A primer probe set, kit and method for early and rapid detection of corn southern rust in field
By designing specific primer and probe sets and multi-enzyme isothermal nucleic acid amplification technology, the problems of portability and early diagnosis of maize southern rust in the field have been solved, realizing rapid, accurate and low-cost disease monitoring and control in the field.
Patent Information
- Application Number
- CN202511011679.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2025-01-22
- Filing Date
- 2025-07-22
- Publication Date
- 2026-05-19
- Estimated Expiration
- 2045-07-22
AI Technical Summary
Existing technologies cannot achieve full-process field operation for maize southern rust, have the risk of non-specific amplification, lack early diagnostic capabilities, lack portability, and are costly and time-consuming, making it difficult to meet the needs of early disease diagnosis and real-time field monitoring.
A primer and probe set based on the specific region of the O-mannosyltransferase gene in Puccinia polysora, the pathogen of maize southern rust, was designed. Combined with multi-enzyme isothermal nucleic acid rapid amplification technology, a portable maize southern rust detection kit was developed, which is suitable for on-site, real-time detection in the field.
It enables rapid, accurate, and low-cost field detection of southern rust disease in corn, with results available within 20-30 minutes, providing early warning of the disease, simplifying the operation process, and making it suitable for grassroots promotion.
Smart Images

Figure CN120888685B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant disease detection technology, specifically relating to a primer and probe set, reagent kit, and method for early rapid field detection of southern rust disease in maize. Background Technology
[0002] Currently, research on southern rust of maize, both domestically and internationally, mainly focuses on the disease's occurrence patterns, pathogen identification, biological characteristics, and genetic resistance. Molecular detection techniques for the pathogen of southern rust, *Russula multifiliis*, still primarily rely on traditional methods, including conventional PCR and TaqMan qPCR. While these traditional methods offer a certain level of accuracy, they have the following shortcomings in practical applications:
[0003] 1. Inability to perform full-process field operations: Although existing technologies have introduced isothermal amplification methods to improve detection speed, product reading still relies on agarose gel electrophoresis and imaging equipment. These devices are bulky, expensive, and complex to operate, requiring laboratory use and not feasible for independent field testing. Furthermore, most grassroots and even provincial plant protection stations or individual farmers in my country lack such equipment and professional operators, failing to meet the practical need for "real-time on-site interpretation."
[0004] 2. Risk of non-specific amplification: Most primers currently used are designed in the ITS region, which is a universal barcode for fungi and is highly conserved among closely related fungi, easily leading to non-specific amplification. This is especially true in field samples where multiple pathogens are commonly found in co-infection, increasing the risk of false detection.
[0005] 3. Insufficient early diagnostic capabilities: Traditional methods are difficult to achieve rapid and accurate early diagnosis of diseases, often leading to missing the best time for prevention and control;
[0006] 4. Lack of portability: The detection process is complex and cumbersome, making it unsuitable for use in non-laboratory environments such as fields;
[0007] 5. High cost and time consumption: The equipment requirements are high, the testing costs are expensive and the time consumption is long, which limits its application in large-scale disease detection.
[0008] Based on the above problems, there is an urgent need to develop a rapid detection technology for southern rust of maize, which is efficient, portable and cost-controllable, to meet the needs of early diagnosis and real-time field monitoring of the disease, and to provide technical support for precise prevention and control. Summary of the Invention
[0009] To address the aforementioned shortcomings of existing technologies, the purpose of this invention is to provide a primer and probe set, reagent kit, and method for the early rapid detection of maize southern rust in the field. This invention successfully developed a portable early rapid detection kit and method for maize southern rust, achieving true real-time field detection for the first time. Through bioinformatics analysis, this invention screened a specific region of the O-mannosyltransferase gene for maize southern rust, designed and synthesized amplification primers for this region, and established a maize southern rust detection system based on multi-enzyme isothermal nucleic acid rapid amplification technology.
[0010] The first objective of this invention is to provide a primer-probe set for detecting southern rust in maize, comprising an upstream primer F12, a downstream primer R11, and a probe. The nucleotide sequence of the upstream primer F12 is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer R11 is shown in SEQ ID NO.6. The nucleotide sequence of the probe is shown in SEQ ID NO.10, wherein the 31st base T is modified with a FAM fluorescent group, a tetrahydrofuran (THF) is introduced between the 32nd base G and the 33rd base T as a debasement site, the 33rd base T is modified with a BHQ1 quencher group, and the 3' end is blocked with a C3 spacer.
[0011] Compared to existing primers based on the ITS region, this invention, for the first time, designs an amplification and detection system based on the specific structure of a functional gene. Targeting the species-specific region of the O-mannosyltransferase gene in *Puccinia polysora*, the pathogen of southern maize rust, specific primers were designed and obtained, establishing a rapid on-site detection system that combines high specificity and functional relevance. This invention makes a breakthrough by utilizing specific segments in functionally relevant genes, significantly improving the accuracy and stability of detection.
[0012] The second objective of this invention is to provide a detection kit for maize southern rust, comprising the aforementioned primer and probe set and DNA isothermal rapid amplification reagent.
[0013] The third objective of this invention is to provide a rapid early field detection kit for maize southern rust, comprising the aforementioned maize southern rust detection kit and DNA lysis buffer. This kit is truly suitable for field use and is easy to operate.
[0014] Preferably, the maize southern rust detection kit contains all the components of the DNA isothermal rapid amplification kit: Abuffer, B buffer, lyophilized powder reagent, and a positive control template and a positive control primer-probe MIX used as controls, as well as the primer-probe set; the DNA isothermal rapid amplification kit is a fluorescent DNA isothermal rapid amplification kit, purchased from Anpu Future Biotechnology Co., Ltd., catalog number: WLE8202KIT.
