Method for ultrasensitively detecting activity of beta-glucosyltransferase based on CRISPR nano sensor

Abstract

The invention belongs to the field of biological nano sensors, and particularly discloses a method for ultrasensitively detecting the activity of beta-glucosyltransferase (beta-GT) based on a CRISPR (clustered regularly interspaced short palindromic repeats) nano sensor. The invention designs a 5-hmC modified dumbbell probe integrating multiple functions of target recognition, palindromic isothermal amplification and restriction enzyme cutting sites, and realizes ultra-sensitive detection of beta-GT activity at a single molecule level by utilizing palindromic primer hyperbranched rolling circle amplification (PP-HRCA) based on a CRISPR (clustered regularly interspaced short palindromic repeats) nano sensor. The nano sensor can accurately quantify the activity of beta-GT in a complex biological matrix, and the method is convenient and fast, low in price, high in sensitivity and suitable for being popularized and applied to inhibitor screening and enzyme kinetic analysis.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biological nanosensors, and specifically discloses a method for ultra-sensitive detection of β-glucosyltransferase activity based on a CRISPR nanosensor. BACKGROUND

[0002] Glucosyltransferase is a subclass of the glycosyltransferase family, which can catalyze the transfer of glucosyl from an activated donor to an acceptor molecule, thereby generating a glycosylated product. The enzyme is widely distributed in various biological systems and plays a key role in biochemical processes such as carbohydrate metabolism, cell wall synthesis and modification of biological macromolecules. Glycosylation modification can significantly affect the solubility, stability and biological activity of the acceptor molecule. As a core member of the glycosyltransferase family, it has an indispensable function in physiological and biochemical pathways such as intracellular transport, protein quality control and elimination, cell-cell interaction, cell-matrix adhesion and signal transduction. Therefore, this type of enzyme can be used as a potential biomarker and therapeutic target. Among them, the β-glucosyltransferase (β-GT) encoded by the T4 bacteriophage DNA has attracted much attention due to its unique role in DNA modification. The enzyme uses UDP-glucose (UDP-Glc) as an activated donor to transfer a glucose group to the hydroxyl group of 5-hydroxymethylcytosine (5-hmC) in double-stranded DNA, forming β-glucosyl-5-hydroxymethylcytosine (5-ghmC). This modification can protect bacteriophage DNA from recognition and degradation by host restriction endonucleases, thereby enhancing genome stability and increasing bacteriophage survival rate. The formation of 5-ghmC can affect protein-DNA recognition and binding, thereby regulating the transcription and replication of T4 bacteriophage genes. β-GT has high specificity for 5-hmC and can be used as an effective tool for detecting 5-hmC in the epigenome of mammals. Traditional β-GT detection methods include chromatographic analysis, radiochemical detection, spectrophotometry and immunological techniques. However, these methods generally have the disadvantages of high equipment cost, complicated operation and radioactivity hazards.

[0003] New detection strategies developed in recent years include gold nanoparticles / Nafion membrane electrochemiluminescence method, tungsten disulfide nanosheet / gold nanoparticle photoelectrochemical method and gold nanocluster electroluminescence method. Although these detection methods have the advantages of high selectivity, cost-effectiveness and no radioactivity, they still have limitations such as long time-consuming, complicated steps and complex synthesis of nanomaterials. SUMMARY

[0004] To solve the above problems, the application discloses a method for ultra-sensitivity detection of beta-glucosyltransferase (beta-GT) activity based on a CRISPR nanosensor. The application constructs a nanosensor based on CRISPR / Cas, integrates 5-hmC glycosylation triggered palindromic primer hyperbranched rolling circle amplification (PP-HRCA), and realizes ultra-sensitivity detection of beta-GT activity at a single molecule level in vitro. A 5-hmC modified multifunctional dumbbell probe is designed, and target recognition, palindromic isothermal amplification and enzyme cutting sites are integrated into a single probe system. The nanosensor can accurately quantify the beta-GT activity in a complex biological matrix, and is used for inhibitor screening and enzyme kinetics analysis.

[0005] The application comprises the following technical solutions:

[0006] A method for ultra-sensitivity detection of beta-GT activity based on a CRISPR nanosensor, comprising the following steps:

[0007] (a) incubating a sample containing beta-GT with 5-hmC modified dumbbell probes and UDP-Glc in a reaction buffer, so that beta-GT catalyzes 5-hmC glycosylation to form 5-ghmC;

[0008] (b) adding restriction endonuclease MspI to digest the dumbbell probes that are not glycosylated;

[0009] (c) adding palindromic primers and phi29 DNA polymerase to perform hyperbranched rolling circle amplification (PP-HRCA), to generate double-stranded DNA products;

[0010] (d) mixing the amplification products with a Cas12a-crRNA complex and a signal probe, to activate the transcleavage activity of Cas12a;

[0011] (e) detecting the fluorescence signal released after the signal probe is cut.

[0012] Further, in the above detection method, the sequence of the dumbbell probe in step (a) comprises 5'-P-TTTTATCATCGC (5-hmC)

[0013] GGATGCACCATTGCGCAATCAGCATCCGGCGATGATAAAAGGCTAGAAGCACCATTGCGCAATCAGCTTCTAGCC-3', the stem part contains an MspI recognition site CCGG, and the loop part contains a palindromic sequence.

