Phosphoenolpyruvate carboxylase mutant and application thereof

Abstract

The invention relates to a phosphoenolpyruvate carboxylase mutant and application thereof, in particular to the phosphoenolpyruvate carboxylase mutant, compared with an amino acid sequence of wild phosphoenolpyruvate carboxylase protein as shown in SEQ ID NO: 1, the phosphoenolpyruvate carboxylase mutant has R528H and S828P substitutions, and the amino acid sequence of the phosphoenolpyruvate carboxylase mutant is shown in SEQ ID NO: 1. And the activity of phosphoenolpyruvate carboxylase is reduced. By mutating phosphoenolpyruvate carboxylase, the protein expression activity of phosphoenolpyruvate carboxylase is reduced, bypass pathway competition is weakened, and pyruvic acid precursor supply is enhanced, so that the production capacity and biomass of valine engineering strains are further improved. Through fermentation verification, compared with an initial bacterium Sval024, the L-valine yield of a recombinant strain containing the ppc (R528H / S828P) mutant gene is increased by 27.7%, and the recombinant strain has important industrial application value for developing the L-valine high-yield strain.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of bioengineering technology, and in particular to a phosphoenolpyruvate carboxylase mutant and application thereof. BACKGROUND

[0002] L-valine is one of the 20 amino acids that make up proteins, and is also one of the essential amino acids and glycogenic amino acids of mammals. L-valine has important applications in the fields of feed, food and medicine, cosmetics, antibiotics and herbicides. At present, the industrial production of L-valine is mainly obtained by microbial fermentation.

[0003] In the biosynthesis of L-valine by Escherichia coli, pyruvate is converted to L-valine through a multi-step enzymatic reaction of ilvIH→ilvc→ilvD→ilvE. As an important precursor of L-valine, the accumulation of pyruvate has a decisive influence on the yield of L-valine. Pyruvate is generated from phosphoenolpyruvate (PEP) under the action of pyruvate kinase, and at the same time, PEP can also generate oxaloacetate under the action of phosphoenolpyruvate carboxylase ppc (encoded by ppc) to enter the tricarboxylic acid (TCA) cycle. In the process of anaerobic fermentation for synthesizing L-valine, the competition and consumption of intracellular TCA cycle and other bypass pathways for PEP limit the accumulation of pyruvate, and to some extent, limit the production capacity of L-valine strain.

[0004] Previous studies have involved weakening the competitive pathway of the precursor PEP of pyruvate by mutating ppc to solve the problem of insufficient supply of pyruvate. The applicant previously disclosed a ppc mutant in patent CN202410447391.5, which has R528H, S828P, D277G, D417G, S664Y single-point mutations compared with the wild type, reduces the expression activity of ppc enzyme through mutation, and improves the yield of L-valine. Therefore, it is of great significance to optimize the intracellular flux distribution of PEP by rational mutation of ppc protein to regulate the catalytic activity of ppc for improving the yield of L-valine.

[0005] Based on the previous research results, in order to further weaken the competitive pathway of the precursor of pyruvate, improve the supply of pyruvate precursor, and further improve the yield of L-valine, the applicant continues to study the activity regulation of ppc, and surprisingly obtains a ppc mutant which unexpectedly exhibits better valine production performance while maintaining low ppc catalytic activity, promoting the development of a new generation of high-yield L-valine strain. Based on this, the present application proposes a group of new ppc mutants with important industrial application value. SUMMARY

[0006] The present application is based on the study of single-site mutation of phosphoenolpyruvate carboxylase ppc, and further exploration through a large number of scheme design and experimental verification, and a double-site mutant ppc with reduced enzyme activity is obtained, which has better L-valine production performance.

[0007] Specifically, the technical scheme of the present application is as follows:

[0008] The present application provides a phosphoenolpyruvate carboxylase mutant, which has at least 99% homology with the amino acid sequence of wild-type phosphoenolpyruvate carboxylase shown in SEQ ID NO: 1 and has reduced phosphoenolpyruvate carboxylase activity; and there are R528H and S828P substitutions corresponding to the positions of SEQ ID NO: 1.

[0009] The term "phosphoenolpyruvate carboxylase mutant" used herein refers to a mutant of phosphoenolpyruvate carboxylase, which includes one or more amino acid substitutions / replacements in the amino acid sequence of a polypeptide having phosphoenolpyruvate carboxylase activity.