[0015] Preferably, all components of the maize southern rust detection kit are prepared into a dry powder reagent and a buffer microsphere in a PCR tube according to the amount of 50 μL amplification reaction system for one detection, which is used as the detection reagent tube; in the detection reagent tube, the upstream primer F12 is 20 pmol, the downstream primer R11 is 20 pmol, and the probe is 6 pmol; the maize southern rust detection kit contains several detection reagent tubes.
[0016] Preferably, the DNA lysis buffer is a DNA rapid nucleic acid release agent type II, purchased from Anpu Future Biotechnology Co., Ltd., catalog number: WLD8201-ES.
[0017] The fourth objective of this invention is to provide a method for early and rapid field detection of southern rust disease in maize, comprising the following steps:
[0018] S1. Take 2-3 small leaf pieces (1cm x 1cm) from the lower part of the leaf of the corn plant to be tested, about 15-20cm from the leaf tip, and place them in tube 1. Grind the sample with a grinding rod for 1 minute, mix well, and let it stand at room temperature for 10 minutes to lyse and obtain the lysate. Tube 1 is a 1.5mL centrifuge tube containing 500μL of DNA lysis buffer.
[0019] S2. Using a 50μL quantitative pipette, take 50μL of the lysis product and add it to tube 2. Mix well to dilute. Using a 50μL quantitative pipette, take 50μL of the diluted lysis product and add it to the test reagent tube. Mix well and then shake the liquid to the bottom of the tube to obtain the reaction tube. Tube 2 is a 1.5mL centrifuge tube containing 450μL of sterile water.
[0020] S3. Place the reaction tube into the digital constant temperature detector, set the temperature to a constant 40℃, start the operation, amplify for 4 minutes, the instrument will emit a "beep" prompt, at this time take out the reaction tube, mix well, shake the liquid to the bottom of the tube, put it back into the digital constant temperature detector to continue amplification for 16 minutes, the program ends, the instrument displays the corresponding value of the well position.
[0021] S4. Interpret the results based on the instrument display values: If the instrument display value is between 00 and 03, the result is negative, indicating that the sample does not contain the nucleic acid of *Rhizoctonia solani*, the pathogen of southern rust of corn; if the instrument display value is between 04 and 99, the result is positive, indicating that the sample contains the nucleic acid of *Rhizoctonia solani*, the pathogen of southern rust of corn.
[0022] Preferably, the digital constant temperature detector is purchased from: Anpu Future Biotechnology Co., Ltd., product number: WL-PS-8C.
[0023] The fifth objective of this invention is to provide the application of the aforementioned maize southern rust detection primer and probe set, maize southern rust detection kit, and maize southern rust field early rapid detection kit in the detection and control of maize southern rust.
[0024] The present invention has the following advantages:
[0025] (1) This invention can enable efficient and rapid field detection of southern rust of maize, providing a scientific basis for molecular identification and early warning of the disease, and helping to achieve precise prevention and control.
[0026] (2) This invention has constructed a pathogen detection technology system that is easy to operate, highly sensitive, low in cost and easy to promote, providing technical support for the monitoring, prediction and control of southern rust of corn, and has high application value.
[0027] (3) This invention is the first to achieve nucleic acid detection in the field, with results observable within 20-30 minutes, enabling earlier and more sensitive monitoring of southern rust in maize. The kit of this invention can detect southern rust infection in maize leaves 7 days before symptoms appear in field tests. Currently, there are no rapid field detection products for early-stage southern rust in maize, both domestically and internationally. The successful development of this kit can help to more accurately control southern rust in maize production.
[0028] (4) The method of the present invention is simple to operate, does not require expensive professional instruments and equipment, and is easier to operate than professional experimental instruments; it is not limited by the detection scenario, and can be tested directly in the field, which is highly practical and easier to promote and detect at the grassroots level. Attached Figure Description
[0029] Figure 1 This is the sequence alignment result of the O-mannosylation and its core enzyme PMT-mannosyltransferase encoding gene; where A is a schematic diagram of the O-mannosylation modification process of yeast proteins; B and C are the sequence alignment results of the PMT1 and PMT2 mannosyltransferase encoding genes (FUNA_006985 and FUNB_002470) of *Russula multifiliis* and homologous genes in other common maize pathogenic fungi, respectively.
[0030] Figure 2 These are the results of the conservation analysis of the target gene PMT1 sequence; among them, A shows the verification of the conservation of the PMT1 gene sequence in more than 100 strains of *Pycnosus spp.*; B shows that no site variations were found in the PMT1 target region in all tested strains, indicating that the region is highly conserved.
[0031] Figure 3 This indicates that the target fragments of more than 100 *Russula multistachys* samples were all covered by short read sequences and showed no structural variation.
[0032] Figure 4This is a primer screening analysis; where A is the qPCR amplification curve using upstream primer F11 with four different downstream primers R11, R12, R13, and R14; B is the qPCR amplification curve using upstream primer F12 with four different downstream primers R11, R12, R13, and R14; C is the qPCR amplification curve using upstream primer F13 with four different downstream primers R11, R12, R13, and R14; and D is the qPCR amplification curve using upstream primer F14 with four different downstream primers R11, R12, R13, and R14.
[0033] Figure 5 This is a validation of the specificity of the selected primer pairs F11-R11 and F12-R11 for amplifying the southern rust pathogen of maize, *Russula multiplystilts*.
[0034] Figure 6 This study analyzes the sensitivity of the selected primers for amplification of *Rhizoctonia solani*, the pathogen of southern rust in maize; where: A is primer pair F11-R11, and B is primer pair F12-R11.
[0035] Figure 7 This is a sensitivity verification test of the selected primer pairs for amplification of maize leaf samples inoculated with *Russula multiflora*; where: A is primer pair F11-R11, and B is primer pair F12-R11.