[0014] Further, in the above detection method, the sequence of the palindromic primer in step (c) is 5'-ATTGCGCAAT-3', which is complementary to the palindromic sequence in the loop part of the dumbbell probe.

[0015] Further, in the above-mentioned detection method, the step (c) is performed under the following conditions: 2 U phi29 DNA polymerase, 600 μM dNTPs, 300 nM palindromic primer, 1x phi29 DNA polymerase reaction buffer, including 50 mM Tris-HCl, 10 mM MgCl2, 10 mM (NH4)2SO4, 4 mM DTT, pH 7.5, and reaction at 37℃ for 25 minutes.

[0016] Further, in the above-mentioned detection method, the crRNA sequence in the step (d) is 5'-GGGUAAUUUCUACUAAGUGUAGAUUCAUCGCCGGAUGCACCAUUG-3', and the signal probe is 5'-Cy5-TTATT-BHQ2-3'.

[0017] Further, in the above-mentioned detection method, the step (e) is detected by a fluorescence spectrophotometer with an excitation wavelength of 650 nm and an emission wavelength of 665 nm, and / or imaged by a single-molecule fluorescence microscope with a 100-fold oil lens and an EMCCD camera to collect the Cy5 signal.

[0018] Further, in the above-mentioned detection method, the detection limit of the method is 2.75x10 -6 U / mL in a single-molecule detection mode, or 2.69x10 -5 U / mL in a fluorescence spectrum detection mode.

[0019] The application discloses an application of the above-mentioned detection method in detection of a complex biological matrix, and the complex biological matrix is a serum sample or a cell lysate.

[0020] The application also discloses a β-GT inhibitor screening method, which detects the change of β-GT activity in the presence of an inhibitor by using any one of the above-mentioned methods, and the inhibitor includes 5'-UDP-Na2 or 4-phenylimidazole.

[0021] The application also discloses a β-GT enzyme kinetic parameter determination method, which detects the reaction rate under different substrate concentrations by using any one of the above-mentioned methods.

[0022] Compared with the prior art, the application has the following outstanding beneficial effects:

[0023] The application discloses a method for ultra-sensitivity detection of beta-glucosyltransferase activity based on a CRISPR nanosensor. The MspI endonuclease can specifically cut the 5-hmC modified dumbbell probe without glycosylation, effectively inhibits non-specific amplification to reduce background signals; compared with traditional rolling circle amplification, the palindromic primer hyperbranched rolling circle amplification (PP-HRCA) has higher amplification efficiency, thereby endowing the CRISPR nanosensor with high sensitivity characteristics; the double-stranded DNA generated by the PP-HRCA can activate the CRISPR / Cas system, effectively eliminating the background signals caused by non-specific trans-cleavage activity; the ultra-high signal-to-noise ratio of single molecule detection makes the background signal negligible; the operation process of the CRISPR nanosensor is simple, and the detection can be completed under isothermal homogeneous conditions without complex fixing, separation and washing steps. In addition, only the recognition sequence and the type of restriction endonuclease need to be adjusted, and the nanosensor can be adapted to the detection of various DNA modification enzymes, thereby providing wide application prospects for epigenetic research and innovative drug development. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 (A) the molecular mechanism mode diagram of the 5-hmC glycosylation mediated by beta-GT to protect the DNA substrate from MspI enzyme cutting; (B) the working flow chart of the nanosensor based on the CRISPR / Cas system; (B) the ultra-sensitivity detection of extracellular proteins containing beta-GT; (C) the control analysis without beta-GT;

[0025] Figure 2 the secondary structure prediction and functional region analysis of the linear dumbbell probe; the blue sequence represents the complementary sequence of the palindromic primer;

[0026] Figure 3 (A) the glycosylation reaction mode diagram catalyzed by beta-GT, and the protection mechanism of 5-ghmC to the DNA substrate from MspI enzyme cutting; (B) 12% non-denaturing PAGE electrophoretic analysis of the 5-hmC modified dumbbell probe cut by MspI; M lane: 20bp DNA marker; 1 lane: 5-hmC dumbbell probe; 2 lane: beta-GT+5-hmC dumbbell probe+UDP-Glc+MspI; 3 lane: 5-hmC dumbbell probe+UDP-Glc+MspI; (C) the palindromic primer hyperbranched rolling circle amplification (PP-HRCA) triggered by 5-hmC glycosylation and the activation mode diagram of the CRISPR / Cas12a system; (D) 12% non-denaturing PAGE electrophoretic analysis of the products of the 5-hmC glycosylation triggered PP-HRCA; (E) 12% non-denaturing PAGE electrophoretic analysis of the products of the CRISPR / Cas12a system cutting reaction. 1 lane: containing beta-GT; 2 lane: without beta-GT;

[0027] Figure 4(A) β-GT activated CRISPR / Cas nanosensor mode diagram; (B) Cy5 fluorescence spectra of dumbbell probe (DP) nanosensor, DP-1 nanosensor and control group; (C) Single molecule imaging in the presence and absence of β-GT; scale bar, 3 μm; (D) Quantitative comparison of the number of Cy5 fluorescent spots in the absence (gray) and presence (green) of β-GT; (E) Point spread function of Cy5 fluorescent spots in single molecule images; (F) Time trace of Cy5 fluorescent spots. 100 U / mL of β-GT was used in the experiment; ***P < 0.001; error bars represent mean ± standard deviation (n = 3);

