Beta-glycosidase derived from gelsemium evergreen and application of mutant of beta-glycosidase

Abstract

According to the invention, beta-glycosidase which has a catalytic effect on vincoside, loganin and strictosamide is selected, and a foundation is laid for diversity and possibility of an aglycone production process. By researching the three-dimensional structure information of the Gelsemium elegans Beta-glycosidase, a zymoprotein structure information basis is provided for molecular modification of the Gelsemium elegans Beta-glycosidase, enzyme variants capable of improving substrate selectivity, thermal stability and catalytic efficiency are obtained more efficiently, and the requirements of industrial application are met; the invention provides a truncated mutant enzyme with improved enzymatic activity, and through induced expression and activity screening, it is found that the enzyme activity of the obtained mutant enzyme to loganin and strictosamide is about two times higher than that of a wild enzyme.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of enzyme engineering, and particularly relates to application of a beta-glucosidase derived from evergreen hooking-wine and mutants thereof. The present application also provides other genes, vectors and host cells that can be used for production. BACKGROUND

[0002] Beta-glucosidase (beta-D-glucosidase, EC 3.2.1.21), also known as beta-D-glucoside hydrolase, belongs to the cellulase class and is an important component of the cellulose-degrading enzyme system. It can hydrolyze the beta-D-glucose bond bound to the non-reducing end and release beta-D-glucose and the corresponding ligand. At present, beta-glucosidase has been widely used in the technical fields of improving fruit juice flavor, enhancing the aroma of fruit wine and tea, producing active aglycone of soybean isoflavone, and cellulose degradation. However, there are still very limited beta-glucosidases with high transglycosylation activity and substrate versatility. Therefore, there is an urgent need to develop more new beta-glucosidases with industrial enzyme properties.

[0003] Due to the limited production process, the aglycone compounds (such as loganin aglycone) with poor water solubility and high separation difficulty are greatly restricted in pharmacological research and application development. The traditional acid / base hydrolysis method cannot efficiently prepare such aglycones (such as the ester group structure of loganin aglycone is easily degraded under extreme conditions), and the beta-glucosidase catalysis method has the advantages of mild reaction conditions, single product, and easy purification. For example, loganin aglycone, isofraxidin aglycone, and vinca alkaloid lactam aglycone can be used in the fields of multidrug-resistant gram-negative bacterial infection, liver injury treatment, anti-inflammatory, and anti-tumor, but their efficient production depends on the discovery and modification of beta-glucosidase.

[0004] The present application aims to discover new plant-derived beta-glucosidases and use them to catalyze the synthesis of various aglycones, thereby laying a foundation for the diversity and possibility of aglycone production process. The present application modifies the beta-glucosidases, and the truncated mutants thereof can further improve the production efficiency. SUMMARY

[0005] The purpose of the present application is to solve the problems of the prior art and provide application of beta-glucosidase derived from evergreen hooking-wine and mutants thereof.

[0006] The technical method adopted by the present application is as follows: In a first aspect, the present application provides application of evergreen hooking-wine beta-glucosidase GsSGD in catalyzing hydrolysis of glycosides, wherein the amino acid sequence of the evergreen hooking-wine beta-glucosidase GsSGD is shown in SEQ ID No. 1, and the glycosides are isofraxidin, loganin, or vinca alkaloid lactam.

[0007] In a second aspect, the present application provides a beta-glucosidase truncated mutant enzyme of evergreen kopsia , characterized in that the beta-glucosidase truncated mutant enzyme of evergreen kopsia is obtained by modifying the enzyme of the beta-glucosidase GsSGD of evergreen kopsia by truncating the intrinsic disordered region, and the amino acid sequence of the beta-glucosidase truncated mutant enzyme of evergreen kopsia is shown as SEQ ID NO. 3.

[0008] In a third aspect, the present application provides a gene encoding the truncated mutant enzyme , and the nucleotide sequence of the gene is shown as SEQ ID NO. 4.

[0009] In a fourth aspect, the present application provides a recombinant vector carrying the gene.

[0010] In a fifth aspect, the present application provides a recombinant cell containing the recombinant vector or containing the gene, and the beta-glucosidase truncated mutant enzyme of evergreen kopsia can be expressed.