[0036] Figure 8 The study tested the effects of different amounts of three different lysis buffers; where A is the DNA lysis buffer, B is the TBS lysis buffer, and C is the RNA lysis buffer.
[0037] Figure 9 This refers to the effect detection of three different lysis buffers; where DNA represents DNA lysis buffer, TBS represents TBS lysis buffer, and RNA represents RNA lysis buffer.
[0038] Figure 10 This is a comparison of qPCR results and digital thermostat detection results for maize leaf samples inoculated with multiple piles of *Russula styracifolium* for different number of days; where A represents the qPCR results and B represents the digital thermostat detection results.
[0039] Figure 11 It is the result of continuous monitoring of field samples that have not yet shown symptoms. Detailed Implementation
[0040] The following embodiments are further illustrations of the present invention, but not limitations thereof.
[0041] Example 1
[0042] I. Screening and Specificity Determination of Target Genes
[0043] O-mannosylation is an important post-translational modification of proteins widely found in fungi, and the PMT family, as its core enzymes, is not only structurally conserved but also closely related to the pathogenicity of pathogens. Figure 1 (A in the original text). Our previous studies have shown that the 5' ends of the PMT1 (FUNA_006985) and PMT2 (FUNB_002470) genes in the P. polysora genome contain approximately 600 bp more unique sequence regions than their homologs in other maize pathogenic fungi. Figure 1 The regions B and C in the gene exhibit strong species specificity. By comparing the genomes of multiple related pathogenic fungi and performing a series of primer screenings, we finally identified a specific region of the PMT1 gene as the detection target. Experiments showed that this site, while possessing high specificity, is also stably expressed in crude field samples and is easily amplified, making it suitable for developing rapid field diagnostic technologies, especially showing significant advantages in the detection of pathogens in the latent stage.
[0044] Based on bioinformatics analysis, a highly conserved gene sequence (a specific target fragment on the PMT1 gene, whose nucleotide sequence is shown in SEQ ID NO.1) was screened from over one hundred *P. multifiliis* rust strains collected nationwide. Simultaneously, it was ensured that this sequence is highly specific for other major maize diseases (such as common rust and small leaf spot), meaning it is not present in the pathogens of other diseases. Combining the requirements of conservation and specificity, primers for rapid detection were further optimized and designed.
[0045] (1) Conservatism
[0046] To verify that the target fragment on the PMT1 gene used for rapid detection is highly conserved among various strains of *Rust hygroscopicus*, we first compared the target fragment. Figure 2 In section A), the area within the red box represents the target fragment. The first exon is conserved, and the results show that this sequence has no SNPs or Indel variations. Figure 2 In the example B), the two indels marked with a short blue line have very low MAF values (0.02), indicating that this gene may not have any variation within the population. Furthermore, genome alignment and depth of coverage analysis were performed on all strains collected from across the country. Figure 3 More than 100 strains of *Russula multipendicularis* were presented; the results showed that the target fragment of all strains was covered by short read sequences, indicating no structural variation; this further confirmed the conservation of the target fragment sequence.
[0047] (2) High specificity
[0048] The target fragment on the PMT1 gene used for rapid detection also exhibits high specificity among maize disease pathogens. Comparison with 12 different diseases (Table 1) shows that, except for southern maize rust, the genomes of the pathogens of other major maize diseases do not contain this sequence, thus indicating that this target fragment sequence has high specificity.
[0049] Table 1. Sequence-specific alignment results of target fragments on the PMT1 gene.
[0050]
[0051]
[0052] II. Primer Design and Optimization
[0053] (1) Primer screening
[0054] Sixteen primer pairs were designed and synthesized based on the target fragment sequence of the specific gene PMT1. qPCR detection and verification were performed using DNA from *Pseudomonas aeruginosa*, the pathogen of southern maize rust, as a template. Preliminary screening identified relatively optimal primers. Specifically, different combinations of upstream primers F11, F12, F13, and F14 with downstream primers R11, R12, R13, and R14 were used for qPCR verification. The primer sequences are as follows:
[0055] F11: GACTTCAAACTCGTATCAAGATTCGCTCGATG (SEQ ID NO. 2);
[0056] F12: CAAGATTCGCTCGATGATCATCTCAATCGATC (SEQ ID NO.3);
[0057] F13: CTCAATCGATCTCAACTAGACCCCATTCGATC (SEQ ID NO.4);
[0058] F14: GTAGACCAAGGGGATCGACCACTAGGACCATC (SEQ ID NO.5);
[0059] R11: GATTGGATGGATCGATGATGGAGAGTGAACTG (SEQ ID NO.6);
[0060] R12: GTGGTGGTGATGAGTTGAGGATTGGATGGATCG (SEQ ID NO.7);
[0061] R13:GATGAGTTGATGGATCGAGAGAGCTGAGTG (SEQ ID NO. 8);
[0062] R14: CTGTTGAGGTAAGAAGTGGCGGATGAGTTGATG (SEQ ID NO.9);
[0063] Probe: GGTGATGATTGAAGTGAGTTGGAAGGGTGATGTGATCATTTGAATCTG (SEQ ID NO.10), wherein the 31st base T is modified with the FAM fluorescent group, a tetrahydrofuran (THF) is introduced between the 32nd base G and the 33rd base T as a debasement site (the recognition site for endonuclease IV), the 33rd base T is modified with the BHQ1 quencher group, and the 3' end is blocked with a C3 spacer. That is, the probe sequence can also be represented as GGTGATGA TTGAAGTGAGTTGGAAGGGTGA[FAM-dT]G[THF][BHQ1-dT]GATCATTTGAATCTG-[3'C3spacer].