[0028] Figure 5 (A) Cy5 fluorescence spectra at different β-GT concentrations; (B) Cy5 fluorescence intensity as a function of concentration at different β-GT concentrations; (C) Linear relationship between Cy5 fluorescence intensity and the logarithm of β-GT concentration; (D) Histogram showing the number of Cy5 fluorescent spots at different β-GT concentrations; (E) Number of Cy5 fluorescent spots as a function of β-GT concentration; (F) Chemical structures of C, 5-mC, 5-hmC and 5-ghmC; (G) Cy5 fluorescent spot numbers of C-DP, 5-mC-DP, 5-hmC-DP and control group; (H) Cy5 fluorescent spot numbers of negative control, UDG, Hhal, Dam, BSA, rSAP and β-GT; (I) Cy5 fluorescent spot numbers of negative control and six enzymes (UDG / Hhal / Dam / BSA / rSAP / β-GT); (J) Cy5 fluorescent spot numbers of β-GT and its mixtures with Hhal, Dam, UDG, rSAP, respectively; β-GT concentrations were 100 U / mL, 10 U / mL or 1 U / mL, respectively; ***P < 0.001; error bars represent mean ± standard deviation (n = 3);

[0029] Figure 6: (A) Schematic diagram of inhibition experiment mode with 5'-UDP-Na2 and 4-phenylimidazole as representative β-GT inhibitors; inset is the molecular structure of 5'-UDP-Na2 and 4-phenylimidazole; (B) Relative activity of β-GT with 5'-UDP-Na2 concentration; (C) Cy5 fluorescence signal comparison with or without β-GT in the presence of 5'-UDP-Na2; (D) Cy5 signal intensity heat map analysis based on nanosensor detection; (E) Relative activity of β-GT with 4-phenylimidazole concentration; (F) Cy5 fluorescence signal comparison with or without β-GT in the presence of 4-phenylimidazole; (G) Heat map showing the number of Cy5 fluorescence spots detected by CRISPR nanosensor; (H) Initial reaction rate with UDP-Glc concentration; (I) Initial reaction rate as a function of dumbbell probe concentration; ***P < 0.001; error bars represent mean ± standard deviation (n = 3);

[0030] Figure 7 : (A) Recovery rate of β-GT in PBS buffer and different concentrations of human serum (1% and 5%); (B) Cy5 fluorescence spot count of negative control, 1% human serum, β-GT and 1% human serum mixed with β-GT; (C-E) Linear relationship between input concentration and detected concentration of β-GT in 1% human serum, 5% human serum and PBS buffer; (F) Cy5 fluorescence spot count of negative control, HeLa cell protein lysate, LO2 cell protein lysate, HEK-293T cell protein lysate, β-GT and its mixture with three kinds of cell protein lysates, respectively; (G-I) Linear relationship between input concentration and detected concentration of β-GT in HeLa (G), LO2 (H) and HEK-293T (I) cell protein lysates; ***P < 0.001; error bars represent mean ± standard deviation (n = 3);

[0031] Figure 8(A) Workflow of β-GT overexpression plasmid transfection and β-GT activity analysis; (B) Confocal fluorescence imaging of HEK-293T, HeLa and LO2 cells transfected with β-GT overexpression plasmid; (C-E) Relationship between Cy5 fluorescence signal intensity and the number of HEK-293T, HeLa and LO2 cells transfected with β-GT overexpression plasmid; scale bar, 3 μm; (F) Western blot detection of β-GT expression level in HEK-293T, HeLa and LO2 cells transfected with empty plasmid (Vector) and β-GT overexpression plasmid (β-GT-OE); (G) ELISA detection of β-GT expression level in HEK-293T, HeLa and LO2 cells transfected with Vector and β-GT overexpression plasmid; ***P < 0.001; error bars represent mean ± standard deviation (n = 3). DETAILED DESCRIPTION

[0032] (1) Design and purification of 5-hmC modified dumbbell probe

[0033] The dumbbell probe was prepared by E. coli DNA ligase acting on the 5' phosphorylated linear dumbbell probe. The dumbbell probe ligation reaction was carried out in a 10 μL system, containing 1 μL of 1 × E. coli DNA ligase reaction buffer and 2 μL of linear dumbbell probe (100 μM). After 5 minutes of reaction at 95 °C, the reaction was cooled to room temperature on a water bath. Then 5 U of E. coli DNA ligase was added to the reaction mixture, and the reaction system was adjusted to 15 μL. The ligation reaction was carried out at 16 °C for 2 hours. The ligation reaction product was inactivated by 80 °C water bath treatment for 10 minutes. In the purification process, 15 μL of ligation product and 1 × NEBuffer TM 1, 1 × NEBuffer TM r3.1, 10 U of Exo III and 10 U of Exo I were mixed into a 20 μL system, and after incubation at 37 °C for 40 minutes, the enzyme digestion reaction was terminated by inactivation treatment at 80 °C for 20 minutes. The final 10 μM 5-hmC modified dumbbell probe stock solution was stored at -20 °C for standby.

[0034] The base sequence of the linear dumbbell probe is: 5'-P-TTT TAT CAT CGC(5-hmC)GG ATG CAC CATTGC GCA ATC AGC ATC CGG CGA TGA TAA AAG GCT AGA AGC ACC ATT GCG CAA TCAGCTTCT AGC C-3' = SEQ ID NO. 1.

