Application of CsFNS1 gene in improving flavonoid content of citrus

By cloning the CsFNS1 gene and constructing an overexpression vector to transform citrus fruits, the problem of low flavonoid content in citrus fruits in traditional breeding methods was solved. This resulted in a high efficiency in increasing the content of rutin, hesperidin, and lemon balm glycosides in citrus peels, thus promoting the cultivation of functional citrus varieties.

CN120905284BActive Publication Date: 2026-07-03GERMPLASM INNOVATION GRAND SCIENCE CENTER OF WESTERN CHINA (CHONGQING) SCIENCE CITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
GERMPLASM INNOVATION GRAND SCIENCE CENTER OF WESTERN CHINA (CHONGQING) SCIENCE CITY
Filing Date
2025-08-15
Publication Date
2026-07-03

AI Technical Summary

Technical Problem

Existing technologies make it difficult to cultivate citrus varieties with high levels of rutin, hesperidin, and lemon balm glycosides through genetic engineering. Traditional breeding methods are slow, labor-intensive, and lack precision.

Method used

By cloning the CsFNS1 gene of citrus, an overexpression vector was constructed and transformed into citrus fruits to increase the expression level of the CsFNS1 gene, thereby increasing the content of rutin, hesperidin and lemon balm glycoside.

Benefits of technology

The expression level of the CsFNS1 gene is positively correlated with the content of citrus flavonoids. After transformation with the overexpression vector, the content of rutin, hesperidin and lemon balm glycoside in citrus peel can be increased by 70.97%, which can accelerate the breeding process, reduce the workload, and improve the comprehensive utilization rate of citrus.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905284B_ABST
    Figure CN120905284B_ABST
Patent Text Reader

Abstract

This invention discloses the application of the CsFNS1 gene in increasing the flavonoid content of citrus fruits, belonging to the field of agricultural bioengineering technology. It provides the application of the CsFNS1 gene in increasing the flavonoid content of citrus fruits, and the nucleotide sequence of the CsFNS1 gene is shown in SEQ ID NO.1. It also provides a method for increasing flavonoid content in citrus peel using the CsFNS1 gene, comprising the following steps: cloning the citrus CsFNS1 gene; constructing a CsFNS1 overexpression vector; transforming the overexpression vector into Agrobacterium tumefaciens to obtain Agrobacterium tumefaciens bacterial solution; and injecting it into citrus fruits to obtain citrus fruits overexpressing the CsFNS1 gene. This invention provides a new option for increasing flavonoid content in citrus peel, effectively increasing the content of rutin, hesperidin, and / or lemon balm glycosides in citrus peel. This has significant application value for cultivating new functional citrus varieties and accelerating the breeding process.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of agricultural bioengineering technology, specifically involving the application of the CsFNS1 gene in increasing the content of flavonoid compounds in citrus fruits. Background Technology

[0002] Citrus fruits are rich in various nutrients and bioactive secondary metabolites. These components not only give citrus fruits their unique flavor and health benefits, but also exhibit significant effects in antioxidation, anti-inflammation, anti-cancer, and cardiovascular protection. Among them, rutin, hesperidin, and lemon balm glycosides, as flavanone glycosides of flavonoids, have outstanding biological activities: in plant self-defense, they can resist pathogens and pests; in the field of human health, they can scavenge reactive oxygen species and free radicals, inhibit inflammatory responses, reduce the risk of cardiovascular disease and various cancers, regulate intestinal flora balance, improve metabolism, and combat obesity. Therefore, they are widely used in food processing to reduce the use of synthetic chemicals, which is of great significance for improving human health.

[0003] Although the value of rutin, hesperidin, and lemon balm glycosides is widely recognized, their biosynthetic pathways and regulatory mechanisms in citrus fruits are not yet fully elucidated, especially the discovery and functional analysis of key rate-limiting enzyme genes. This makes it difficult to use molecular breeding techniques such as genetic engineering to directionally cultivate functional citrus varieties with high levels of these components. Traditional breeding methods suffer from slow progress, high workload, and insufficient precision, hindering the improvement of the comprehensive utilization rate of citrus fruits. Therefore, in-depth research into the key genes and molecular mechanisms regulating the synthesis of rutin, hesperidin, and lemon balm glycosides in citrus fruits is of significant theoretical and practical importance for promoting the efficient breeding of functional citrus varieties. Summary of the Invention

[0004] This invention aims to provide the application of the CsFNS1 gene in increasing the content of flavonoids in citrus fruits, offering a new option for increasing flavonoid content in citrus peels. This application involves integrating the citrus CsFNS1 gene into citrus fruits via an expression vector, effectively increasing the content of rutin, hesperidin, and / or lemon balm glycosides in the citrus peel. This has significant application value for cultivating new functional citrus varieties and accelerating the breeding process.