[0011] In a sixth aspect, the present application provides an engineering strain carrying the recombinant vector, and the engineering strain is a recombinant Escherichia coli Rosetta (DE3) strain.

[0012] In a seventh aspect, the present application provides a method for producing the beta-glucosidase truncated mutant enzyme of evergreen kopsia by fermentation using the recombinant cell.

[0013] In an eighth aspect, the present application provides the use of the beta-glucosidase truncated mutant enzyme of evergreen kopsia for catalyzing the hydrolysis of the beta-D-glucoside bond at the non-reducing end of a glycoside compound to generate the corresponding aglycone.

[0014] Further, the glycoside compound is strychnoside or isovincadine lactam.

[0015] In a ninth aspect, the present application provides a method for hydrolyzing a glycoside compound, which comprises the step of reacting the glycoside compound with the beta-glucosidase truncated mutant enzyme of evergreen kopsia under conditions capable of hydrolyzing the beta-D-glucoside bond at the non-reducing end of the compound by the enzymatic catalysis of the beta-glucosidase truncated mutant enzyme of evergreen kopsia , and the reaction is carried out at pH 5-6 and temperature 30-40℃. Advantages

[0016] (1) The beta-glycosidase screened by the application has catalytic effect on gypsogenin, loganin and vinka lactam, which lays a foundation for the diversity and possibility of aglycone production process; (2) The application provides the three-dimensional structure information of the beta-glycosidase of the evergreen gelsemium, which provides the enzyme protein structure information basis for the molecular modification of the enzyme, so that the enzyme mutant with improved catalytic efficiency can be obtained more efficiently, and the requirements of industrial application are met; (3) The application provides a truncated mutant enzyme with improved enzyme activity Through induced expression and activity screening, the mutant enzyme obtained has enzyme activity about 2 times higher than that of the wild-type enzyme on loganin and vinka lactam. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1A is the SDS-PAGE electrophoresis diagram of GsSGD after purification; Figure 1B is the molecular sieve sample out peak diagram of GsSGD after purification; Figure 2 is the liquid chromatography detection diagram of the reaction of generating gypsogenin aglycone catalyzed by GsSGD; Figure 3A is the mass spectrometry detection catalytic peak diagram of the reaction of generating gypsogenin aglycone catalyzed by GsSGD; Figure 3B is the ion flow diagram of the mass spectrometry detection of the reaction of generating gypsogenin aglycone catalyzed by GsSGD; Figure 4A is the homologous octamer crystal structure diagram of GsSGD; Figure 4B is the monomer crystal structure diagram of GsSGD; Figure 5 is the relative enzyme activity comparison diagram of GsSGD and the truncated mutant enzyme on loganin and vinka lactam. DETAILED DESCRIPTION

[0018] The application will be described in detail below in combination with the drawings and specific examples. It should be understood that these examples are only used to illustrate the application and are not used to limit the scope of the application. In addition, it should be understood that after reading the content taught by the application, those skilled in the art can make various modifications or modifications to the application, and these equivalent forms also fall within the scope defined by the claims of the present application. Based on the examples in the application, all other examples obtained by those of ordinary skill in the art without creative labor fall within the scope of the application.

[0019] Example 1, obtaining of beta-glycosidase nucleotide GsSGD sequence and its amino acid sequence and protein expression and purification.

[0020] The β-glucosidase gene sequence of evergreen gelsemium published on NCBI (GenBank: MF401946.1) was obtained and directly synthesized on a intermediate vector. The intermediate vector plasmid was used as a template for PCR amplification using forward and reverse primers (see Table 1) to obtain the gene sequence of β-glucosidase (GluA) as shown in SEQ ID NO. 2. The obtained gene sequence was translated by DNA sequence to obtain the amino acid sequence of β-glucosidase as shown in SEQ ID NO. 1. GsSGD

[0021] The PCR amplification system and conditions are as follows: 50 μL of PCR amplification system includes 1 μL of cDNA, 25 μL of 2x PrimeSTAR Max DNA Polymerase, 1 μL of primer (10 μmol / L), and 22 μL of sterilized ultrapure water. The PCR reaction conditions are as follows: 98℃ pre-denaturation for 5 minutes; 98℃ denaturation for 30 seconds, 56℃ annealing for 30 seconds, 72℃ extension for 2 minutes, 35 cycles; finally 72℃ extension for 10 minutes.

