amiRNA targeting OsPT4 The primer set 4 is SEQ ID NO. 4 and SEQ ID NO. 5.
[0010] Preferably, the plant expression vector is pCAMBIA1301-35SN.
[0011] Preferably, the molar ratio of the DNA fragment and the plant expression vector is 2-3:1.
[0012] The process of cloning the amiRNA targeting OsPT4 The process of cloning the amiRNA targeting The amiRNA targeting OsPT4 The process of cloning the amiRNA targeting BamH I and Kpn I and then connecting into the specific basic vector.
[0013] Preferably, the method of transducing the specific silencing vector into rice is as follows: Introducing the specific silencing vector into Agrobacterium to obtain positive recombinant Agrobacterium; Preparing the infection solution by using the positive recombinant Agrobacterium; Infecting rice with the infection solution, and the specific silencing vector can enter the rice.
[0014] Preferably, the preparation process of the infection solution is as follows: Culturing the positive recombinant Agrobacterium to OD 600The concentration is 0.5, which yields the inoculum.
[0015] Preferably, the Agrobacterium is EHA105.
[0016] Compared with the prior art, the beneficial effects of the present invention are: This invention provides a method for specific silencing of DNA fragments. OsPT4 Applications in gene expression, the DNA fragment Ole18 The promoter base sequence is shown in SEQ ID NO.1. This invention utilizes specific inhibition... OsPT4 Expression in grains significantly reduced the content of the anti-nutrient phytic acid in grains. In grains from seedlings aged 14–16 weeks, OsPT4 The total phosphorus, soluble phosphorus, inositol-3-phosphate, and phytic acid concentrations in the SKD strain were significantly lower than those in the wild type. This indicates that the present invention, through grain-specific regulation, achieves efficient reduction of phytic acid while avoiding excessive interference with overall phosphorus metabolism, thus better meeting the needs of agricultural production.
[0017] This invention also has the following advantages: Advantages of balancing growth and yield traits: The core advantage of this invention lies in the fact that the negative impact of grain-specific silencing on vegetative growth and yield is significantly less than that of constitutive loss. From the perspective of root phenotype during the vegetative growth period, ospt4-1 The lateral root length and density were significantly lower than those of WT, while OsPT4 -SKD's lateral root length is similar to ospt4-1 No difference, but lateral root density was significantly higher than ospt4-1 This indicates that its inhibition of root development is weaker. Regarding phosphorus transport capacity, after 24 hours of absorption of 32Pi, OsPT4 -The 32Pi content in SKD seeds is significantly higher than that in other seeds. ospt4-1 Furthermore, phosphorus accumulation in the aboveground parts showed a WT> OsPT4 -SKD> ospt4-1 The gradient indicates that it can still maintain a certain capacity for phosphorus translocation to the grains. From the perspective of reproductive growth and yield, under normal phosphorus supply and phosphorus deficiency conditions, OsPT4 Although SKD's effective tillering, seed setting rate, and thousand-grain weight are lower than WT, they are significantly better. ospt4-1 This indicates that its inhibition of yield is less severe. In summary, this invention achieves a balance between "phytic acid reduction, growth potential, and yield" through grain-specific regulation, solving the problem of significant yield reduction caused by traditional constitutive mutations.
[0018] This invention utilizes seed-specific silencing. OsPT4 It effectively inhibits the synthesis and accumulation of phytic acid in rice grains, significantly reduces the content of anti-nutritional substances, and reduces the excessive accumulation of phosphorus in grains, thus improving the nutritional quality of rice and making it more conducive to the digestion and absorption of phosphorus by humans and monogastric animals.
[0019] Compared to traditional constitutive deletion mutants, grain-specific silencing avoids global inhibition of phosphorus metabolism in vegetative organs such as roots, has less negative impact on vegetative growth phenotypes such as lateral root development and adventitious root number, and the plant vigor is closer to that of the wild type, laying a good foundation for subsequent reproductive growth.