[0010] The term "phosphoenolpyruvate carboxylase (ppc)" used herein refers to phosphoenolpyruvate carboxylase (ppc) encoded by ppc, which complements oxaloacetate, an intermediate product of the tricarboxylic acid cycle, to maintain carbon metabolic flow balance; specifically, phosphoenolpyruvate carboxylase (ppc enzyme) catalyzes the generation of oxaloacetate and inorganic phosphate from phosphoenolpyruvate and bicarbonate.

[0011] The phosphoenolpyruvate carboxylase (ppc) can be a ppc protein derived from Escherichia or other sources, or a mutant thereof, but is not limited thereto. Specifically, the ppc protein can comprise an amino acid sequence as shown in SEQ ID NO: 1, or an amino acid sequence having 80% or more sequence homology thereto, but is not limited thereto, as long as it retains the activity of the ppc protein. Further, the ppc amino acid sequence can comprise an amino acid sequence as shown in SEQ ID NO: 1, or an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more homology with the amino acid sequence of SEQ ID NO: 1. The sequence of SEQ ID NO: 1 can be obtained from a publicly available database, such as Genbank of NCBI, etc. As long as the amino acid sequence of the ppc protein has such homology and exhibits equivalent or similar efficacy to the protein, any auxiliary protein with partial deletion, modification, substitution, or addition of the amino acid sequence can also be included within the scope of the present application.

[0012] The term "homology" as used herein refers to the degree of relatedness between two given amino acid sequences or nucleotide sequences and can be shown as a percentage; the terms "homology" and "identity" and "similarity" can be used interchangeably. Sequence homology, similarity or identity between any two given polynucleotides or polypeptides can be determined using visual inspection or known computer algorithms / programs.

[0013] The term "mutant" as used herein refers to a polypeptide in which the amino acid sequence is different from that before the mutation due to conservative substitution and / or modification of one or more amino acids, but maintains its function or property before the mutation. Such a mutant can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the mutant can be increased, unchanged, or decreased compared to the polypeptide before the mutation. In addition, some mutants can include mutants in which at least a part (such as an N-terminal leader sequence or a transmembrane domain) is removed. Other mutants can be those in which a portion of the N-terminus and / or C-terminus of the mature protein is removed. The term "mutant" can be used interchangeably with "modified", "modified polypeptide", "modified protein", "variant", "mutaprotein", "mutant", etc., and there is no limitation in using any term used in the sense of mutation.

[0014] In addition, variants can include deletion or addition of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the polypeptide can be coupled with a signal (or leader) sequence at the N-terminus of the protein involved in co-translational or post-translational transfer of the protein. In addition, the polypeptide can also be coupled with another sequence or linker to identify, purify, or synthesize the polypeptide.

[0015] The term "reduced phosphoenolpyruvate carboxylase activity" as used herein refers to a phosphoenolpyruvate carboxylase mutant having reduced activity of catalyzing the generation of oxaloacetate from phosphoenolpyruvate.

[0016] Further, the amino acid sequence of the phosphoenolpyruvate carboxylase mutant is shown in SEQ ID NO: 2.

[0017] The present application provides a polynucleotide encoding the phosphoenolpyruvate carboxylase mutant.

[0018] The present application provides a recombinant expression vector containing the polynucleotide.

[0019] The present application provides a microorganism expressing the phosphoenolpyruvate carboxylase mutant, containing the polynucleotide, or containing the recombinant expression vector.

[0020] Furthermore, the microorganism has an increased L-valine production capacity compared to microorganisms expressing the polypeptide shown in SEQ ID NO:1 or containing a polynucleotide encoding the polypeptide.

[0021] Furthermore, the microorganism is Escherichia coli.

[0022] The present invention provides the application of the phosphoenolpyruvate carboxylase mutant, the polynucleotide, the recombinant expression vector, or the microorganism in reducing the activity of phosphoenolpyruvate carboxylase protein or in preparing L-valine.

[0023] The present invention provides a method for reducing the activity of phosphoenolpyruvate carboxylase protein, comprising the following steps: mutating the 528th amino acid residue of wild-type phosphoenolpyruvate carboxylase as shown in SEQ ID NO:1 from R to H, and mutating the 828th amino acid residue from S to P.