[0035] The 1x E. coli DNA ligase reaction buffer includes 30 mM Tris-HCl, 4 mM MgCl2, 26 μM NAD, 1 mM DTT, 50 μg / mL recombinant albumin, pH 8. E. coli DNA ligase can catalyze the 5'-phosphate end and 3'-hydroxyl end of two adjacent DNA strands to form a phosphodiester bond. 1x NEBuffer TM 1 includes 10 mM Bis-Tris-Propane-HCl, 10 mM MgCl2, 1 mM DTT, pH 7. 1x NEBuffer TM r3.1 includes 100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 100 μg / mL recombinant albumin, pH 7.9. Exo III and Exo I are exonucleases that further purify the dumbbell probe by degrading single-stranded DNA and non-specific double-stranded DNA.

[0036] (2) A method for ultra-sensitive detection of β-GT activity based on a CRISPR nanosensor using 5-hmC modified dumbbell probes for palindromic primer hyperbranched rolling circle amplification (PP-HRCA), specifically comprising the following steps:

[0037] ① The enzymatic reaction was performed in a 10 μL system containing different concentrations of β-GT, 100 nM dumbbell probe, 120 μM UDP-Glc, and 1x NEBuffer 4. Incubation was performed at 37°C for 60 minutes.

[0038] ② 5U MspI and 1x rCutSmart buffer were added to the above reaction system to form a 15 μL reaction system, and MspI was digested at 37°C for 4 hours. The reaction was terminated by heat inactivation at 95°C for 10 minutes, followed by ice bath cooling for 30 seconds before proceeding to the next step.

[0039] ③ The palindromic primer hyperbranched rolling circle amplification (PP-HRCA) reaction was performed in a 20 μL system containing 15 μL MspI digestion product, 2U phi29 DNA polymerase, 600 μM dNTPs, 300 nM palindromic primer, and 1x phi29 DNA polymerase reaction buffer. The reaction mixture was incubated at 37°C for 25 minutes.

[0040] ④ Then 50 nM crRNA, 50 nM Lba Cas12a (Cpf1), and 1.5 μM signal probe were added to the above reaction solution, and the total reaction system volume was supplemented to 30 μL. The reaction system was continued to incubate at 37°C for 30 minutes.

[0041] (5) Take 30 μL of the reaction product and dilute to a final volume of 50 μL with ultrapure water. Use a fluorescence spectrophotometer to record the fluorescence emission spectrum, with an emission and excitation slit width of 5 nm. The excitation wavelength of the Cy5 fluorescence emission spectrum is 650 nm, and the detection wavelength is 665 nm. Record the fluorescence intensity for data analysis.

[0042] (6) After diluting the reaction product 10,000 times, single molecule imaging was performed using a fluorescence microscope equipped with a 650 nm laser. Cy5 fluorescence signals were collected through a 100x oil objective and recorded using an EMCCD camera. ImageJ software was used to process and analyze the 300x300 pixel region of interest. Ten images were collected and averaged for data evaluation.

[0043] The crRNA base sequence is: 5'-GGG UAA UUU CUA CUA AGU GUA GAU UCA UCG CCG GAU GCA CCA UUG-3' = SEQ ID NO. 2.

[0044] The signal probe base sequence is: 5'-Cy5-TTA TT-BHQ2-3'.

[0045] The palindromic primer sequence is: 5'-ATT GCG CAA T-3' = SEQ ID NO. 3.

[0046] The 1x NEBuffer 4 includes 20 mM Tris-acetate, 50 mM potassium acetate, 1 mM DTT, 10 mM magnesium acetate, pH 7.9. UDP-Glc is an activated donor of glucose group, and is a component of the β-GT product. MspI is a restriction endonuclease that can recognize specific DNA sequences (CCGG) and cut DNA at that site. 1x rCutSmart buffer is the reaction buffer solution included in the MspI product, which includes 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mg / mL recombinant albumin, pH 7.9. phi29 DNA polymerase is a highly efficient DNA polymerase encoded by the bacteriophage Phi29, commonly used for DNA isothermal amplification. 1x phi29 DNA polymerase reaction buffer is the reaction buffer included in the phi29 DNA polymerase product, which includes 10 mM MgCl2, 50 mM Tris-HCl, 4 mM DTT, 10 mM (NH4)2SO4, pH 7.5. Lba Cas12a (Cpf1) is a commercially produced Cas12a (formerly Cpf1) nuclease variant, a new type of CRISPR-associated enzyme, commonly used for gene editing and molecular detection.

[0047] In the dumbbell probe, "P" represents a phosphate group modification. In the signal probe, the 3' end and 5' end are modified with BHQ2 and Cy5, respectively.

[0048] The present application is a method for in vitro ultra-sensitive detection of β-GT activity based on a CRISPR nanosensor, using 5-hmC modified dumbbell probes for palindromic primer hyperbranched rolling circle amplification (PP-HRCA), with a minimum detection limit of 2.75 x 10 -6 U / mL.