[0005] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0006] Application of the CsFNS1 gene in increasing the content of flavonoid compounds in citrus peel, wherein the nucleotide sequence of the CsFNS1 gene is shown in SEQ ID NO.1.

[0007] Preferably, the content of flavonoid compounds in citrus peel is increased by regulating the expression level of the CsFNS1 gene in citrus.

[0008] Preferably, the flavonoid compounds in citrus peel include rutin, hesperidin and / or lemon balm glycoside.

[0009] The present invention also provides an overexpression vector for increasing the content of flavonoid compounds in citrus peel, wherein the overexpression vector includes the CsFNS1 gene.

[0010] The present invention also provides a strain that increases the content of flavonoid compounds in citrus peel, the strain comprising the overexpression vector described above.

[0011] The present invention also provides a method for increasing flavonoid compounds in citrus peel using the CsFNS1 gene, comprising the following steps:

[0012] S1, Cloning the CsFNS1 gene of citrus;

[0013] S2. Construct a CsFNS1 overexpression vector;

[0014] S3. Transform the overexpression vector obtained in S2 into Agrobacterium to obtain Agrobacterium bacterial solution; inject the Agrobacterium bacterial solution into citrus fruit to obtain citrus fruit with CsFNS1 gene overexpression.

[0015] Preferably, in S1, the cloned citrus CsFNS1 gene specifically comprises:

[0016] Total RNA was extracted from citrus and reverse transcribed into cDNA. Using cDNA as a template, the citrus CsFNS1 gene was amplified by PCR using primers OE-CsFNS1-F and OE-CsFNS1-R.

[0017] Preferably, the nucleotide sequence of primer OE-CsFNS1-F is shown in SEQ ID NO.2, and the nucleotide sequence of primer OE-CsFNS1-R is shown in SEQ ID NO.3.

[0018] Preferably, in S2, the construction of the CsFNS1 overexpression vector specifically involves: ligating the CsFNS1 gene obtained in S1 into the pLGNe vector recovered by KpnⅠ and EcoRⅠ enzyme digestion, transforming it into Escherichia coli DH5α, and constructing the overexpression vector pLGNe-CsFNS1.

[0019] Preferably, in step S3, PCR identification and qRT-PCR identification are performed after the Agrobacterium tumefaciens bacterial solution is injected into the citrus fruit.

[0020] Compared with the prior art, the present invention has the following advantages and technical effects:

[0021] This invention provides the application of the CsFNS1 gene in increasing the flavonoid content of citrus fruits. This invention is the first to discover a positive correlation between the expression level of the CsFNS1 gene and the content of rutin, hesperidin, and / or lemon balm glycosides in citrus fruits. Higher CsFNS1 gene expression levels result in higher contents of these flavonoids in the citrus peel. By cloning the citrus CsFNS1 gene, constructing an overexpression vector, and then transforming citrus fruits, the transgenic material obtained showed a flavonoid content up to 70.97% higher than that of citrus fruits transformed with an empty vector. In conclusion, the CsFNS1 gene can serve as a candidate gene for breeding new citrus varieties with increased rutin, hesperidin, and / or lemon balm glycoside content. This is of great significance for using genetic engineering methods to cultivate functional citrus varieties, accelerate the breeding process, reduce breeding workload, and improve the comprehensive utilization rate of citrus fruits.

[0022] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0023] Figure 1 This is the bioinformatics analysis result of the CsFNS1 gene in this invention; wherein Figure 1 In this text, A represents the chromosomal location of the CsFNS1 gene in Late Orange, and bp represents bases. Figure 1 In this text, B represents the structure of the CsFNS1 gene in Late Orange, and Exon1-2 are exons. Figure 1 In this context, C represents the conserved domain of the CsFNS1 gene in the late orange variety, and aa represents an amino acid.