[0064] First group of tests ( Figure 4 In step A), upstream primer F11 was used with four different downstream primers R11, R12, R13, and R14 for amplification. The results showed that the F11-R11 primer pair had an earlier peak and a higher peak value. The second set of detections (…) Figure 4 In step B), upstream primer F12 was used to amplify the amplification using four different downstream primers R11, R12, R13, and R14. The results showed that the F12-R11 primer pair had an earlier peak and a higher peak value. The third group of detections (…) Figure 4 In step C), the upstream primer F13 was used with four different downstream primers R11, R12, R13, and R14 for detection. The results showed that the F13-R11 primer pair had an earlier peak and a higher peak value. The last set of detections (…) Figure 4 In step D), upstream primer F14 was used with four different downstream primers R11, R12, R13, and R14 for detection. The results showed that the F14-R11 primer pair had an earlier peak and a higher peak value. Based on the qPCR results, the CT values of primer pairs F11-R11, F12-R11, F13-R11, and F14-R11 were compared. The results showed that primer pairs F11-R11 and F12-R11 had the earliest peak and the lowest CT value compared to other primer combinations. Figure 4 Since A and B are in the primer pair, F11-R11 and F12-R11, which are relatively good primer pairs, were selected as candidate primers for subsequent testing.
[0065] The specific reaction system for the aforementioned qPCR detection is as follows: 29.4 μL of buffer A, 2 μL of upstream primer (10 μM), 2 μL of downstream primer (10 μM), 0.6 μL of probe (10 μM), 5 μL of DNA template, 8.5 μL of ddH2O, and 2.5 μL of buffer B, for a total volume of 50 μL. Before the detection reaction, thaw the liquid components of the kit (DNA Isothermal Rapid Amplification Kit (Fluorescent Type), purchased from AMP Future Biotechnology Co., Ltd., website: https: / / www.tech-up.cn / 1089.html, catalog number: WLE8202KIT, kit composition: A buffer, B buffer, lyophilized reagent, and positive control template and positive control primer probe MIX used as controls) at room temperature, vortex to mix, and add the reagents in the above reaction system to the dry powder tube in the kit in sequence. Finally, add the B buffer from the kit to the inside of the cap of the reaction tube, and after capping, invert 8-10 times to mix. After mixing, shake (or rapidly centrifuge) the reaction solution to the bottom of the tube, and then immediately place the reaction tube into the PCR instrument. The detection reaction conditions were set as follows: isothermal 39℃; fluorescence signal acquisition every 30s; reaction time 20min; and "none" selected for both passive reference and quencher on the PCR instrument.
[0066] (2) Primer specificity verification
[0067] The two primer pairs F11-R11 and F12-R11, selected from the initial primer screening, were further validated for specificity. qPCR amplification was performed using DNA from common maize rust, short leaf spot, stalk rot / ear rot pathogens, and *Russula multifiliis*, the pathogen of southern maize rust, as templates. qPCR results ( Figure 5 The results showed that both primer pairs only produced peak values when the template was *Russula multifiliis* DNA; no peak values were observed for other pathogen DNA. This indicates that the two primer pairs were specific to *Russula multifiliis* compared to the pathogens causing common maize rust, small leaf spot, and stalk / ear rot. The qPCR reaction system consisted of: 29.4 μL A buffer, 2 μL upstream primer (10 μM), 2 μL downstream primer (10 μM), 0.6 μL probe (10 μM), 5 μL DNA template, 8.5 μL ddH2O, and 2.5 μL B buffer, for a total volume of 50 μL. The DNA template consisted of the corresponding specific pathogen DNA for verification.
[0068] (3) Primer sensitivity verification
[0069] First, construct a synthetic plasmid containing the PMT1 gene target fragment using a vector. The specific steps are as follows:
[0070] Using DNA from *Pseudomonas aeruginosa*, the pathogen of southern maize rust, as a template, PCR amplification was performed using upstream primer F: GACCTCGAGGGGGGGCCCAGACCAAGGGGATCGACCAC (SEQ ID NO.11) and downstream primer R: CTCCTCGCCCTTGCTCACCATTGGATTCGAGACCACCACCGA (SEQ ID NO.12). The amplified product was obtained. After gel electrophoresis, the amplified fragment was recovered and its concentration was measured. The sequence of this amplified fragment is shown in SEQ ID NO.13. This fragment was inserted into the linearized pYBA1143(C-HA) vector for recombination, yielding a recombinant product. This recombinant product was transformed into competent *E. coli* cells, subjected to resistance selection and culture, and then plasmid was extracted and its concentration was measured to obtain a synthetic plasmid containing the PMT1 gene target fragment for later use.
[0071] Using the synthetic plasmid containing the PMT1 gene target fragment prepared above as a template, six concentration gradients of the plasmid were prepared (100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL, 1 fg / μL). Different concentrations of plasmid were used as templates, with three replicates for each concentration, and qPCR amplification was performed using different primers. First, qPCR amplification of the above six different concentrations of *Rust hygroscopicus* plasmids was performed using primer pair F11-R11; the test results (…) Figure 6 A) indicates that the lowest detection sensitivity of F11-R11 is 1 fg / μL. Next, qPCR amplification was performed on the above six different concentrations of *Rust hygroscopicus* plasmids using primer pair F12-R11; the results ( Figure 6 B) indicates that the lowest detection sensitivity of F12-R11 is 10 fg / μL. This shows that both primer pairs selected for the initial screening have high sensitivity to *Russula multifiliis*. Although F11-R11 can detect lower concentrations, its high sensitivity may lead to relatively poor repeatability and peak performance in CT values. F12-R11 has slightly lower sensitivity than F11-R11, but F12-R11 has better repeatability and more stable peak performance in CT values. Therefore, considering all factors, F12-R11 is superior to F11-R11. The qPCR reaction system consisted of: 29.4 μL of buffer A, 2 μL of upstream primer (10 μM), 2 μL of downstream primer (10 μM), 0.6 μL of probe (10 μM), 5 μL of plasmid template, 8.5 μL of ddH2O, and 2.5 μL of buffer B, for a total volume of 50 μL. Two different primer pairs were used for qPCR amplification, and the gradient CT values and peak changes were compared.