[0024] The present invention provides a method for preparing L-valine, comprising the step of culturing the microorganism in a culture medium to obtain L-valine.

[0025] Furthermore, the method for preparing L-valine further includes the step of separating L-valine from the culture medium.

[0026] Furthermore, anaerobic fermentation culture was adopted.

[0027] Beneficial Effects: This invention provides a phosphoenolpyruvate carboxylase (ppc) mutant, which exhibits reduced catalytic activity compared to wild-type ppc, thereby weakening competition from alternative pathways and enhancing intracellular pyruvate precursor supply. Fermentation verification showed that the recombinant strain containing the aforementioned ppc mutant gene significantly increased L-valine production while maintaining normal cell growth requirements. Compared to the initial strain Sva1024, L-valine production increased by 27.7%, and the cell OD600 remained at 94% of the initial strain, promoting the development of a new generation of high-yielding L-valine strains and possessing significant industrial application value. Attached Figure Description

[0028] Figure 1 The reaction progress curves are for PPC and mutant enzymes. Detailed Implementation

[0029] The inventors found in previous studies that unit point mutations of ppc, such as R528H, S828P, D277G, D417G and S664Y, can improve the production performance of L-valine to different extents (see the prior patent CN202410447391.5 of the company). Among them, the D417G site mutation shows the best single point effect, but the technical effect of multi-site combination mutation is not clear.

[0030] Based on this, the inventors continue to study the ppc protein to further optimize the intracellular PEP flux distribution, and through systematic combination mutation design, the above-mentioned sites are further explored, and a multi-site combination mutant library containing R528H, S828P, D277G, D417G and S664Y sites is constructed. Through high-throughput screening and fermentation verification, it is accidentally found that the double-site mutation of R528H / S828P shows a significant improvement in production performance; through comparative experiments, it is proved that the L-valine yield of the R528H / S828P mutant is 11.4% higher than that of the optimal single-point mutation D417G, and is significantly better than other multi-site combinations, has certain technical advantages, and provides a more optimal solution for industrial production.

[0031] For the designed various combination mutation schemes, the present application does not enumerate all the experimental processes and data, but only selects representative combinations (such as R528H / S828P, D417G / R528H, D417G / S828P) for comparative analysis.

[0032] The present application will be further described below in conjunction with the drawings and specific embodiments, so that those skilled in the art can better understand the present application and implement it, but the embodiments are not limiting to the present application.

[0033] The present application will be further described below in conjunction with specific embodiments, but the protection scope of the present application is not limited to this:

[0034] The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples are conventional biochemical reagents unless otherwise specified.

[0035] The present application takes L-valine production strain Sval024 (obtained by modification of Escherichia coli ATCC8739, the construction process is described in the prior patent CN202010460035.9 of the company) as the starting strain, and introduces ppc gene mutation in the microbial genome.

[0036] Table 1 Strains and plasmids used in the present application

[0037]

[0038] Table 2 Primers and sequence information used in the present application

[0039]

[0040]

[0041] Example 1: Construction of recombinant strains

[0042] From the engineering strain Sval024 strain, the sequence of ppc gene was subjected to point mutation at different positions by Crispr-Cas9 method, wherein the nucleotide sequence of wild type ppc gene is shown in SEQ ID NO. 3, the amino acid sequence is shown in SEQ ID NO. 1, NCBI gene number: NZ CP033020.1:4474801-4477452, and the cat gene sequence is shown in SEQ ID NO. 4. The specific steps are as follows:

[0043] First, construct pTarget-ppc-N20-1, pTarget-ppc-N20-2 and pTarget-cat-N20 plasmids

[0044] The 20bp sequence before the PAM site of ppc and cat gene was searched on the online website, and the highest score was selected as the reference sequence for primer design. The N20 sequence designed for four different mutations of D417G(d1), S828P(d3), D417G / S828P(d1 / 3) and R528H / S828P(d2 / 3) was gcctggtagacaaagcactg; the N20 sequence designed for two mutations of R528H(d2) and D417G / R528H(d1 / 2) was caggtggacagccagtacgt; and the N20 sequence designed for knocking out cat gene was ccattgggatatatcaacgg. With pTarget plasmid (Yang, et al., Acta Biochim Biophys Sin, 2021; 53(5):620-627) as the template, PCR amplification was performed with primers ppc-sgRNA-F1 / ppc-sgRNA-R1, ppc-sgRNA-F2 / ppc-sgRNA-R2 and cat-sgRNA-F / cat-sgRNA-R, respectively, and three plasmids pTarget-ppc-N20-1, pTarget-ppc-N20-2 and pTarget-cat-N20 were obtained after transformation.