[0020] During the phosphorus transport process to the grain, grain-specific silencing not only preserves a certain phosphorus transport capacity but also avoids yield collapse caused by excessive phosphorus deficiency. Under normal and phosphorus-deficient conditions, its key yield indicators such as effective tillering, seed setting rate, and thousand-grain weight are significantly better than those of the constitutive deletion mutant, achieving a synergistic balance between "phosphorus regulation and yield," which is more in line with the actual needs of agricultural production. Attached Figure Description
[0021] Figure 1 The carrier structure is p1301-amiPT4-Ole18.
[0022] Figure 2 for OsPT4 The effect of grain-specific silencing on the content of different forms of phosphorus in grains at multiple time points: A: total phosphorus content; B: soluble phosphorus content; C: inositol-3-phosphate content; D: phytic acid content.
[0023] Figure 3 For root phenotypic identification of different materials, A: 7 WT replicates; B: Enlarged view of A; C: 6 replicates. ospt4-1 D: A close-up of C; E: 6 plants OsPT4 -SKD1 repeated; F: Enlarged view of E; G: 7 plants OsPT4 -SKD2 repeat; H: a magnified view of a portion of G.
[0024] Figure 4 For the measurement and statistics of adventitious root number, lateral root length and lateral root density, A: adventitious root number; B: lateral root length; C: lateral root density.
[0025] Figure 5 for OsPT4 The effect of seed-specific silencing on phosphorus transport in rice, A: wild-type, mutant and seed-specific silencing materials 32 Pi transport to seeds; B: wild-type, mutant, and seed-specific silencing materials 32 Pi's transportation status throughout the entire above-ground area.
[0026] Figure 6 for OsPT4Agronomic traits analysis of seed-specific silencing materials under normal phosphorus-supplied and phosphorus-deficient soil conditions: A: Phenotype of materials under normal phosphorus-supplied soil conditions; B: Phenotype of materials under phosphorus-deficient soil conditions; C: Ear phenotype under normal phosphorus-supplied soil conditions; D: Ear phenotype under phosphorus-deficient soil conditions; E: Statistical analysis of effective tillers; F: Statistical analysis of seed setting rate; G: Statistical analysis of thousand-grain weight. Detailed Implementation
[0027] The present invention will be further illustrated below with specific embodiments, but these embodiments do not limit the scope of the invention. Modifications or substitutions to the details and form of the technical solutions of the present invention may be made without departing from the spirit and scope of the invention, but all such modifications or substitutions fall within the protection scope of the present invention.
[0028] The inventive concept of this invention is as follows: This invention achieves precise silencing of the phosphate transporter OsPT4 through seed-specific regulation technology: Ole18 Using the promoter as a core element, an amiRNA expression vector was constructed, which inhibited expression only in rice grains. OsPT4 The expression avoids the global interference of traditional constitutive mutations on phosphorus metabolism in nutrient organs.
[0029] The core technical solution of this invention is through Ole18 Promoter-driven amiRNA expression vector implementation OsPT4 Specific silencing in rice grains. The specific construction process is as follows: First, rice is obtained through gene synthesis technology. Ole18 The promoter was inserted into the pMD18 vector using TA cloning. After double digestion with HindIII and SalI, the CaMV35S promoter in pCAMBIA1301-35SN was replaced, resulting in the seed-specific basic vector pCAMBIA1301-OleN. Subsequently, using pNW55 plasmid as a template, targeted molecules were synthesized using fusion PCR with four primers. OsPT4 The amiRNA fragment was cloned into the pMD18 vector, digested with BamHI and KpnI, and inserted into pCAMBIA1301-OleN to construct the grain-specific silencing vector p1301-amiPT4-Ole18. This vector was transformed into rice callus tissue via Agrobacterium-mediated transformation, and the results were verified through antibiotic screening, differentiation culture, and molecular validation.