[0072] III. Validation of the testing system
[0073] 1. Validation of the indoor testing system
[0074] 1.1 Sample sensitivity verification
[0075] DNA from maize leaf samples inoculated with *Symplocos rubrum* for 1-10 days was used directly as a template, with each sample tested in triplicate. The sensitivity of primer pairs F11-R11 and F12-R11 was validated. First, detection was performed using primer pair F11-R11. Figure 7 The results (A) showed that qPCR began to show peak values and CT values when the template was maize leaf sample DNA inoculated with *Russula multiflora* on the third day, indicating that this primer pair could detect *Russula multiflora* on the third day after infection of maize leaves. Then, primer F12-R11 was used for detection. Figure 7 (B) The results showed that qPCR began to show peak values and CT values when the template was maize leaf samples inoculated with *Russula multifiliis* on the second day. This indicates that primer pair F12-R11 can detect *Russula multifiliis* on the second day after infection of maize leaves. Sample sensitivity verification results showed that F12-R11 had a lower CT value, better repeatability, and could detect *Russula multifiliis* earlier. Therefore, based on the primer sensitivity test results, F12-R11 was determined as the optimal primer pair and used as the primer pair for kit development.
[0076] The DNA preparation method for corn leaf samples is as follows: Select 10 Zhengdan 958 corn seedlings at the 2-3 leaf stage per pot, wash the seedlings (gently stroke the leaves 2-3 times with your fingers) and set aside. Collect fresh urediniospores of *Styrax styracifolium*, prepare a spore suspension with an aqueous solution containing Tween-80, and then prepare the spore suspension (concentration 2×10⁻⁶). 5 The spores (per mL) were evenly sprayed onto corn leaves. The inoculated corn seedlings were then placed in an incubator (conditions: temperature 26℃, relative humidity 70%), covered with a black bag, and cultured in the dark for 24 hours. After 24 hours, the bag was removed, and normal cultivation resumed. The first sampling was performed 24 hours after inoculation, followed by sampling every day for a total of 10 days. Samples were photographed daily and promptly stored at -80℃. DNA was extracted from the collected samples using the CTAB method and stored at -20℃ for later use.
[0077] To facilitate rapid field testing of maize leaf samples, the lysis buffer used in sample DNA extraction was screened and optimized.
[0078] 1.2 Screening of lysis buffers
[0079] 1.2.1 Test of the amount of lysis buffer added
[0080] To clarify the impact of the amount of lysis buffer added on the detection effect and obtain the best detection results, primer pair F12-R11 was used to detect the amount of three different lysis buffers added: DNA lysis buffer, TBS lysis buffer, and RNA lysis buffer.
[0081] First, the amount of DNA lysis buffer added was tested. Figure 8 In step A), two gradients of 60 and 100 μL were set, with each treatment repeated twice. qPCR results showed that DNA lysis buffer eluted earlier and produced a higher peak value when 60 μL was added. Next, the amount of TBS lysis buffer added was tested (…). Figure 8 The qPCR results showed that the peak value of TBS lysis buffer was higher when 60 μL was added (B in the formula), with three gradients: 60 μL, 100 μL, and 120 μL, and each treatment was repeated twice. The final test was conducted on the amount of RNA lysis buffer added (B in the formula). Figure 8 In step C), three gradients were set: 100, 300, and 500 μL, with each treatment repeated three times. RNA lysis buffer showed earlier and higher peak values with 100 μL. The results indicated that DNA and TBS lysis buffers performed better with 60 μL, so 60 μL was added for subsequent assays. RNA lysis buffer performed better with 100 μL, therefore 100 μL was added for subsequent assays.
[0082] Specific sample preparation methods and reaction conditions: Three small pieces of corn leaves (approximately 1cm x 1cm in size) inoculated with *Symplocos rubrum* on the third day after inoculation were added to 1.5mL centrifuge tubes with the corresponding volumes of lysis buffer and ground until the leaf tissue was broken up. Lysis was then performed. The lysis conditions and times for different lysis buffers were as follows: DNA lysis buffer was reacted at room temperature for 5 min, RNA lysis buffer at 40℃ for 10 min, and TBS lysis buffer at 65℃ for 15 min. 5μL of the supernatant was used as a template for qPCR amplification. The DNA lysis buffer was a rapid nucleic acid release agent (DNA type)-II, purchased from Anpu Future Biotechnology Co., Ltd., catalog number: WLD8201-ES; the RNA lysis buffer was a rapid nucleic acid release agent (RNA type), purchased from Anpu Future Biotechnology Co., Ltd., catalog number: WLR8203. The TBS lysis buffer formulation was: 100mL Tris-HCl (pH 8.0), 20mL EDTA, 74.5g KCl, diluted to 1L with water.
[0083] 1.2.2 Selection of final pyrolysis solution
[0084] To select the most effective and convenient lysis buffer, primer pair F12-R11 was used to further test and compare the effects of three lysis buffers, thereby screening for the optimal lysis buffer. Test results ( Figure 9The results showed that the peak value of the DNA lysis buffer was higher than that of the TBS and RNA lysis buffers, and the CT value of the DNA lysis buffer was the lowest, indicating that the DNA lysis buffer was more effective. Therefore, the DNA lysis buffer was finally selected as the lysis buffer for rapid detection of southern rust in maize.