[0045] Second, prepare donor fragment for inserting cat gene

[0046] The cat gene fragment was amplified by using the puc57 plasmid containing cat gene biosynthesized by commission as template and primer cat-F / cat-R. The Sval024 strain genome was used as template, and the homologous arms of the target gene upstream and downstream for d1, d3, d1 / d3, d2, d1 / d2 and d2 / d3 mutation were amplified by using ppc-d1-UF / ppc-d1-cat-UR and ppc-d1-cat-DF / ppc-d1-DR, ppc-d1-UF / ppc-d3-cat-UR and ppc-d3-cat-DF / ppc-d1-DR, ppc-d1-UF / ppc-d1-cat-UR and ppc-d3-cat-DF / ppc-d1-DR, ppc-d1-UF / ppc-d2-cat-UR and ppc-d2-cat-DF / ppc-d2-DR, ppc-d1-UF / ppc-d1-cat-UR and ppc-d2-cat-DF / ppc-d2-DR, ppc-d2-UF / ppc-d2-cat-UR and ppc-d3-cat-DF / ppc-d1-DR, respectively, and then the homologous arms and cat gene were amplified by three-fragment fusion PCR to obtain the donor for inserting cat gene, and the single-point and double-point mutation of the corresponding site was introduced at the same time.

[0047] In the third step, the pTarget-ppc-N20-1 and pTarget-ppc-N20-2 plasmids and donor fragment were electrotransformed into E. coli (Sval024) to obtain different strains containing cat gene

[0048] E. coli (Sval024) / pEcCas (Yang, et al., Acta Biochim Biophys Sin, 2021; 53(5):620-627) was electro-transformed and placed in ice bath. Different 5 μL plasmids and 5 μL donor fragments were added in a clean bench: pTarget-ppc-N20-1 and d1-cat-donor, pTarget-ppc-N20-1 and d3-cat-donor, pTarget-ppc-N20-1 and d1 / 3-cat-donor, pTarget-ppc-N20-1 and d2 / 3-cat-donor, pTarget-ppc-N20-2 and d2-cat-donor, pTarget-ppc-N20-2 and d1 / 2-cat-donor. Gently mix, after 5 min in ice bath, use a pipette to transfer to pre-cooled 2 mm shock cup, use an electrotransformation instrument to shock, then add pre-cooled LB medium, remove all bacterial liquid and transfer to a sterile centrifuge tube, recover at 37 °C, 200 rpm for 3 h, centrifuge to remove part of the supernatant, blow the remaining bacterial liquid evenly, and then coat on LB solid medium (containing SD+kan+Chl antibiotics) and incubate at 37 °C overnight. PCR amplification and sequencing verification were performed using the verification primers ppc-YZ-F / ppc-YZ-R to determine whether the mutation was introduced and the cat gene was inserted.

[0049] Fourth step, elimination of pTarget plasmid

[0050] The recombinant strain obtained in the third step was inoculated in a sterile LB tube (kan antibiotic) and 2% rhamnose was added, and incubated at 37 °C, 200 rpm for about 8 h, then three-zone streaking of the bacterial liquid was performed on LB solid medium (kan antibiotic), and incubated at 37 °C overnight. Part of the single colonies were picked and streaked on LB solid medium (SD+kan antibiotic) and LB solid medium (kan antibiotic) corresponding to the regions, and incubated at 37 °C overnight. Single colonies that could not grow in the region corresponding to LB solid medium (SD+kan antibiotic) and grew normally in LB solid medium (kan resistance) were successfully eliminated pTarget plasmid.