[0030] This invention constructs a grain-specific silencing vector to inhibit [the virus] only in rice grains. OsPT4The expression of phytic acid and phosphorus in rice grains can effectively reduce the excessive accumulation of phytic acid and phosphorus, while avoiding global interference with phosphorus metabolism in vegetative organs, reducing the inhibition of key indicators of vegetative growth potential and yield, and ultimately achieving a synergistic balance between "resistance to reduced nutrients, growth potential and yield". This provides technical support for the cultivation of low-phytic acid rice varieties with both high nutritional value and stable yield.
[0031] To enable those skilled in the art to better understand and implement the technical solutions of this invention, the invention will be further described below with reference to specific embodiments. Unless otherwise specified, all reagents used in this invention are commercially available, and all methods used are conventional techniques in the art.
[0032] Example 1 A DNA fragment is specifically silenced OsPT4 Its applications in gene expression are as follows: 1. Construction and material acquisition of seed-specific silencing vectors.
[0033] 1.1 Grain-specific promoters Ole18 Cloning and verification.
[0034] Select rice grain-specific promoters Ole18 As a driving element, it is highly expressed during rice grain development stages, such as the grain-filling stage, but its expression level is extremely low in non-grain tissues such as roots, stems, and leaves. A 1.2kb gene was obtained through gene synthesis technology. Ole18 The promoter sequence was ligated into the pMD18-T vector using the TA cloning method, transformed into E. coli DH5α competent cells, and after screening with ampicillin plates, single clones were selected for colony PCR verification. Positive clones were sent for sequencing to confirm the sequence correctness.
[0035] Ole18 The gene ID is LOC_Os03g04920; Ole18 The base sequence of the promoter is shown in SEQ ID NO.1.
[0036] SEQ ID NO.1:
[0037] 1.2, Construction of grain-specific basic vector pCAMBIA1301-OleN.
[0038] The sequencing correct pMD18-Ole18 plasmid and plant expression vector pCAMBIA1301-35SN were double digested with restriction enzymes Hind III and Sal I respectively. The enzyme digestion products were separated by 1% agarose gel electrophoresis, and the gel was recovered Ole18 Promoter fragment and linearized pCAMBIA1301-35SN vector. The promoter fragment and linearized pCAMBIA1301-35SN vector were ligated using T4 DNA ligase at 16°C overnight Ole18 Promoter fragment and linearized pCAMBIA1301-35SN vector, Ole18 The molar ratio of the promoter fragment and linearized pCAMBIA1301-35SN vector was 3:1; then Escherichia coli DH5a was transformed, and after screening by 25 μg / mL hygromycin plate, the plasmid was extracted and enzyme digestion was verified, and finally the grain-specific basic vector pCAMBIA1301-OleN was obtained.
[0039] 1.3, Design and synthesis of amiRNA fragment targeting OsPT4 .
[0040] According to the mRNA sequence of OsPT4 , the specific target region was screened by plant amiRNA design tool. The primer was designed with pNW55 plasmid as template, and the amiRNA fragment targeting OsPT4 was synthesized by two-step fusion PCR. Details are as follows:
[0041] First step: with pNW55 plasmid as template, G4368 and PT4-II miR-a, PT4-I miR-s and PT4-IV miR*a, G4369 and PT4-III miR*s were amplified respectively, and the amplified fragments were mixed; then primers G4368 and G4369 were amplified to obtain the final amiRNA fragment targeting OsPT4 , and the sequence is shown in SEQ ID NO. 9.
[0042] Second step: the amiRNA fragment targeting OsPT4 was cloned by pMD18 vector, and then digested with BamH I and Kpn I and inserted into pCAMBIA1301-OleN to finally construct grain-specific silencing vector p1301-amiPT4-Ole18, and the grain-specific silencing vector is shown in Figure 1 . The sequence information of the primers is shown in Table 1.
[0043] OsPT4 The gene ID of the rice is LOC_Os04g10750; OsPT4 The cRNA sequence is shown as SEQ ID NO. 2; the amiRNA fragment targeting OsPT4 The amiRNA fragment targeting the rice is shown as SEQ ID NO. 3.