[0085] Specific operating methods and reaction conditions: Take corn leaves (approximately 1cm x 1cm in size, 3 small pieces) inoculated with *Symplocos rubrum* for 5 days and add corresponding volumes of lysis buffer (60μL for DNA lysis buffer, 60μL for TBS lysis buffer, and 100μL for RNA lysis buffer) to 1.5mL centrifuge tubes and grind until the leaf tissue is broken, then perform lysis; the lysis conditions and times for different lysis buffers are as follows: DNA lysis buffer is reacted at room temperature for 5 min, RNA lysis buffer is reacted at 40℃ for 10 min, and TBS lysis buffer is reacted at 65℃ for 15 min; take 5μL of supernatant as DNA template for qPCR amplification, and perform 2 replicates for each treatment.
[0086] 1.2.3 Comparison of qPCR results and results from digital isothermal detector
[0087] qPCR instruments are expensive, require operators to have certain experimental skills, and can only be used indoors, limiting their application. Digital thermostats, on the other hand, are simple and flexible to operate, and can be taken directly to the field for testing with a small portable power supply.
[0088] To verify whether the results of the two amplification methods were consistent, we used the same primers to detect F12-R11 and the same leaf sample, and then compared the detection results.
[0089] Template preparation method: Take three small pieces (approximately 1cm x 1cm) of corn leaves inoculated with *Russula multiflora* on days 2-5 of inoculation into a 1.5mL centrifuge tube, add 60μL of DNA lysis buffer, and incubate at room temperature for 5 minutes. Use 5μL of the supernatant as a template for testing. First, extract DNA from the leaf samples inoculated with *Russula multiflora* using the DNA lysis buffer extraction method. Then, amplify the DNA using a qPCR instrument. Figure 10 In A), the qPCR amplification results showed that when the template was the DNA from a corn leaf sample inoculated with *Russula multiflora* on the third day, a peak value and CT value appeared, indicating that *Russula multiflora* could be amplified on the third day.
[0090] Secondly, DNA was extracted from maize leaf samples inoculated with *Symplocos rubrum* using the same DNA lysis buffer extraction method and amplified in a digital thermostat. The digital thermostat was powered on, the prepared eight-panel sample was placed inside, the heating button was pressed (constant temperature 40℃), and the test results were obtained after 20 minutes. The digital thermostat was purchased from: Anpu Future Biotechnology Co., Ltd., product number: WL-PS-8C. Results ( Figure 10 B) in the table is as follows: S1: Template is from 1 day after inoculation, detection value is 0; S2: Template is from 2 days after inoculation, detection value is 0; S3: Template is from 3 days after inoculation, detection value is 6; S4: Template is from 4 days after inoculation, detection value is 12; S5: Template is from 5 days after inoculation, detection value is 13; S6: Template is DNA from a field sample showing disease symptoms, detection value is 33; S7: Template is a positive control of *Rust pilosa* inoculated for 10 days, detection value is 36; S8: Template is a negative control without inoculation, detection value is 0.
[0091] The amplification results from the digital thermostat showed that *Russula multistachys*, the pathogen of southern rust in maize, could be amplified on the third day after inoculation. Comparison of the test results showed that the qPCR results were consistent with the digital thermostat results, indicating that the digital thermostat can be used for field testing.
[0092] 2. Validation of the field testing system
[0093] Because laboratory conditions and field conditions differ significantly, field testing was conducted to verify the results in addition to laboratory testing.
[0094] The leaves used in the initial testing were laboratory-inoculated leaves, ensuring a clean inoculum free from other contaminants, and the corn seedlings were young with more delicate leaves. Field testing, however, presents more complex conditions, with other interfering factors on the leaves, and the tested leaves are from the tasseling stage, indicating greater maturity. Therefore, the testing time is slightly later than laboratory testing. However, *Russula multifiliis* has a 6-7 day incubation period after invading the leaves. During this period, no symptoms appear on the leaves, and it is difficult to detect with the naked eye. Field testing has demonstrated that the optimized method in this embodiment can detect the pathogen during its incubation period, before leaf disease development, providing guidance for disease control at the grassroots level in the field.
[0095] 2.1 Determine the sampling location
[0096] Take 30 corn leaves from the field, measure the distance from the leaf tip to the diseased area and take the average value. Determine the sampling location as a small piece of corn leaf, 1cm*1cm in size, 15-20cm away from the leaf tip.
[0097] 2.2 Testing the grinding time and pyrolysis time detection process.
[0098] Field samples were tested using a digital thermostat. Two to three corn leaves (small pieces, approximately 1cm x 1cm, located 15-20cm from the leaf tip) were placed in 1.5mL centrifuge tubes containing 500μL of DNA lysis buffer. (Field corn leaves are usually quite mature, so the buffer volume was adjusted; volumes of 60μL, 100μL, 300μL, 500μL, and 800μL were compared, and 500μL was found to be optimal; therefore, 500μL of DNA lysis buffer was used in subsequent experiments.) Grinding and lysis times were tested, with three replicates for each treatment. The results (Tables 2 and 3) showed that grinding for 1 min was more effective than grinding for 2 or 3 min, and lysis for 10 min was more effective than lysis for 3 or 5 min; therefore, lysis for 10 min yielded the best results.
[0099] Table 2 Test results of grinding time
[0100]
[0101] Table 3 Test results of pyrolysis time
[0102]
[0103] 2.3 Test of the amount of reaction template added
[0104] Maize leaf samples that had been inoculated with multiple batches of *Sterculia sclerotiorum* fungus for 1-8 days prior in the laboratory were tested, with each treatment performed in triplicate. A digital thermostat was used to detect values of 0 for samples inoculated for 1-3 days, with values only detected from the fourth day onwards.
[0105] According to the test results (Table 4), the test values of samples inoculated with *Styrax multiflora* for 4-8 days were higher when the sample template addition amount was 5 μL than when it was 10 μL. This indicates that adding 5 μL of the reaction template is more effective than adding 10 μL. Therefore, the template addition amount in the test reaction system was determined to be 5 μL.