[0049] Materials and reagents:

[0050] All oligonucleotide chains were synthesized by Shanghai Shengong Bioengineering Co., Ltd. T4 phage β-GT, 1x NEBuffer 4 (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM DTT, pH 7.9), UDP-Glc, MspI, 1x rCutSmart (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mg / mL recombinant albumin, pH 7.9), phi29 DNA polymerase, 1x phi29 DNA polymerase reaction buffer (50 mM Tris-HCl, 10 mM MgCl2, 10 mM (NH4)2SO4, 4 mM DTT, pH 7.5), E. coli DNA ligase, Lba Cas12a (Cpf1), 1x E. coli DNA ligase reaction buffer (30 mM Tris-HCl, 4 mM MgCl2, 26 μM NAD, 1 mM DTT, 50 μg / mL recombinant albumin, pH 8), Exo III, Exo I, 1x NEBuffer TM r3.1 (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 100 μg / mL recombinant albumin, pH 7.9), 1x NEBuffer TMTransfection kits (10 mM Bis-Tris-Propane-HCl, 10 mM MgCl2, 1 mM DTT, pH 7), Dam, UDG, HhaI, BSA, rSAP, and Lipofectamine 3000 were purchased from New England Biolabs (Beverly, MA, USA). dNTPs mixing solution was purchased from Changsha Aikerui Biotechnology Co., Ltd. 4-phenylimidazole and 5′-UDP-Na2 were purchased from Sigma-Aldrich (St. Louis, MO, USA). Human cervical cancer cells (HeLa cells), normal human hepatocytes (LO2 cells), and human embryonic kidney 293T cells (HEK-293T cells) were purchased from the Cell Bank of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. Plasmids were purchased from Jinan Boshan Biotechnology Co., Ltd. Ultrapure water was prepared using a Millipore ultrafiltration system (Millipore, Milford, MA, USA).

[0051] Unless otherwise specified, all reagents or instruments used in the embodiments of this invention are commercially available conventional reagent products.

[0052] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0053] Example 1

[0054] A method for detecting β-GT activity using nanosensors based on the CRISPR / Cas system

[0055] We have invented a CRISPR / Cas-based nanosensor that utilizes 5-hmC glycosylation-triggered palindromic primer hyperbranched rolling circle amplification (PP-HRCA) to achieve ultrasensitive detection of β-GT. Figure 1 First, a 5-hmC-modified dumbbell probe, palindromic primers, crRNA, and signal probe were designed. The dumbbell probe contains two functional regions: a loop and a stem. Figure 2). Each loop of the dumbbell probe contains a 10-bp palindromic sequence (5'-TAA CGC GTT A-3') as the binding site for the palindromic primer to initiate PP-HRCA. The stem of the dumbbell probe contains a MspI recognition site (5'-ChmCGG-3' / 5'-CCGG-3'). The signal probe is labeled with a Cy5 fluorescent group at the 5' end and a BHQ2 quenching group at the 3' end. Based on the fluorescence resonance energy transfer effect, the Cy5 fluorescence is effectively quenched by the BHQ2. This detection method contains four consecutive steps:

[0056] Step one, overexpression of β-GT plasmid transfection into cells and extraction of total cell protein;

[0057] Step two, β-GT in total cell protein catalyzes 5-hmC dumbbell probe glycosylation to form 5-ghmC dumbbell probe to resist MspI enzyme digestion;

[0058] Step three, palindromic primer mediated PP-HRCA produces a large amount of high molecular weight double-stranded DNA, which activates the CRISPR / Cas system to cut the signal probe to release the Cy5 fluorescence signal;

[0059] Step four, detect the Cy5 fluorescence signal by fluorescence spectrometer and single molecule microscopic imaging.

[0060] The base sequence of the linear dumbbell probe: 5'-P-TTT TAT CAT CGC(5-hmC)GG ATG CAC CATTGC GCA ATC AGC ATC CGG CGA TGA TAA AAG GCT AGA AGC ACC ATT GCG CAA TCA GCTTCT AGC C-3'= SEQ ID NO. 1.

[0061] The base sequence of the crRNA: 5'-GGG UAA UUU CUA CUA AGU GUA GAU UCA UCG CCG GAUGCA CCA UUG-3'= SEQ ID NO. 2.

[0062] The base sequence of the signal probe: 5'-Cy5-TTA TT-BHQ2-3'.

[0063] The sequence of the palindromic primer: 5'-ATT GCG CAA T-3'= SEQ ID NO. 3.

[0064] The purpose of this invention is to design a 5-hmC-modified dumbbell probe that integrates target recognition, palindromic isothermal amplification, and enzyme cleavage site functions, and to achieve ultrasensitive detection of β-GT activity at the single-molecule level using a CRISPR-based nanosensor with palindromic primer hyperbranched rolling circle amplification (PP-HRCA). This nanosensor can accurately quantify β-GT activity in complex biological matrices. This method is convenient, rapid, inexpensive, and highly sensitive, making it suitable for widespread application in inhibitor screening and enzyme kinetic analysis.