[0044] Table 1 Primers used for constructing the grain-specific silencing vector SEQ ID NO. 2:
[0045] SEQ ID NO.3: CTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCTCGGATCCCAGCAGCAGCCACAGCAAAATTTGGTTTGGGATAGGTAGGTGTTATGTTAGGTCTGGTTTTTTGGCTGTAGCAGCAGCAGTACTAAGTGAATTGTAGGCGACAGGAGATTCAGTTTGAAGCTGGACTTCACTTTTGCCTCTCTTCGCCTACAATTCACTTAGTATTCCTGCTGCTAGGCTGTTCTGTGGAAGTTTGCAGAGTTTATATTATGGGTTTAATCGTCCATGGCATCAGCATCAGCAGCGGTACCGAGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTTCGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGC.
[0046] 1.4, Agrobacterium transformation and rice line acquisition.
[0047] The grain-specific silencing vector p1301-amiPT4-Ole18 was introduced into Agrobacterium EHA105 by electroporation method, and positive recombinant Agrobacterium was obtained by screening on 60 μg / mL rifampicin + 30 μg / mL hygromycin plates.
[0048] The positive recombinant Agrobacterium was cultured to OD 600 = 0.5, i.e. the logarithmic growth phase, to obtain an infection solution; the infection solution was used to infect mature embryos of rice variety 'Nipponbare', and the embryos were cultured in the dark at 28°C for 3 d to induce callus; then the callus was transferred to a selection medium containing 50 μg / mL hygromycin for 2 rounds of selection, with each round of selection lasting for 20 d, to obtain resistant callus; then the resistant callus was transferred to a differentiation medium to induce seedlings in a light culture at 28°C with a light / dark cycle of 16 h light / 8 h dark, and the seedlings were transplanted to a greenhouse when they grew to 10 cm in length to obtain a grain-specific silencing OsPT4 rice line, i.e.OsPT4 -SKD.
[0049] The formula of screening medium is N6 basic medium + 2 mg / L 2,4-D. The formula of differentiation medium is MS basic medium + 2 mg / L 6-BA + 0.5 mg / L NAA.
[0050] 2, Grain-specific silencing OsPT4 of phytic acid content in seeds of rice lines.
[0051] Wild type, OsPT4 constitutive deletion mutant of rice lines ospt4-1 , grain-specific silencing OsPT4 of rice lines OsPT4 -SKD1 and grain-specific silencing OsPT4 of rice lines OsPT4 -SKD2, the total phosphorus, soluble phosphorus, inositol-3-phosphate and phytic acid concentrations in grains were detected in 14w, 15w and 16w seedlings. The results are shown in Figure 2 , it was found that OsPT4 the effect of specific silencing on the content of different phosphorus forms in seeds was more significant, and it had a significant reducing effect on the total phosphorus, soluble phosphorus, inositol-3-phosphate and phytic acid concentrations in grains of 14w-16w seedlings. In 16w seedlings, OsPT4 specific silencing reduced the total phosphorus and soluble phosphorus by 36% and 40%, and the inositol-3-phosphate and phytic acid concentrations were reduced by 20% and 26%. In addition, OsPT4 the degree of reduction of total phosphorus and soluble phosphorus caused by the constitutive deletion of OsPT4 was higher than that of grain-specific silencing OsPT4 of rice lines, while the degree of reduction of phytic acid content was not significantly different from that of grain-specific silencing OsPT4 of rice lines. This result shows that grain-specific silencing Figure 2 can significantly reduce the phytic acid content in rice grains. P In the table, different letters between wild type and transgenic materials indicate significant differences between them, <0.05, one-way ANOVA.
[0052] 3, Phenotypic identification of grain low-phytic acid rice in the vegetative growth period.