[0051] Fifth step, preparation of donor fragment for original gene restoration

[0052] ppc-d1-UF / ppc-d1-UR, ppc-d1-DF / ppc-d1-DR and ppc-D1 / 3-knock-F / ppc-D1 / 3-knock-R; ppc-d1-UF / ppc-d3-UR, ppc-d3-DF / ppc-d1-DR and ppc-D1 / 3-knock-F / ppc-D1 / 3-knock-R; ppc-d1-UF / ppc-d1-UR, ppc-d3-DF / ppc-d1-DR and ppc-D1 / 3-knock-F / ppc-D1 / 3-knock-R;

[0053] ppc-d1-UF / ppc-d2-UR, ppc-d2-DF / ppc-d2-DR and ppc-D1 / 2-knock-F / ppc-D1 / 2-knock-R;

[0054] ppc-d1-UF / ppc-d1 / 2-UR, ppc-d2-DF / ppc-d2-DR and ppc-D1 / 2-knock-F / ppc-D1 / 2-knock-R;

[0055] ppc-d2 / 3-UF / ppc-d2 / 3-UR, ppc-d3-DF / ppc-d1-DR and ppc-D2 / 3-knock-F / ppc-D3 / 3-knock-R were amplified to obtain the gene fragments for d1, d3, d1 / d3, d2, d1 / d2 and d2 / d3 to be knocked out when cat gene was inserted, and the homologous arms above and below the target gene, and then the three fragments were fused by PCR amplification to obtain the donor for restoring the original gene, while retaining the single-point and double-point mutations of the corresponding sites.

[0056] Step 6, the pTarget-cat-N20 plasmid was electroporated into the corresponding recombinant bacteria containing cat with the different donors obtained in step 5 to obtain the final target single-point and double-point mutant strains, and the specific steps are referred to the third step experiment.

[0057] Step 7, elimination of double plasmids

[0058] pTaregt-cat-N20 elimination reference fourth step experiment, after loss success, pick up one of the single colonies to inoculate 3 mL LB test tube (without resistance), add the final concentration of 50% sucrose solution, 37℃, 200rpm culture for about 8h, streaked on LB solid medium (without resistance), 37℃ culture overnight. Pick up part of the single colony, respectively, streaked on LB solid medium (kan antibiotic) and LB solid medium (without antibiotic) on the corresponding area, 37℃ culture overnight. In LB solid medium (without resistance) normal growth, while in LB solid medium (kan antibiotic) corresponding area cannot grow single colony for pEcCas successful elimination of the clone.

[0059] Thus six plasmid-free recombinant strains can be obtained, which are named as ppc001 (containing D417G mutation), ppc002 (containing R528H mutation), ppc003 (containing S828P mutation), ppc004 (containing D417G / R528H mutation), ppc005 (containing D417G / S828P mutation), ppc006 (containing R528H / S828P mutation) strains.

[0060] Example 2: Expression of valine production bacteria ppc protein and mutant ppc* and enzyme activity determination

[0061] (1) Protein expression of ppc and ppc*

[0062] Referring to the method and conditions disclosed in CN202410447391.5, the expression plasmids of phosphoenolpyruvate carboxylase ppc gene and mutant ppc* gene are constructed, and the enzymatic properties of the two are compared.

[0063] The specific steps of the method are as follows, and the method and conditions are the same as the operation in Example 2(1) of CN202410447391.5:

[0064] First, the E. coli carrying Pet-28a plasmid (purchased from Shanghai Shengong Company, B540183-0001) was inoculated in 5ml LB+kan resistance liquid medium, and cultured at 37℃ overnight. The next day, the plasmid was extracted. Using the plasmid as the template, Pet-28a-F / Pet-28a-R as the primer, linearized Pet-28a was obtained by reverse PCR method, and the band size was 5369bp.

[0065] Second, using the genome of the engineering bacteria Sval024 and the genomes of the six mutant strains constructed in Example 1 as the template, ppc-F / ppc-R as the primer, the target gene ppc and the six mutant genes ppc* were amplified.

[0066] The amplification system and the amplification conditions are the same as described in the first step.

[0067] In the third step, the linearized Pet-28a is recombined with the above-mentioned fragments ppc and mutant genes ppc* respectively. The recombination products are transformed into DH5a competent cells, and the transformants are screened by kanamycin resistance; the transformants are identified by colony PCR, and the positive clones are amplified to extract the target plasmids, a total of 7, for standby use.

[0068] In the fourth step, the above-mentioned 7 target plasmids are transformed into the expression host BL21 competent cells respectively, screened by kanamycin resistance and identified by cloning, and finally the recombinant expression strains are obtained. The finally obtained recombinant strains are recorded as P-ppc, P-ppc*-1 (containing D417G mutation), P-ppc*-2 (containing R528H mutation), P-ppc*-3 (containing S828P mutation), P-ppc*-4 (containing D417G / R528H mutation), P-ppc*-5 (containing D417G / S828P mutation) and P-ppc*-6 (containing R528H / S828P mutation).