[0065] Example 2

[0066] Verification of the feasibility of the detection method in Example 1

[0067] PAGE imaging technology was used to verify the feasibility of detecting β-GT activity based on CRISPR nanosensors. For example... Figure 3 As shown in Figure A, the β-GT-mediated 5-hmC glycosylation modification reaction to form a 5-ghmC dumbbell probe blocks MspI cleavage of the dumbbell probe. Conversely, in the absence of β-GT, 5-hmC does not undergo glycosylation modification, and MspI cleaves the dumbbell probe into two fragments. Figure 3 F1 and F2 in A). We analyzed the MspI digestion products after 5-hmC glycosylation using 12% non-denaturing PAGE electrophoresis. In the system where β-GT, 5-hmC dumbbell probe, UDP-Glc, and MspI coexisted, only the 5-hmC dumbbell probe was observed to be present. Figure 3 Lane B, 1) corresponds to the 88bp single band ( Figure 3 Lane B (2), indicating that β-GT-mediated 5-hmC glycosylation effectively prevents MspI cleavage of the dumbbell probe. Conversely, when β-GT is absent, 61bp and 27bp bands corresponding to the two cleavage fragments can be observed ( Figure 3 The assays in lane B, specifically F1 and F2 in lane 3, confirmed that MspI could cleave the unglycosylated 5-hmC dumbbell probe. To verify the 5-hmC glycosylation-triggered palindromic primer hyperbranched rolling circle amplification reaction (PP-HRCA), further studies were conducted. Figure 3 C), we performed 12% non-denaturing PAGE electrophoresis analysis. No PP-HRCA product bands were detected when β-GT was absent. Figure 3 Lane D (1). However, in the presence of β-GT, a slower-migrating PP-HRCA product band can be observed because the PP-HRCA product is a high-molecular-weight double-stranded DNA. Figure 3 Lane D (2). We further verified the feasibility of CRISPR nanosensors by combining 12% non-denaturing PAGE with Cy5 direct excitation ( Figure 3 E). When β-GT is present, the Cy5 signal probe is cut, producing a distinct red band (E). Figure 3Lane 1), indicating that the PP-HRCA product triggered by the glycosylated 5-hmC dumbbell probe can successfully activate the transcleavage activity of the CRISPR / Cas12a system. In contrast, no obvious red band was observed without β-GT (lane 2). Figure 4 E Lane 2).

[0068] Fluorescence spectroscopy assay verified the feasibility of this nanosensor Figure 4 A). We designed a conventional nanosensor based on a single palindromic domain dumbbell probe (DP-1) for comparison with a double palindromic domain dumbbell probe nanosensor (DP-nanosensor). As shown in Figure 4 B, the Cy5 fluorescence background signal was negligible without β-GT. The fluorescence signal generated by the DP-nanosensor was significantly higher than that of the DP-1-nanosensor when β-GT was present, because the dumbbell probe contained a double palindromic domain, which allowed the palindromic primer to hybridize to either palindromic region and initiate PP-HRCA for efficient amplification. Single-molecule imaging further verified the feasibility of the DP-nanosensor. The number of Cy5 fluorescence spots generated by the DP-nanosensor was significantly higher than that of the DP-1-nanosensor when β-GT was present, and the DP-nanosensor had almost no Cy5 fluorescence spots without β-GT Figure 4 C). The number of Cy5 fluorescence spots generated by the DP-nanosensor was 16.04 times higher when β-GT was present than when it was not Figure 4 D, P<0.001). Point spread function analysis of Cy5 fluorescence spots showed that the DP-nanosensor had a better signal-to-noise ratio Figure 4 E). One-step photobleaching analysis confirmed that a single Cy5 molecule corresponded to a single fluorescence spot Figure 5 F), indicating that the DP-nanosensor had the ability to detect β-GT at the single-molecule level.

[0069] Dumbbell probe-1 (DP-1) base sequence: 5'-P-TTT TAT CAT CGC(5-hmC)GG ATG CAC CAT TGC GCA ATC AGC ATC CGG CGA TGA TAA AAG GCT AGA AGC ACC TTA CCT GTC ACA GCT TCT AGC C-3' = SEQ ID NO. 4.

[0070] Example 3

[0071] Sensitivity and specificity detection of the method of Example 1

[0072] Based on optimized experimental parameters, we evaluated the detection sensitivity of this method by detecting Cy5 fluorescence intensity at different β-GT concentrations. Within a specific wavelength range, the fluorescence intensity increased proportionally with increasing β-GT concentration. Figure 5 A). When the β-GT concentration increases from 1×10 -4 When the U / mL was increased to 100 U / mL, the fluorescence intensity of Cy5 showed a gradual increase. Figure 5 B). In 1×10 -4 In the concentration range up to 100 U / mL, the fluorescence intensity (F) of Cy5 was correlated with the logarithm of the β-GT concentration (log). 10 C) shows a linear relationship ( Figure 5 C), the fitted equation is F = 7062.99 + 1326.51log 10 C(R² = 0.9997). The detection limit was found to be 2.69 × 10⁻⁶. -5 U / mL. In single-molecule detection, the number of Cy5 fluorescent spots increases accordingly with increasing β-GT concentration. Figure 5 D). Quantitative analysis showed that at 1×10 -5 Within the concentration range up to 100 U / mL, the Cy5 fluorescence spot count (N) and log 10 C has a linear relationship (R) 2 =0.9992)( Figure 5 E), whose mathematical expression is N = 252.79 + 41.12log 10 C. The single-molecule detection limit is as low as 2.75 × 10⁻⁶ U / mL, significantly superior to fluorescence detection methods. Notably, the single-molecule detection sensitivity is 14545.45 times higher than that of the enzyme-linked reaction-based electrochemiluminescence method (0.04 U / mL), 10181.82 times higher than that of the WS₂ nanosheet photochemical detection method (0.028 U / mL), and higher than that of the rolling circle transcription amplification fluorescence biosensor (2.03 × 10⁻⁶ U / mL). -5 The specificity of the CRISPR nanosensor was increased by 7.38-fold (U / mL). Two interfering probes (5-C modified dumbbell probe and 5-mC modified dumbbell probe) were used to evaluate the specificity of the CRISPR nanosensor. Figure 5 F). Figure 5 G showed that the number of Cy5 fluorescent spots generated by the 5-hmC dumbbell probe was 10.17 times and 9.69 times that of the 5-C modified dumbbell probe and the 5-mC modified dumbbell probe, respectively. This indicates that the lack of hydroxyl groups in 5-C and 5-mC inhibits β-GT-mediated glycosylation. At the same time, MspI digestion of the 5-C dumbbell probe and the 5-mC dumbbell probe blocked the trans-cleavage of PP-HRCA and CRISPR / Cas12a.