[0022] Table 1 β-glucosidase sequence synthesis primers

[0023] The above obtained PCR products were respectively connected with the vector pCold I , and the double enzyme digestion sites were Nde I and Xho I. The ligation product was directly transformed into E. coli Top10 for plasmid amplification. The correct plasmid was confirmed by DNA sequencing of the plasmid. The recombinant plasmid was transformed into E. coli Rosetta (DE3) competent cells, and the obtained transformants were cloned and transferred into an appropriate amount of LB medium (amoxicillin was added to a final concentration of 50 μg / mL), and cultured at 37℃ until the absorbance at 600 nm was 0.8. Inducer isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.02%, and induced at 16℃ for 18 h. The expression conditions were as follows: 16℃, 12-18 h of shaking culture. The bacterial liquid after induction and expression was centrifuged at 16℃, 5,000 rpm, 10 min, and the bacteria were collected for purification.

[0024] ​The centrifugally collected expression bacteria were suspended with an appropriate amount of buffer (20 mM Tris, 500 mM NaCl, 10% glycerol, 20 mM imidazole, pH 8.0), and the bacterial bodies were lysed using a low-temperature ultrahigh-pressure cell crusher. The precipitate and other particulate impurities were removed by high-speed centrifugation at 12,000 rpm for 1 h. After the supernatant after centrifugation was combined with the Ni-NTA affinity medium, column equilibration was performed using twice the enzyme volume of a 20 mM Tris, 500 mM NaCl, 10% glycerol, 20 mM imidazole, pH 8.0 solution. Then, twice the enzyme volume of a 20 mM Tris, 500 mM NaCl, 10% glycerol, 300 mM imidazole, pH 8.0 solution and a 20 mM Tris, 500 mM NaCl, 10% glycerol, 500 mM imidazole, pH 8.0 solution were used to elute the target protein. Subsequently, SDS-PAGE detection was performed on each component.

[0025] The protein obtained by the purification in the previous step was concentrated using an ultrafiltration tube in a low-temperature centrifuge at 4,000 rpm at 4°C, and the total volume of the protein was concentrated to less than 5 mL. A certain volume of a 20 mM Tris, 500 mM NaCl, 10% glycerol, pH 8.0 solution was then added to reduce the imidazole concentration in the sample, and the total protein volume after replacement was 4-5 mL. The concentrated and replaced protein sample was centrifuged at 12,000 rpm at 4°C for 10 min to remove the precipitate and other particulate impurities. After the protein sample was combined with the Ni-NTA affinity medium, the sample was purified using an automatic protein purification instrument. A 20 mM Tris, 500 mM NaCl, 10% glycerol, pH 8.0 solution was used as the initial buffer, and a 500 mM imidazole, 20 mM Tris, 500 mM NaCl, 10% glycerol, pH 8.0 solution was used as the eluent for gradient elution. The eluted protein sample was collected and verified by SDS-PAGE.

[0026] According to the SDS-PAGE results, the purified protein was concentrated using 30 kDa ultrafiltration tube in 4,000 rpm centrifuge at 4°C. Further, the imidazole and glycerol concentration in the protein from the previous step was diluted using 20 mM Tris, 500 mM NaCl solution, and the concentrated was replaced to less than 2 mL of total protein volume. The protein sample less than 2 mL was centrifuged at 12,000 rpm for 10 min at 4°C to remove the precipitate and other particulate impurities. The concentrated protein solution was further purified by gel filtration chromatography using 20 mM Tris, 500 mM NaCl as the buffer. Each protein peak eluted was collected and verified by SDS-PAGE. The desired pure protein was concentrated and replaced with 20 mM Tris, 250 mM NaCl solution to reduce the salt concentration in the total protein, and the final GsSGD protein was stored at -80°C (see Figure 1).

[0027] Example 2, Application of the above-obtained β-glycosidase to hydrolyze the gypsoside to produce gypsoside aglycone.