[0024] Figure 2 This is an electrophoresis diagram of the PCR amplification product of the CsFNS1 gene coding sequence of the present invention; where CDS represents the CsFNS1 gene coding sequence; M represents the DNA molecular weight standard;

[0025] Figure 3 This is a structural diagram of the CsFNS1 gene overexpression vector of the present invention; where GUS:NPTII represents the β-glucosidase gene; P 35S This indicates a plant constitutive promoter derived from cauliflower mosaic virus; T NOS This indicates the terminator of the crown gall alkaloid synthase gene;

[0026] Figure 4 These are photographs of the fruit taken on the day of the instantaneous transformation and 5 days after the instantaneous transformation, as shown in Example 4 of this invention; wherein, Figure 4 In the image, A represents a photograph of the fruit taken on the day of the instantaneous transformation. Figure 4 B in the image is a photograph of the fruit after 5 days of cultivation following the transient transformation; Figure 4 C in the image represents a partial sample photograph taken during total RNA extraction.

[0027] Figure 5 This is the result of the relative expression level analysis of the CsFNS1 gene in this invention;

[0028] Figure 6 The results of the detection of the content of rutin, hesperidin and / or lemon balm glycoside in the peel of Late Orange by the instantaneous conversion of the present invention are as follows: Figure 6 In the figure, A represents the result of the rutin content test. Figure 6 B in the figure represents the result of hesperidin content detection. Figure 6 C in the figure represents the result of lemon balm glycoside content detection. Detailed Implementation

[0029] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0030] Unless otherwise defined, the technical or scientific terms used in this invention shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

[0031] Source of experimental materials:

[0032] In this embodiment, the late-ripening orange was used as the test subject.

[0033] In this invention, unless otherwise specified, all other test materials and instruments are conventional test materials in the field and can be purchased through commercial channels.

[0034] Example 1

[0035] I. Bioinformatics Analysis Results of the CsFNS1 Gene in Late Orange

[0036] The structure of the CsFNS1 gene in Late Orange is as follows: Figure 1 As shown, it is located between 21,959,892bp and 21,962,970bp on chromosome 5 of Late Orange, contains 2 exons, and encodes 504 amino acids.

[0037] The CDS sequence of the CsFNS1 gene is shown in SEQ ID NO.1.

[0038] SEQ ID NO.1:

[0039]

[0040] II. Cloning of the CsFNS1 coding sequence of Late Orange

[0041] 1. RNA extraction and cDNA synthesis

[0042] Total RNA was extracted from citrus (Late Orange) leaves using a plant total RNA extraction kit (Adley, CAT: RN09). RNA quality was verified by agarose gel electrophoresis, and its concentration was determined using a concentration meter. cDNA was synthesized using a reverse transcription kit PrimeScript RTMaster Mix (TaKaRa, CAT: RR036A).

[0043] 2. PCR amplification of the CsFNS1 coding sequence

[0044] Using primers OE-CsFNS1-F (SEQ ID No. 2), OE-CsFNS1-R (SEQ ID No. 3) and the high-fidelity enzyme PrimeSTAR Max DNAPolymerase (TaKaRa, CAT: R045A), with the late-ripening orange cDNA obtained in S1 as a template, the amplification system was prepared according to the instructions accompanying the high-fidelity enzyme PrimeSTAR Max DNAPolymerase.

[0045] The PCR amplification program was as follows: 98℃, 5 min; 98℃, 30 s, 56℃, 30 s, 72℃, 1.5 min, 35 cycles; extension at 72℃ for 10 min. The amplified DNA fragment encoding the CsFNS1 sequence was obtained, with a fragment length of 1521 bp (1512 bp CDS sequence - 3 bp terminator + 12 bp of restriction enzyme sites).

[0046] Agarose gel electrophoresis results are as follows Figure 2 As shown, the amplified fragment size results were as expected. Under UV light, the agarose gel block containing the target fragment was cut off with a clean blade, and the DNA fragment was recovered using a kit (BioFlux, CAT: BSC02M1). A portion of the recovered product was sent to the company for sequencing. The sequencing results, after comparative analysis, confirmed that the obtained DNA fragment was the coding sequence of the Late Orange CsFNS1 gene (SEQ ID NO.1).