[0073] To evaluate the specificity of the CRISPR nanosensor in detecting β-GT, UDG, Dam, HhaI, BSA, and rSAP were selected as potential interfering agents. Figure 5 As shown in H, UDG, HhaI, Dam, BSA, and rSAP produce very few Cy5 fluorescent spots. However, the presence of β-GT produces more Cy5 fluorescent spots. The radar plot visually illustrates these results. Figure 6 I). The anti-interference capability of the CRISPR nanosensor was further evaluated by formulating mixed systems containing different concentrations of β-GT and non-specific proteins. Figure 6 J). At three concentration gradients of 100 U / mL, 10 U / mL, and 1 U / mL, there was no significant difference in the Cy5 signal generated by β-GT alone and in combination with HhaI, Dam, UDG, and rSAP, respectively, confirming that the CRISPR nanosensor has excellent anti-interference performance.

[0074] Example 4

[0075] Enzyme inhibition and kinetic detection of the method in Example 1

[0076] In the enzyme inhibition experiment, 5′-UDP-Na2 and 4-phenylimidazole were used as β-GT inhibitors. Figure 6 A). For example Figure 6 As shown in Figure B, β-GT activity exhibited concentration-dependent inhibition when the 5′-UDP-Na2 concentration increased from 0.5 μM to 80 μM. The measured half-maximal inhibitory concentration (IC50) was 19.16 μM, consistent with the value obtained from the fluorescent biosensor based on rolling circle transcription amplification (21.26 μM). In the presence of β-GT alone, the Cy5 fluorescence spot count was significantly higher than that of the 5′-UDP-Na2 inhibitor group (…). Figure 6 C). Figure 6 The D-scan showed a positive correlation between Cy5 fluorescence spot count and β-GT concentration, and a negative correlation with 5′-UDP-Na2 concentration. These results indicate that 5′-UDP-Na2 can effectively inhibit β-GT activity. Figure 6 E showed that the relative activity of β-GT gradually decreased with increasing 4-phenylimidazole concentration. The measured IC50 value was 5.16 μM, which is in high agreement with the result obtained by the novel photoelectrochemical detection method based on tungsten disulfide nanosheets (5.06 μM). The Cy5 fluorescence spot count without 4-phenylimidazole was 3.92 times that with the inhibitor (…). Figure 6 F). Figure 7G confirmed that the Cy5 fluorescence spot count was positively correlated with β-GT concentration and negatively correlated with 4-phenylimidazole concentration. This result confirms that the developed CRISPR nanosensor can serve as an effective tool for screening β-GT inhibitors. We further investigated the enzyme kinetics of β-GT using two substrates (5-hmC-modified dumbbell probe and UDP-Glc). When the UDP-Glc concentration increased in the range of 5-120 μM, the initial reaction rate showed a gradual increase. Figure 7 H). Mie kinetic analysis shows K m The value is 9.68 μM, V max 39.71 min -1 K obtained by radioactive analysis m The values ​​(16 μM) were consistent. Similarly, the initial reaction rate increased accordingly when the concentration of the 5-hmC dumbbell probe increased from 0.05 μM to 0.5 μM. Figure 7 I), K was measured m Values ​​0.11 μM and V max Value 45.01min -1 K obtained from a fluorescent biosensor based on a hybridization chain reaction m The values ​​(0.10 μM) were consistent. These results indicate that the CRISPR nanosensor can accurately determine the enzyme kinetic parameters of β-GT.

[0077] Example 5

[0078] Verification of the application of the method described in Example 1 for detecting β-GT activity in complex biological matrices

[0079] We evaluated the detection capability of CRISPR nanosensors in complex biological matrices by adding different concentrations of β-GT to human serum (1% and 5%) and PBS. The Cy5 fluorescence spot counts observed in the serum matrix were highly consistent with the results in PBS. Figure 7 A). When β-GT is absent, the Cy5 fluorescence spot counts in both the control group and the human serum group showed negligible background signal. Figure 7 B). However, a higher Cy5 fluorescence spot count was detected in the mixture of β-GT and 1% human serum, consistent with the count in the β-GT group ( Figure 7 B). When 0.01-100 U / mL of β-GT was added to 1% or 5% human serum and PBS, a good linear relationship was observed between the input concentration and the logarithm of the detected concentration. Figure 8C-E). The above results show that the CRISPR nanosensor exhibits the ability to accurately detect the activity of β-GT in complex biological matrix. We further evaluated the performance of the CRISPR nanosensor in detecting the activity of β-GT in Hela, LO2 and HEK-293T cell protein lysates. The background signal was detected in PBS and three cell protein lysates, while the number of Cy5 fluorescent dots was consistent with the results of β-GT detected in the mixture of β-GT and each cell protein lysate, respectively Figure 8 F). The logarithmic values of input concentration and detection concentration also showed a strong linear correlation Figure 8 G-I), indicating that the CRISPR nanosensor can be used for accurate detection of the activity of β-GT in cell protein lysates.