[0069] In the fifth step, the recombinant strain induction expression and the preparation of crude enzyme solution:

[0070] Induction expression: the above-mentioned recombinant strains are inoculated into LB liquid medium containing kanamycin (final concentration 50 μg / mL) at an inoculation amount of 1%, and cultured at 37°C, 220 rpm until OD600=0.6. IPTG (isopropyl thiogalactoside) is added to a final concentration of 0.1 mM, and low-temperature induction culture is carried out at 16°C, 150 rpm for 20 h.

[0071] Preparation of crude enzyme solution: the induced bacterial solution is centrifuged to collect the bacterial cells, which are then resuspended in Lysis Buffer, and PMSF solution is added to a final concentration of 1 mM. Then, the cells are broken by using an ultrasonic disrupter on ice. The bacteria or cells (10 4 are broken by ultrasonic wave, and the supernatant is taken and placed on ice for testing.

[0072] (2) Enzyme activity determination of ppc and ppc*

[0073] ppc irreversibly catalyzes the reaction of phosphoenolpyruvate (PEP) and carbon dioxide (bicarbonate form) to generate oxaloacetate and orthophosphate (bicarbonate form). In this experiment, the content of orthophosphate in the solution is detected by ammonium molybdate phosphorus determination method.

[0074] The specific steps of the method are as follows, and the method and conditions are the same as the operation in Example 2(2) of CN202410447391.5:

[0075] 1. Preparation of phosphorus reagent

[0076] Reagent A component: concentrated HCl 5 mL, L-ascorbic acid 7.2 g, ddH2O 55 mL;

[0077] Reagent B component: ammonium molybdate tetrahydrate 0.75 g, ddH2O 50 mL;

[0078] Reagent C component: Reagent A and Reagent B mixed in a volume ratio of 2:1, prepared fresh;

[0079] Reagent D component: trisodium citrate dihydrate 1 g, acetic acid 1 mL, ddH2O 49 mL.

[0080] 2. Preparation of phosphorus standard curve

[0081] Prepare potassium dihydrogen phosphate gradient solution (0 mM, 0.5 mM, 1 mM, 1.5 mM, 2 mM);

[0082] Add 150 μL of reagent C to a 96-well plate → add 50 μL of different concentrations of potassium dihydrogen phosphate solution → stand for 5 min → add 150 μL of reagent D → stand for 15 min, and measure OD with a continuous wavelength enzyme marker. 655 .

[0083] Plot the OD 655 value against the concentration of orthophosphate to prepare a phosphorus standard curve.

[0084] 3. Preparation of enzyme reaction progress curve

[0085] 10 mg of phosphoenolpyruvate monopotassium salt (PEP-K, 0.049 mmol) was dissolved in water to prepare a stock solution with a final concentration of 22.5 mM. Take 50 μL of the stock solution, dilute 10-fold with 450 μL of Elution buffer (composition: Tris-HCl 25 mM, NaCl 150 mM, imidazole 300 mM, pH = 8) to prepare a 2.25 mM reaction stock solution.

[0086] Similarly, prepare a 2.25 mM potassium bicarbonate reaction stock solution (dissolved in Elution buffer).

[0087] Prepare the following reaction system to explore the optimal PEPC concentration and reaction progress curve.

[0088] Table 3 Reaction system

[0089]

[0090] React at 37°C, 220 rpm for 180 min, and measure the phosphoric acid content in the system at 5, 10, 20, 30, 60, and 180 min.

[0091] Definition of enzyme activity unit: the content of phosphate generated per mg protein per unit time is defined as an enzyme activity unit.

[0092] Draw the enzyme reaction progress curve, and it can be seen from FIG. 1 that, compared with the wild-type ppc, the activity of the six mutant enzymes is reduced, and the activity of the R528H / S828P combined mutant is reduced more significantly, thereby making more phosphoenolpyruvic acid flow to the generation of pyruvic acid, that is, the generation of L-valine is increased. Figure 1

[0093] Example 3: Fermentation test of engineering strain Sval024 and recombinant strain

[0094] According to the method disclosed in Example 3 of the cited patent CN202410447391.5 (specifically related to seed culture, fermentation culture conditions and L-valine liquid phase detection method), fermentation tests were carried out on the engineering strain Sval024 and the corresponding recombinant strain.