[0047] SEQ ID No. 2:

[0048] GGTACCATGACACTTCAACCACTGATTTTTTATGC

[0049] SEQ ID No. 3:

[0050] GAATTCATTTAGGATACTAGGAGCACAACGTG

[0051] III. Construction of CsFNS1 overexpression vector and transformation of Agrobacterium tumefaciens

[0052] 1. Construction of overexpression vectors

[0053] The recovered DNA fragments and overexpression vector pLGNe obtained in Example 2 were double-digested with restriction endonucleases KpnⅠ and EcoRI (ThermoFisher), then gel-recovered and ligated overnight at 16°C. The digestion system and reaction conditions were performed according to the accompanying instructions. Ligation was performed using the T4 DNA Ligase kit (Promega, CAT: M1801), and the ligation system and reaction conditions were performed according to the instructions accompanying the T4 DNA Ligase kit.

[0054] The obtained ligation product was transformed into *E. coli* DH5α using the method described in the *E. coli* DH5α instruction manual. Plasmids from positive clones were extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the CsFNS1 overexpression vector pLGNe-CsFNS1. The vector structure is shown below. Figure 3 As shown.

[0055] 2. Transformation of Agrobacterium with overexpression vector

[0056] Thaw 50 μL of frozen Agrobacterium tumefaciens competent cells EHA105 in a 2 mL centrifuge tube on ice. Add 2 μL of the plasmid overexpression vector to the competent cells, mix well by pipetting, and then place the mixture on ice for 5 min, flash freeze in liquid nitrogen for 5 min, incubate at 37 °C for 5 min, and place on ice for 5 min. Then add 800 μL of LB liquid medium to a 2 mL centrifuge tube, mix well by pipetting, and incubate at 28 °C with shaking at 260 rpm for 2 h. After the designated time, centrifuge the bacterial suspension at 6000 rpm for 1 min, discard the supernatant, resuspend the bacterial cells in 50 μL of LB liquid medium, and then spread the resuspended cells onto LB solid medium containing 50 mg / L kanamycin. Incubate in the dark at 28°C for 2 days. Once plaques have grown, pick colonies and perform PCR verification on single colonies using primers ID-CsFNS1-F (SEQ ID NO.4) and ID-CsFNS1-R (SEQ ID NO.5) and the high-fidelity enzyme PrimeSTARMax DNAPolymerase (TaKaRa, CAT: R045Q). The amplification system was prepared according to the instructions accompanying the PrimeSTARMax DNAPolymerase package. The PCR amplification conditions were: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0057] SEQ ID NO.4: TCGTTGAAGATGCCTCTGCCGACAG;

[0058] SEQ ID NO. 5: ATTTAGGATACTAGGAGCACAACGTG.

[0059] IV. Transient conversion of the CsFNS1 overexpression vector pLGNe-CsFNS1

[0060] 1. Agrobacterium infection

[0061] Select late-ripening orange fruits of uniform growth condition and sterilize them with 75% alcohol in a clean bench. Add 500 μL of Agrobacterium suspension containing pLGNe and pLGNe-CsFNS1 plasmids to 50 mL of liquid LB medium (containing 50 mg / L kanamycin) and incubate at 28℃ and 200 rpm until OD600 = 0.5. Centrifuge and collect the precipitate. Resuspend the Agrobacterium in 1 / 2 MS liquid medium. Then, randomly select four injection points on the diagonal of the equatorial plane of the sterilized late-ripening orange fruit and mark them. Inject 1 mL of the Agrobacterium resuspension containing pLGNe-CsFNS1 plasmid into the peel of the late-ripening orange using a 1 mL syringe. Each area is injected with 1 mL of this solution, designated as the experimental group. Use the same method to inject an equal amount of Agrobacterium resuspension containing pLGNe plasmid as the control group. The experimental and control groups were each replicated three times. Late-ripening orange fruits injected with Agrobacterium resuspension were placed in a 28°C incubator in the dark for 5 days. Photos of the fruits on the day of transient transformation and after 5 days of cultivation are shown below. Figure 4 As shown.

[0062] 2. qRT-PCR analysis of transiently transformed late-ripening orange fruits.

[0063] Total RNA (Adelai, CAT No: RN09) was extracted from the peel of the injected areas of the late-blooming orange (Adelai, CAT No: RN09) after 5 days of dark incubation at 28℃. cDNA was synthesized using the PrimeScript RTMasterMix reverse transcription kit (TaKaRa, CAT: RR036A), and the expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsFNS1-F (SEQ ID NO. 6) and RT-CsFNS1-R (SEQ ID NO. 7). Two... -△△Ct The relative expression levels of the CsFNS1 gene in the experimental and control groups of late-ripening oranges were calculated as follows: the control group sample was defined as the reference factor, i.e., its CsFNS1 expression level was 1. Then, the fold increase in gene expression in the experimental group sample relative to the reference factor was calculated as 2. -△△Ct , which is its relative expression level. The results are as follows: Figure 5 As shown, the expression level of CsFNS1 gene in the experimental group was significantly higher than that in the control group, with the highest level being more than 8 times that of the control.