[0028] The reaction system included 95 μΐ of the purified GsSGD protein dissolved in PBS buffer, and 0.2, 0.5, 1, 2, 4, 5 mM gypsoside was added to a final concentration, and 100 μΐ was added. After 10 minutes of reaction at 37°C, an equal volume of methanol was added to terminate the reaction, and product HPLC analysis was performed.

[0029] The test results are shown in Figures Figure 2 , 3, and it was found that GsSGD could react with gypsoside to produce gypsoside aglycone by HPLC detection of enzyme activity.

[0030] Example 3, Crystallization of β-glycosidase GsSGD.

[0031] The purified β-glycosidase GsSGD expressed by the above method was concentrated to a concentration of about 15-30 mg / ml, and a crystallization kit (Crystal Screen Kit I / II, Index, Salt, PEG / Ion, etc. from Hampton Research and other companies) was used as the initial screening condition for crystal growth. The sitting drop vapor diffusion method was used for crystallization. The present application obtained initial crystals under multiple different crystallization reagent conditions. Through later optimization and adjustment, a buffer solution of 0.17 M Potassium nitrate, 16% w / v PEG 3350 was selected as the crystal growth condition, and the crystals were crystallized at a temperature of 4°C. A set of X-ray diffraction data with a resolution of 3.055 Å was collected.

[0032] Example 4, Collection and structure analysis of β-glycosidase GsSGD.

[0033] The prepared crystal was treated with 20% glycerol as antifreeze and stored in liquid nitrogen. The crystal X-ray diffraction data collection was carried out at the Shanghai Synchrotron Radiation Facility (SSRF) macromolecular crystallography beamline station (BL18U). The data processing used HKL-3000, the structure was analyzed by using the structure of raucumficine β-D-glucosidase (PDB: 3ZJ6) as a template, and the molecular replacement method was used, and the Refmac program was used for further modification with the aid of Coot software. Finally, the crystal structure of the β-glycosidase GsSGD protein was obtained.

[0034] The crystal structure of the β-glycosidase GsSGD is a homologous octamer with a space group of C121; the cell parameters are: a = 237.43 Å, b = 107.84 Å, c = 220.27 Å, α = γ = 90°, β = 118.455°.

[0035] Specifically, alpha helix 1, the amino acid segment containing Arg17-Asp19, beta sheet 1, the amino acid segment containing Val25-Ala29, alpha helix 2, the amino acid segment containing Ala32-Ile35, alpha helix 3, the amino acid segment containing Ile48-Arg55, alpha helix 4, the amino acid segment containing Pro57-Met59, alpha helix 5, the amino acid segment containing Ser72-Leu86, beta sheet 2, the amino acid segment containing Ala90-Ser94, alpha helix 6, the amino acid segment containing Trp97-Ile100, alpha helix 7, the amino acid segment containing Lys112-Ser128, beta sheet 3, the amino acid segment containing Gln131-Thr135, alpha helix 8, the amino acid segment containing Gln143-Tyr149, alpha helix 9, the amino acid segment containing Pro155-Arg175, beta sheet 4, the amino acid segment containing Asn178-Ile180, alpha helix 10, the amino acid segment containing Pro185-Ala195, alpha helix 11, the amino acid segment containing Glu236-Gln263, beta sheet 5, the amino acid segment containing Gln266-Ala273, beta sheet 6, the amino acid segment containing Trp275-Pro278, alpha helix 12, the amino acid segment containing Asp284-Ser307, alpha helix 13, the amino acid segment containing Glu312-Val318, alpha helix 14, the amino acid segment containing Ala327-Leu333, beta sheet 7, the amino acid segment containing Leu340-Asn343, beta sheet 8, the amino acid segment containing Ala347-Ser352, alpha helix 15, the amino acid segment containing Tyr363-Thr367, beta sheet 9, the amino acid segment containing Val369-His372, alpha helix 16, the amino acid segment containing Pro393-Tyr407, beta sheet 10, the amino acid segment containing Leu411-Ile414, alpha helix 17, the amino acid segment containing Leu429-Arg433, alpha helix 18, the amino acid segment containing Pro436-Asp455, beta sheet 11, the amino acid segment containing Gly461-Val464, beta sheet 12, the amino acid segment containing Ile484-Asn487, beta sheet 13, the amino acid segment containing Tyr492-Pro496, alpha helix 19, the amino acid segment containing Asp498-Phe507.