[0106] Table 4 Results of the test on the amount of reaction template added
[0107]
[0108] 2.4 Establish specific operational methods for field monitoring
[0109] (I) Material Preparation
[0110] 1.5mL centrifuge tubes, 50μL quantitative pipettes, grinding rods, field testing reagents, DNA lysis buffer, sterile water, digital thermostat, power bank, PCR tube rack, scissors, etc. Each sample requires two 1.5mL centrifuge tubes and two 50μL quantitative pipettes. The field testing reagent contains all the original components of the DNA Isothermal Rapid Amplification Kit (fluorescent type) (manufactured by Anpu Future Biotechnology Co., Ltd., catalog number: WLE8202KIT): A buffer, B buffer, lyophilized powder reagent (and a positive control template and positive control primer-probe MIX used as a control), as well as primer F12, primer R11, and probe. Each PCR tube contains all the components of the above-mentioned field testing reagent for a single detection volume (50 μL amplification reaction system), prepared as one dry powder reagent and one buffer microsphere, packaged in a tube as the detection reagent tube; wherein, in the 50 μL amplification reaction system, primer F12 is 20 pmol, primer R11 is 20 pmol, and probe is 6 pmol. The digital isothermal detector used was purchased from: Anpu Future Biotechnology Co., Ltd., catalog number: WL-PS-8C.
[0111] 2. Add 500 μL of DNA lysis buffer (the DNA lysis buffer is rapid nucleic acid release agent (DNA type)-II, purchased from Anpu Future Biotechnology Co., Ltd., product number: WLD8201-ES) to a 1.5 mL centrifuge tube as tube 1; add 450 μL of sterile water to a 1.5 mL centrifuge tube as tube 2.
[0112] (II) Nucleic Acid Extraction
[0113] 1. Take the 3rd-4th leaf from the bottom of the corn plant, and place 2-3 small pieces of leaf, each 1cm x 1cm, about 15-20cm from the tip of the leaf, into tube 1.
[0114] 2. Grind and crush the sample with a grinding rod for 1 minute. After crushing, mix the sample and let it stand at room temperature for 10 minutes to lyse the sample and obtain the lysate.
[0115] (III) Amplification Detection
[0116] 1. Using a 50 μL pipette, pipette 50 μL of the lysis product into tube 2, cap the tube, and mix manually (this dilutes the lysis product 10 times).
[0117] 2. Open the test reagent tube cap, use a 50μL quantitative pipette to draw 50μL of diluted lysis product and add it to the test reagent tube.
[0118] 3. Cover the tube and immediately invert it 8-10 times to mix. After mixing, shake the liquid to the bottom of the tube to obtain the reaction tube.
[0119] 4. Open the top cover of the digital constant temperature detector, place the reaction tube into the instrument, close the top cover tightly, press the heating button (constant temperature 40℃), and press the run button to start.
[0120] 5. After 4 minutes of amplification, the instrument will emit a "beep" sound. At this time, open the instrument cover, take out the reaction tube, and mix it by inverting it 8-10 times. Swish the liquid to the bottom of the tube, put it back into the digital constant temperature detector in the original order, and close the cover tightly.
[0121] 6. After continuing amplification for 16 minutes, the program ends, and the instrument displays the corresponding values for each well.
[0122] (iv) Result Interpretation
[0123] Preliminary test results indicate that false positives can occur because the detection instrument uses fluorescent dyes to detect pathogens, resulting in negative values of 0-2. Based on previous test results and the amount of reaction template added, the minimum detection value is 3. To ensure accuracy and avoid false positives, 0-3 is defined as negative, and 4-99 as positive.
[0124] Therefore, the result interpretation method is as follows: If the instrument displays a value between 00 and 03, the result is negative, indicating that the sample does not contain nucleic acid of *Rhizoctonia solani*, the pathogen of southern rust of corn, or the content is below the detection limit. If the instrument displays a value between 04 and 99, the result is positive, indicating that the sample contains nucleic acid of *Rhizoctonia solani*, the pathogen of southern rust of corn. 2.5 Field sample testing in Xinxiang, Henan Province
[0125] 2.5.1 Continuous monitoring of disease-free fields
[0126] The method established in section 2.4 was used to test field samples from the experimental plots. All monitoring plots had the same maize growth stage, specifically the tasseling stage. Random sampling and photographic recording were conducted daily at five different experimental plots. Monitoring results ( Figure 11 The results indicate that since the first detection of the pathogen of southern rust of maize, *Russula multidus*, on August 28, 2024, the detected value has been gradually increasing over time, and diseased maize leaves were observed in the field on the seventh day after the detection of *Russula multidus* (September 4, 2024).
[0127] Figure 11 In the experiment, plots ①1, ②2, ③3, ④4, and ⑤5 were in the incubation period on or before August 27, 2024. No disease spots appeared on the corn leaves in the field, and all the leaves were healthy. Figure 11B in the experiment refers to ① Experimental site 1, ② Experimental site 2, ③ Experimental site 3, ④ Experimental site 4, and ⑤ Experimental site 5. On August 28, 2024, the initial infection period was observed. No lesions appeared on the corn leaves in the field, but the instrument began to detect the values. Figure 11 In the experimental field, the first diseased leaves appeared in the C variety (September 4, 2024), with spore masses observed on the corn leaves. Figure 11 D in the table represents the test results. Before August 27, 2024, the corn was not diseased and no disease was detected. On August 28, the corn was not diseased and the first test result was obtained. As time went on, the test result value became larger and larger. On September 4, the first spore masses appeared and the corn in the field officially developed the disease. This shows that the kit can detect the pathogen of southern rust of corn about 7 days before the symptoms appear.
[0128] 2.5.2 Incidence rate survey in the monitoring area
[0129] Three plots were set up in the field, each plot measuring 7m*10m, and the susceptible maize variety Zhengdan 958 was planted. Three treatments were set up: (1) control plot: no pesticide treatment was applied; (2) early prevention plot: the plot was treated immediately after rust disease was detected; (3) conventional prevention plot: the plot was treated after the leaves began to show symptoms.