[0053] In order to identify the phenotype of grain-specific silencing OsPT4 materials , The number of adventitious roots, lateral root length and lateral root density of 14-day-old Nipponbare wild type, ospt4- 1 , specific silencing materials OsPT4 -SKD1 and OsPT4 -SKD2 were measured and statistically analyzed, and the results are shown inFigure 3 and Figure 4 No significant difference was found in the number of adventitious roots among different strains; however... ospt4-1 and specific silencing materials OsPT4 -SKD significantly reduced both lateral root length and lateral root density. OsPT4 -SKD had significantly lower lateral root length and density than the wild type; but compared with ospt4-1 In comparison, there was no significant difference in lateral root length; however, lateral root density... ospt4- 1 Compare OsPT4 -SKD is lower. (Explanation) OsPT4 The absence of these features has a more significant impact on root growth and development, particularly in seeds. OsPT4 The effect of specific silencing on rice seed root development is lower than that of complete deletion. Figure 4 In the text, the scale bar is 1 cm and 1 mm. "**" indicates a significant difference between wild-type and transgenic materials. P <0.01, one-way ANOVA; "***" indicates a significant difference between the two. P <0.005, one-way ANOVA.
[0054] 4. The impact of low-phytic acid rice grains on phosphorus transport capacity.
[0055] Utilizing the wild type of Nipponbare, ospt4-1 and OsPT4 -SKD materials were added to the nutrient solution starting on the 9th day after fertilization. 32 Pi isotopes were applied for further treatment at 3 h, 12 h, and 24 h. Different parts of the treated plant samples were then pulverized, scintillation solution was added, and the uptake within the plant was determined using scintillation counting. 32 Pi content. Results are shown in... Figure 5 , shows, in 32 Pi absorption at 3h and 12h ospt4-1 and OsPT4 -SKD material seed 32 The Pi content was significantly lower in the wild type, but ospt4-1 and OsPT4 -SKD material seed 32 There was no significant difference in Pi content, but the accumulation in the entire aboveground part was different. ospt4-1 The middle is significantly lower than OsPT4 -SKD material. In 32 Pi absorption time 24 hours ospt4-1 and OsPT4 -SKD material seed 32 The Pi content was significantly lower in the wild type than in the previous period, which is different from the previous period. OsPT4 -SKD material seed 32The Pi content is significantly higher than ospt4-1 At this point, the accumulation in the entire aboveground part also exhibits a gradient state, i.e., WT> OsPT4 -SKD> ospt4-1 Therefore, compared to OsPT4 Missing materials OsPT4 Seed-specific silencing has a relatively small effect on phosphorus uptake in the aboveground parts, but its effect on phosphorus translocation to the seeds is more significant, which also indicates... OsPT4 It is responsible for the transport of phosphorus into the seed during the reproductive growth stage. Figure 5 In the text, the different letters among wild-type, mutant, and seed-specific silencing materials indicate significant differences between them. P <0.05, one-way ANOVA.
[0056] 5. Phenotypic and yield identification of low-phytic acid grain rice during the reproductive growth stage.
[0057] In order to investigate OsPT4 The effects of grain-specific silencing on rice yield and seed development, under normal phosphorus supply and phosphorus-deficient soil conditions. OsPT4 The agronomic traits of constitutive deletion mutants and seed-specific silencing materials were statistically analyzed. The results are as follows: Figure 6 show, OsPT4- SKD1 and OsPT4- SKD2 was significantly weaker than the wild type under both normal phosphorus supply and phosphorus deficiency soil conditions. OsPT4- SKD1 and OsPT4- Although SKD2's growth is weaker than the wild type, it is significantly better. ospt4-1 Mutant. Ear phenotype results showed the same trend, namely, regardless of whether the soil conditions were phosphorus-supplied or phosphorus-deficient, the ear phenotype was WT> OsPT4- SKD1= OsPT4- SKD2> ospt4-1 Mutant. Statistical results show that, under normal phosphorus supply and phosphorus deficiency soil conditions, although... OsPT4- SKD1 and OsPT4- The SKD2 strain had lower effective tillering, seed setting rate, and thousand-seed weight than the wild type, but compared to the wild type, ospt4-1 The mutant had lower effective tillering, seed setting rate, and thousand-seed weight than the wild type and OsPT4- SKD1 and OsPT4- The SKD2 strain. These results indicate... OsPT4 While seed-specific silencing reduces P accumulation in seeds, its inhibitory effect on agronomic traits such as seed setting rate and thousand-seed weight is significantly less than that on seed setting rate and thousand-seed weight. OsPT4 The complete absence of. Figure 6 In the above, all data are averages. n =4; Figure 6 The A scale is 50cm.Figure 6 B scale = 8 cm. Letters different among wild type, mutant and seed-specific silencing material indicate significant difference between two, P <0.05, one-way ANOVA.