[0036] As shown in Figure 4, the GsSGD crystal structure is composed of 13 beta sheets and 19 alpha helices, with the core catalytic domain exhibiting a highly conserved barrel fold feature.

[0037] Table 2 GsSGD crystal statistics table GsSGD Wavelength (A) 0.9786 Space group C 1 2 1 Cell parameters a, b, c (A) 237.43, 107.84, 220.27 α, β, γ (°) 90, 118.455, 90 Resolution (A) 48.991 - 2.950 (3.055 - 2.950 a )]]> Rmerge (%) 21.25 (51.86) CC 1 / 2 (%)]] 96.1 (72.6) I / σI 6.25 (3.14) Completeness (%) 95.80 (99.68) Refrinement No. reflections (overall) 98,836 No. reflections (test set) 10,202 [R work / R free (%)]]> 19.96 / 24.90 No. of atoms Protein 29,334 Solvent 0 RMS deviations Bond lengths (A) 0.012 Bond angles (°) 1.18 Ramachandran plot % residues Favored region 93.84 Allowed region 5.81 Outlier region 0.35 Example 5, Production and application of β-glycosidase GsSGD truncated mutant.

[0038] GsSGD Truncated mutant gene cloning: the present application GsSGD The truncated mutant gene is derived from the β-glycosidase gene sequence (GenBank: MF401946.1) published by NCBI. Forward primers F1 and F2, and reverse primers R1 and R2 are designed according to SEQ ID NO. 2 for PCR amplification. The amplification method is as follows: PCR amplification is carried out using forward primer F1 and reverse primer R1, and forward primer F2 and reverse primer R2, respectively, to obtain PCR fragments P1 and P2, respectively. The PCR amplification system and conditions are as follows: 10 μL of the PCR amplification system includes 0.2 μL cDNA, 5 μL 2×PrimeSTAR Max DNA Polymerase, 0.2 μL primer (10 μmol / L), and 4.4 μL sterile ultrapure water. The PCR reaction conditions are as follows: 98℃ pre-denaturation for 5 minutes; 98℃ denaturation for 30 seconds, 56℃ annealing for 30 seconds, 72℃ extension for 1 minute, 35 cycles; finally 72℃ extension for 10 minutes.

[0039] The PCR fragments P1 and P2 are mixed and diluted with ddH2O, and the diluted 10-fold solution is used as a cDNA template. The diluted cDNA template is used for PCR amplification with forward primer F1 and reverse primer R2 to obtain the gene sequence of the truncated mutant enzyme , as shown in SEQ ID NO. 4. The gene sequence is translated by DNA sequence to obtain the amino acid sequence of the truncated mutant enzyme , as shown in SEQ ID NO. 3. The PCR amplification system and conditions are as follows: 50 μL of the PCR amplification system includes 1 μL cDNA, 25 μL 2×PrimeSTAR Max DNA Polymerase, 1 μL primer (10 μmol / L), and 22 μL sterile ultrapure water. The PCR reaction conditions are as follows: 98℃ pre-denaturation for 5 minutes; 98℃ denaturation for 30 seconds, 56℃ annealing for 30 seconds, 72℃ extension for 2 minutes, 35 cycles; finally 72℃ extension for 10 minutes.

[0040] The above obtained PCR products are respectively connected with the vector pCold-TF , and the double enzyme digestion sites are Bam HI and Hin dIII). The ligation product is directly transformed into E. coli Top10 for plasmid amplification. The correct plasmid is confirmed by DNA sequencing of the plasmid.