[0095] The specific steps are as follows:

[0096] (1) Seed culture: two-stage seed culture was carried out according to the method described in the cited document to obtain seed liquid.

[0097] (2) Fermentation culture: the seed liquid was inoculated into the fermentation medium (final concentration OD 550 = 0.1) and subjected to anaerobic fermentation in a 500 mL anaerobic tank (liquid loading amount 250 mL) at 37°C, 150 rpm for 4 days. 5M ammonia water was used to automatically control the pH to 7.0 during the fermentation process.

[0098] (3) L-valine detection: sampling was carried out at 48h of fermentation. After pretreatment such as centrifugation, supernatant dilution (50 times), filtration (0.22μm water system filter membrane), etc., the L-valine content was determined according to the high performance liquid chromatography (HPLC) conditions described in the cited document (using ZORBAX Eclipse AAA chromatographic column, detection wavelength 338nm).

[0099] According to the liquid phase result comparison and data analysis, the results are shown in Table 4 below.

[0100] Table 4 L-valine yield

[0101] Strains Sva1024 ppc001 ppc002 ppc003 ppc004 ppc005 ppc006 Valine production g / L 1.3 1.49 1.41 1.35 1.44 1.36 1.66

[0102] ​Each mutant was designed for 3 groups of parallel experiments, and the final L-valine production results are shown in Table 4. The average values were taken, and the significance analysis was performed on the following data, and the P values were all <0.05, which had significant differences. As can be seen from Table 4, compared with single-point mutation, the combined mutation R528H / S828P showed more excellent L-valine production capacity, and its yield was increased by 11.4% compared with the optimal single-point mutation D417G, and was also significantly better than the double-site combination of D417G and R528H or S828P; in addition, although the cell growth rate (OD600) of all mutant strains decreased, it could still maintain normal cell growth, and the OD600 of the mutant strain ppc004 remained at 94% of the control strain Sval024.

[0103] Although the present application has been disclosed in the preferred embodiments as above, it is not intended to limit the present application, and anyone skilled in the art can make various modifications and modifications without departing from the spirit and scope of the present application, and therefore the protection scope of the present application should be defined by the claims.

Claims

1. A phosphoenolpyruvate carboxylase mutant having at least 99% homology to the amino acid sequence of wild-type phosphoenolpyruvate carboxylase shown in SEQ ID NO: 1 and having reduced phosphoenolpyruvate carboxylase activity, and having R528H and S828P substitutions at positions corresponding to SEQ ID NO:

1. 2.The phosphoenolpyruvate carboxylase mutant of claim 1, the amino acid sequence of which is shown in SEQ ID NO:

2. 3.A polynucleotide encoding the phosphoenolpyruvate carboxylase mutant of claim 1 or 2. 4.A recombinant expression vector containing the polynucleotide of claim 3. 5.A microorganism expressing the phosphoenolpyruvate carboxylase mutant of claim 1 or 2, containing the polynucleotide of claim 3, or containing the recombinant expression vector of claim 4. 6.The microorganism of claim 5, which has increased L-valine production capacity compared to a microorganism expressing the polypeptide shown in SEQ ID NO: 1 or containing a polynucleotide encoding the polypeptide. Preferably, the microorganism is Escherichia coli. 7.Use of the phosphoenolpyruvate carboxylase mutant of claim 1 or 2, the polynucleotide of claim 3, the recombinant expression vector of claim 4, or the microorganism of claim 5 or 6 in reducing phosphoenolpyruvate carboxylase protein activity or in preparing L-valine.

8. A method of reducing the activity of a phosphoenolpyruvate carboxylase protein comprising the steps of: The amino acid residue at position 528 of wild-type phosphoenolpyruvate carboxylase shown in SEQ ID NO: 1 is mutated from R to H, and the amino acid residue at position 828 is mutated from S to P. 9.A method of preparing L-valine, comprising the step of culturing the microorganism of claim 5 or 6 in a culture medium to obtain L-valine. Optionally, the method further comprises the step of isolating the L-valine from the culture medium.

10. The method of claim 9, wherein, Anaerobic fermentation culture is employed.

Images