[0058] Each technical feature of the above-described embodiments can be combined arbitrarily, and for the sake of brevity, each technical feature of the above-described embodiments is not described in all possible combinations, but it should be understood that the combinations of these technical features are within the scope of the present disclosure as long as there is no contradiction.
[0059] The above-described embodiments only express several implementation manners of the present application, and the description is relatively specific and detailed, but it should not be understood as a limitation on the scope of the patent. It should be pointed out that for ordinary skilled persons in the art, several modifications and improvements can be made without departing from the concept of the present application, and these are within the protection scope of the present application.
Claims
1. A DNA fragment is specifically silenced. OsPT4 Its application in gene expression is characterized by, The base sequence of the DNA fragment is shown in SEQ ID NO.
1.
2. The application as described in claim 1, characterized in that, By constructing a specific silencing vector for the aforementioned DNA fragment, the specific silencing vector was transduced into rice to inhibit... OsPT4 Gene expression in rice grains.
3. The application as described in claim 2, characterized in that, The method for preparing the specific silencing vector includes the following steps: The DNA fragment was synthesized and ligated into a plant expression vector to obtain a specific basic vector. Amplification Target OsPT4 amiRNA of the gene, targeting OsPT4 The sequence of the amiRNA of the gene is shown in SEQ ID NO.3; Target OsPT4 The amiRNA of the gene is ligated into a specific basic vector to obtain the specific silencing vector.
4. The application as described in claim 3, characterized in that, Amplify the target OsPT4 The process of gene amiRNA is as follows: Using pNW55 plasmid as a template, product 1 was amplified using primer set 1; primer set 1 consists of SEQ ID NO.4 and SEQ ID NO.
7. Using pNW55 plasmid as a template, product 2 was amplified using primer set 2; primer set 2 is SEQ ID NO.6 and SEQ ID NO.9; Using pNW55 plasmid as a template, product 3 was amplified using primer set 3; primer set 3 consists of SEQ ID NO.5 and SEQ ID NO.
8. Products 1, 2, and 3 were mixed and used as a template. The target was then amplified using primer set 4. OsPT4 The amiRNA of the gene; the primer set 4 is SEQ ID NO.4 and SEQ ID NO.
5.
5. The preparation method according to claim 3, characterized in that, The plant expression vector is pCAMBIA1301-35SN.
6. The preparation method according to claim 3, characterized in that, The molar ratio of the DNA fragment to the plant expression vector is 2-3:
1.
7. The application as described in claim 3, characterized in that, Targeted OsPT4 The process by which the amiRNA of a gene is ligated into a specific basic vector is as follows: Target OsPT4 The amiRNA of the gene was cloned into the pMD18 vector, and then... BamH I and Kpn After double digestion with enzyme I, the enzyme is ligated into a specific basic vector.
8. The application as described in claim 2, characterized in that, The method for transducing the specific silencing vector into rice is as follows: A specific silencing vector was introduced into Agrobacterium to obtain positive recombinant Agrobacterium; Infection solution was prepared using positive recombinant Agrobacterium; Rice can be infected with an infection solution, and a specific silencing vector can then enter the rice.
9. The application as described in claim 8, characterized in that, The preparation process of the infiltration solution is as follows: The positive recombinant Agrobacterium was cultured to OD. 600 The concentration is 0.5, which yields the inoculum.
10. The application as described in claim 8, characterized in that, The Agrobacterium is EHA105.