[0041] Table 3 Truncated mutant enzymes Sequence synthesis primers

[0042] The recombinant plasmid was transformed into E. coli Rosetta (DE3) competent cells, and the obtained transformants were cloned and inoculated into an appropriate amount of LB medium (amoxicillin was added to a final concentration of 50 μg / mL), which was cultured at 37°C until the absorbance at 600 nm was 0.8, and then isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.02%, and the induction was carried out at 16°C for 18 h. The bacteria were collected by centrifugation at 5,000 rpm / min for 10 min, and then the bacteria were resuspended with buffer (20 mM PBS, pH 6.0) at a ratio of bacteria:buffer = 1 (g):10 (mL). After resuspension, the bacteria were lysed by ultrasonic fragmentation, and the fragmentation program was as follows: amplitude 60%, 15 min. The resuspended bacteria were placed on a tray coated with ice blocks. After fragmentation, the precipitate and other particulate impurities were removed by low-temperature centrifugation at 12,000 rpm / min for 40 min. After centrifugation, the supernatant was combined with Ni-NTA affinity medium, and then the medium was washed with 100 mM phosphate buffer containing 500 mM sodium chloride and 20 mM imidazole to remove impure proteins. Finally, the target protein was eluted from the affinity medium with 100 mM phosphate buffer containing 500 mM sodium chloride and 250 mM imidazole, and the eluted proteins were collected and detected by SDS-PAGE.

[0043] Example 6, Application of the truncated mutant enzyme obtained above to hydrolyze isorosindonine lactam. Application of the hydrolysis of loganin to obtain the application of loganic acid.

[0044] The reaction system was as follows: 95 μL of purified truncated mutant enzyme dissolved in PBS buffer , 1 mM of loganin was added to a final concentration, and the volume was made up to 100 μL. After 10 min of reaction at 37°C, the reaction was terminated by adding an equal volume of methanol, and the product was analyzed by HPLC.

[0045] Test results: as shown in Figure 5 , the enzyme activity detected by HPLC showed that the truncated mutant enzyme could react with loganin to generate loganic acid, and the relative activity of the truncated mutant enzyme catalyzing loganin was about 2 times higher than that of GsSGD.

[0046] Example 7, Application of the truncated mutant enzyme obtained above to hydrolyze isorosindonine lactam. Application of the hydrolysis of loganin to obtain the application of loganic acid.

[0047] The reaction system was as follows: 95 μL of purified truncated mutant enzyme dissolved in PBS buffer , 1 mM final concentration of homolignan lactam was added, and 100 μL was added. After 10 minutes of reaction at 37°C, an equal volume of methanol was added to terminate the reaction, and product HPLC analysis was performed.

[0048] Test results: as shown in Figure 5 , the truncated mutant enzyme could hydrolyze homolignan lactam, and the relative activity of the truncated mutant enzyme catalyzing homolignan lactam was about 2 times higher than that of GsSGD.

[0049] The above only describes the preferred embodiments of the present application, and it should be noted that for those skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.

[0050] Sequence Listing SEQ ID NO. 1 MATPSSTIVPDATKINRRDFPSDFVFGAASSAYQIEGGASEGGRGPSIWDTFTKRRPEMVKGGSNGNVAIDSYHLYKEDVKILKNLGLDAYRFSISWSRILPGGNLSGGINKEGIDFYNNFIDELIASGIQPYVTLFHWDVPQALEDEYGGFLSPKIVDDFRDYAELCFWNFGDRVKNWITLNEPWTFSVDGYVAGTFAPGRGATPTDQVKGPIKRHRCSGWGPQCSNSDGNPGTEPYLVTHHQILAHAAAVESYRNKFKASQEGQIGITIVAQWMEPLNEKSDSDVQAAKRALDFMYGWFMEPITSGDYPEIMKKIVGSRLPKFSAEQSRKLKGSYDFLGLNYYTANYVTSAPNPTGGIVSYDTDTQVTYHSDRNGKLIGPLAGSEWLHIYPEGIRKLLVYTKKTYNVPLIYITENGVDELNDTSLTLSEARVDPIRIKFIQDHLLQLRLAIDDGVNVKGYFVWSLLDNFEWNEGFTVRFGMIHVNYNDQYARYPKDSAIWLMNNFHKKFSGPPVKRSVEENQETDSRKRSRK SEQ ID NO. 2 SEQ ID NO. 3 MATPSSTIVPDATKINRRDFPSDFVFGAASSAYQIEGGASEGGRGPSIWDTFTKRRPEMVKGGSNGNVAIDSYHLYKEDVKILKNLGLDAYRFSISWSRILPGGNLSGGINKEGIDFYNNFIDELIASGIQPYVTLFHWDVPQALEDEYGGFLSPKIVDDFRDYAELCFWNFGDRVKNWITLNEPWTFSVDGYVAGTFAPGRGGKGDEGDPGTEPYLVTHHQILAHAAAVESYRNKFKASQEGQIGITIVAQWMEPLNEKSDSDVQAAKRALDFMYGWFMEPITSGDYPEIMKKIVGSRLPKFSAEQSRKLKGSYDFLGLNYYTANYVTSAPNPTGGIVSYDTDTQVTYHSDRNGKLIGPLAGSEWLHIYPEGIRKLLVYTKKTYNVPLIYITENGVDELNDTSLTLSEARVDPIRIKFIQDHLLQLRLAIDDGVNVKGYFVWSLLDNFEWNEGFTVRFGMIHVNYNDQYARYPKDSAIWLMNNFHKKFSGPPVKRSVEENQETDSRKRSRK SEQ ID NO. 4 SEQ ID NO. 5 CGAAGGTAGGCATATGGCAACTCCAAGCAGTAC SEQ ID NO. 6 TTCGGATCCCTCGAGCTACTTCCGGGACCTTTTCC SEQ ID NO. 7 ATGGCAACTCCAAGCAGTACCATC SEQ ID NO. 8 GTCGAGGTGGTAAAGGTGATGAAGGCGACCCAGGC SEQ ID NO. 9 GCCTGGGTCGCCTTCATCACCTTTACCACCTCGAC SEQ ID NO. 10 CTACTTCCGGGACCTTTTCCTTGAG