[0080] To verify the practical application performance of the nanosensor, we transfected the β-GT overexpression plasmid into HEK-293T, HeLa and LO2 cells Figure 8 A). Figure 8 B shows that the EGFP fluorescence intensity of HEK-293T cells is significantly higher than that of HeLa and LO2 cells, indicating that the transfection efficiency of the β-GT overexpression plasmid is better. Subsequently, we used the CRISPR nanosensor to detect the expression level of β-GT in the protein lysates of HEK-293T, HeLa and LO2 cells. ​ C-E shows that the number of Cy5 fluorescent dots gradually increases with the increase of cell number (1 to 10000), suggesting that the CRISPR nanosensor has the ability of single cell detection. In addition, we compared the expression level of β-GT under different treatment conditions by Western blot ​ F). Compared with the empty plasmid transfection group (Vector), the expression level of β-GT in HEK-293T, HeLa and LO2 cells was significantly improved, and the expression level in HEK-293T cells was the highest. The expression level of β-GT in three cells (HEK-293T, HeLa and LO2) transfected with Vector and β-GT overexpression plasmid was quantitatively detected by ELISA method, and the results were consistent with Western blot ​ G), confirming that the CRISPR nanosensor can accurately detect the activity of exogenous β-GT in complex biological matrix.

[0081] The above shows and describes the basic principles, main features and advantages of the present application. Those skilled in the art should understand that the above examples do not limit the present application in any form, and any technical solutions obtained by equivalent substitution or equivalent transformation fall within the protection scope of the present application.

Claims

1. A method for ultra-sensitive detection of β-glucosyltransferase (β-GT) activity based on CRISPR nanosensor, characterized in that, The method comprises the following steps: (a) incubating the sample containing β-GT with 5-hmC modified dumbbell probe, UDP-Glc in reaction buffer, allowing β-GT to catalyze 5-hmC glycosylation to form 5-ghmC; (b) adding restriction endonuclease MspI to digest the dumbbell probe not glycosylated; (c) adding palindromic primer and phi29 DNA polymerase to perform hyperbranched rolling circle amplification reaction (PP-HRCA), generating double-stranded DNA product; (d) mixing the amplification product with Cas12a-crRNA complex and signal probe, activating the transcleavage activity of Cas12a; (e) detecting the fluorescence signal released after the cleavage of the signal probe.

2. The method of claim 1, wherein: The sequence of the dumbbell probe in step (a) comprises: 5'-P-TTTTATCATCGC(5-hmC) GGATGCACCATTGCGCAATCAGCATCCGGCGATGATAAAAGGCTAGAAGCACCATTGCGCAATCAGCTTCTAGCC-3'=SEQ ID NO.1, wherein the stem part contains MspI recognition site CCGG, and the loop part contains palindromic sequence.

3. The method of claim 1, wherein: The sequence of the palindromic primer in step (c) is 5'-ATTGCGCAAT-3', which is complementary to the palindromic sequence of the loop part of the dumbbell probe.

4. The method of claim 1, wherein: The PP-HRCA in step (c) is performed under the following conditions: 2U phi29 DNA polymerase, 600μM dNTPs, 300nM palindromic primer, 1×phi29 DNA polymerase reaction buffer, including 50mM Tris-HCl, 10mM MgCl2, 10mM(NH4)2SO4, 4mM DTT, pH 7.5, reaction at 37℃ for 25 minutes.

5. The method of claim 1, wherein: The sequence of the crRNA in step (d) is 5'-GGGUAAUUUCUACUAAGUGUAGAUUCAUCGCCGGAUGCACCAUUG-3'=SEQ ID NO.2, and the signal probe is 5'-Cy5-TTATT-BHQ2-3'.

6. The method of claim 1, wherein: Step (e) is detected by fluorescence spectrophotometer, excitation wavelength 650nm, emission wavelength 665nm; and / or imaged by single molecule fluorescence microscope, Cy5 signal is collected by 100x oil objective and EMCCD camera.

7. The method of claim 1, wherein: The method has a detection limit of 2.75 x 10 -6 U / mL in single molecule detection mode; or 2.69 x 10 -5 U / mL in fluorescence spectroscopy detection mode.

8. Use of the method according to any one of claims 1 to 7 for the detection of complex biological matrices, characterized in that, The complex biological matrix is serum sample or cell protein lysate.

9. A method of screening for a β-GT inhibitor, characterized by, The method of any one of claims 1-8 is used to detect the change of β-GT activity in the presence of inhibitors, including 5'-UDP-Na2 or 4-phenylimidazole.

10. A method for determining a β-GT enzyme kinetic parameter, characterized by, The method of any one of claims 1-8 is used to detect the reaction rate under different substrate concentrations.

Images