[0064] qRT-PCR reaction conditions: 95℃ for 3 min, 94℃ for 10 s; 56℃ for 10 s, 72℃ for 10 s, 40 cycles; 72℃ for 10 min.

[0065] SEQ ID NO.6:TGCTTTCGCTCCCTATGGC;

[0066] SEQ ID NO. 7: CCGAATAAGCTCGCGCAAC.

[0067] V. Evaluation of flavonoid content in pericarp of CsFNS1 overexpression materials

[0068] The contents of rutin, hesperidin, and / or lemon balm glycosides in the peels of the experimental and control groups 5 days after transient transformation in the above experiment were determined using UPLC-MS. Statistical results are shown below. Figure 6 As shown, compared with the control group fruit transiently transformed with pLGNe, the contents of rutin, hesperidin and / or lemon balm glycoside in the peel of the fruit transiently transformed with pLGNe-CsFNS1 increased by 13.74%–17.13%, 46.77%–47.14% and 25.61%–26.86%, respectively, indicating that transient overexpression of the CsFNS1 gene can significantly increase the contents of rutin, hesperidin and / or lemon balm glycoside in the fruit of the late-maturing orange.

[0069] Therefore, this invention is the first to discover a positive correlation between the expression level of the CsFNS1 gene and the content of rutin, hesperidin, and / or lemon balm in citrus. The higher the expression level of the CsFNS1 gene, the higher the content of rutin, hesperidin, and / or lemon balm in the citrus peel. In the experiment, citrus transiently transformed with the CsFNS1 gene overexpression vector showed up to 70.97% higher content than citrus transformed with the empty vector. The CsFNS1 gene can serve as a candidate gene for breeding new citrus varieties with high rutin, hesperidin, and / or lemon balm content, which is of great significance for using genetic engineering methods to cultivate functional new citrus varieties, accelerate the breeding process, reduce the breeding workload, and improve the comprehensive utilization rate of citrus.

[0070] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. Overexpression CsFNS1 The application of genes in increasing the content of rutin, hesperidin and / or lemon balm glycoside in the peel of Late-ripening oranges is characterized by, The CsFNS1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. A method through overexpression CsFNS1 A method for genetically increasing the content of naringin, hesperidin, and / or lemon balm glycoside in the peel of Late-ripening oranges, characterized in that... Includes the following steps: S1, Cloned Late-Blooming Orange CsFNS1 Genes, the ones mentioned CsFNS1 The nucleotide sequence of the gene is shown in SEQ ID NO.1; S2, Construction CsFNS1 Overexpression vector; S3. The overexpression vector obtained in S2 is transformed into Agrobacterium to obtain Agrobacterium bacterial suspension; the Agrobacterium bacterial suspension is injected into late-ripening orange fruit to obtain... CsFNS1 Late-ripening orange fruit with overexpressed genes.

3. The method according to claim 2, characterized in that, In S1, the cloned Late Orange CsFNS1 The genes are specifically: Total RNA was extracted from Late Orange and reverse transcribed into cDNA. This cDNA was then used as a template and primer OE- CsFNS1 -F and OE- CsFNS1 -R was used for PCR amplification to obtain late-ripening oranges. CsFNS1 Gene; The primer OE- CsFNS1 The nucleotide sequence of -F is shown in SEQ ID NO.2, and the primer OE- CsFNS1 The nucleotide sequence of -R is shown in SEQ ID NO.

3.

4. The method according to claim 2, characterized in that, In S2, the construction CsFNS1 The overexpression vector is specifically: the vector obtained from S1 CsFNS1 The gene was ligated into the pLGNe vector, which was recovered after digestion with KpnⅠ and EcoRI, and transformed into E. coli DH5α to construct the overexpression vector pLGNe- CsFNS1 .

5. The method according to claim 2, characterized in that, S3 also includes PCR identification and qRT-PCR identification after the Agrobacterium tumefaciens bacterial solution is injected into the late-ripening orange fruit.