Claims

1. The use of evergreen kounoudra β-glucosidase GsSGD in catalyzing the hydrolysis of glycosides, characterized in that, The amino acid sequence of the evergreen Kopsia beta-glucosidase GsSGD is shown as SEQ ID No. 1, and the glycoside compound is secologanin, loganin or iso-loganic lactam.

2. A beta-glucosidase truncated mutant enzyme of Aspidosperma quebracho-bolldes with improved enzyme activity characterized in that, The evergreen kounounia beta-glucosidase truncated mutant enzyme The evergreen kounounia beta-glucosidase truncated mutant enzyme obtained by modifying the enzyme by truncating the intrinsic disordered region of the evergreen kounounia beta-glucosidase GsSGD according to claim 1 The amino acid sequence of the evergreen kounounia beta-glucosidase truncated mutant enzyme is shown as SEQ ID NO.

3.

3. A truncated mutant enzyme of *Gelsemium elegans* β-glucosidase with enhanced activity as described in claim 2. The gene is characterized by, The nucleotide sequence of the gene is shown as SEQ ID No.

4.

4. A recombinant vector carrying the gene of claim 3.

5. A recombinant cell, characterized in that, The evergreen Campsis β-glucosidase truncated mutant enzyme expressed by the recombinant vector of claim 4 or the gene of claim 3 .

6. An engineered bacterial strain, characterized in that, The engineering strain is a recombinant Escherichia coli Rosetta (DE3) strain carrying the recombinant vector of claim 4.

7. A method of producing the truncated mutant enzyme of the β-glucosidase of Asclepiadon sinense with improved enzymatic activity according to claim 2, characterized by, The recombinant cell of claim 6 is used for fermentation to produce enzymes. ​ 8. The enzyme activity-enhanced beta-glucosidase truncated mutant enzyme of Aspidosperma quebracho-bolldvii described in claim 2. The use of a beta-D-glucosidase for catalyzing the hydrolysis of a non-reducing end of a glycoside compound to generate a corresponding aglycone.

9. Use according to claim 7, characterized in that, The glycoside compound is loganin or iso-loganic lactam.

10. A method of hydrolyzing a glycoside compound, comprising: The method comprises contacting a glycoside compound with the enzyme activity-enhanced Aspidosperma quebracho-bolivianum β-glucosidase truncated mutant enzyme of claim 2 carried out in conditions enabling hydrolysis of the β-D-glucosidic bond at the non-reducing end of the compound by the enzymatic catalysis of the Aspidosperma quebracho-bolivianum β-glucosidase truncated mutant enzyme , said reaction being carried out at pH 5-6, at a temperature of 30-40°C.

Images