[0130] When the pathogen of southern rust in maize was first detected, the early control plots were treated. One week later, when diseased maize leaves were clearly visible in the field, the conventional control plots were then treated (the early control and conventional control plots used the same pesticide and dosage, and were applied using the conventional method). After treatment, a five-point sampling method was used to investigate the incidence rate. The results of the incidence rate survey in the experimental fields (Table 5) show that on September 21, September 28, and October 4, 2024, the incidence rates in the plots where the pathogen of southern rust was detected and treated immediately (i.e., early control plots) were 19%, 20.2%, and 22%, respectively; in the plots where treatment began after leaf symptoms appeared (i.e., conventional control plots), the incidence rates were 27.7%, 31.6%, and 34%, respectively; and in the untreated plots (i.e., control plots), the incidence rates were 28.2%, 34.4%, and 41.1%, respectively. The survey results show that the optimized detection method in this embodiment can detect the pathogen of southern rust in corn before leaf symptoms appear, and early guidance for prevention and control can reduce the incidence of southern rust in corn.
[0131] Table 5. Results of the incidence rate survey at different drug application periods.
[0132] Investigation time Comparison of community incidence rates Preventing the spread of disease in communities Routine prevention and control of community incidence rate September 21 28.2% 19% 27.7% September 28 34.4% 20.2% 31.6% October 4 41.1% 22% 34%
Claims
1. A primer and probe set for detecting southern rust in maize, characterized in that, The device includes an upstream primer F12, a downstream primer R11, and a probe. The nucleotide sequence of the upstream primer F12 is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer R11 is shown in SEQ ID NO.
6. The nucleotide sequence of the probe is shown in SEQ ID NO.10, wherein the 31st base T is modified with a FAM fluorescent group, a tetrahydrofuran (THF) is introduced between the 32nd base G and the 33rd base T as a debasement site, the 33rd base T is modified with a BHQ1 quencher group, and the 3' end is blocked with a C3 spacer.
2. A detection kit for southern rust disease in maize, characterized in that, It includes the primer and probe set and DNA isothermal rapid amplification reagent as described in claim 1.
3. A rapid field detection kit for southern rust of maize, characterized in that, Includes the maize southern rust detection kit and DNA lysis buffer as described in claim 2.
4. The reagent kit according to claim 3, characterized in that, The maize southern rust detection kit contains all the components of the DNA isothermal rapid amplification kit: buffer A, buffer B, lyophilized powder reagent, and a positive control template and positive control primer probe MIX used as controls, as well as the primer probe set as described in claim 1; the DNA isothermal rapid amplification kit is a fluorescent DNA isothermal rapid amplification kit, purchased from Anpu Future Biotechnology Co., Ltd., catalog number: WLE8202KIT.
5. The reagent kit according to claim 4, characterized in that, All components of the maize southern rust detection kit are prepared into a dry powder reagent and a buffer microsphere in a PCR tube according to the amount of 50 μL amplification reaction system for one detection, which is used as the detection reagent tube; in the detection reagent tube, the upstream primer F12 is 20 pmol, the downstream primer R11 is 20 pmol, and the probe is 6 pmol; the maize southern rust detection kit contains several detection reagent tubes.
6. The reagent kit according to claim 3, characterized in that, The DNA lysis buffer is a rapid nucleic acid release agent of DNA type II, purchased from Anpu Future Biotechnology Co., Ltd., catalog number: WLD8201-ES.
7. A rapid field detection method for early detection of southern rust in maize, characterized in that, Includes the following steps: S1. Take 2-3 small leaf pieces (1 cm x 1 cm) from the lower part of the leaf of the corn plant to be tested, 15-20 cm from the leaf tip, and place them in tube 1. Grind the sample with a grinding rod for 1 min, mix well, and let it stand at room temperature for 10 min to lyse and obtain the lysate. Tube 1 is a 1.5 mL centrifuge tube containing 500 μL of DNA lysis buffer. S2. Using a 50 μL quantitative pipette, take 50 μL of the lysis product and add it to tube 2. Mix well to dilute. Using a 50 μL quantitative pipette, take 50 μL of the diluted lysis product and add it to the test reagent tube as described in claim 5. Mix well and then shake the liquid to the bottom of the tube to obtain a reaction tube. Tube 2 is a 1.5 mL centrifuge tube containing 450 μL of sterile water. S3. Place the reaction tube into the digital constant temperature detector, set the temperature to a constant 40℃, start the operation, amplify for 4 minutes, the instrument will emit a "beep" prompt, at this time take out the reaction tube, mix well, shake the liquid to the bottom of the tube, put it back into the digital constant temperature detector to continue amplification for 16 minutes, the program ends, the instrument displays the corresponding value of the well position. S4. Interpret the results based on the instrument display values: If the instrument display value is between 00 and 03, the result is negative, indicating that the sample does not contain the nucleic acid of *Rhizoctonia solani*, the pathogen of southern rust of corn; if the instrument display value is between 04 and 99, the result is positive, indicating that the sample contains the nucleic acid of *Rhizoctonia solani*, the pathogen of southern rust of corn.
8. The detection method according to claim 7, characterized in that, The DNA lysis buffer is a rapid nucleic acid release agent of DNA type II, purchased from Anpu Future Biotechnology Co., Ltd., catalog number: WLD8201-ES.
9. The detection method according to claim 7, characterized in that, The digital constant temperature detector was purchased from Anpu Future Biotechnology Co., Ltd., item number: WL-PS-8C.
10. The application of the maize southern rust detection primer and probe set according to claim 1, the maize southern rust detection kit according to claim 2, or the maize southern rust field early rapid detection kit according to any one of claims 3-6 in the detection and control of maize southern rust.