Application of primer group for identifying polymorphic site combination in preparation of kit for predicting voriconazole blood concentration and kit

Abstract

The invention discloses application of a primer group for identifying a polymorphic site combination in preparation of a kit for predicting the metabolic capacity of voriconazole and the kit. The polymorphic site combination comprises an rs4244285 site, an rs4986893 site, an rs3740066 site, an rs4149056 site and an rs464637 site. According to the method, the voriconazole blood concentration can be effectively predicted, and the hysteresis and empirical limitations of traditional treatment medicine monitoring are overcome.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology. More particularly, the present application relates to the use of a primer set for identifying a combination of polymorphic sites in the preparation of a kit for predicting the blood concentration of voriconazole and the kit. BACKGROUND

[0002] Voriconazole, as a broad-spectrum antifungal drug of triazole class, is the core treatment for invasive aspergillosis after lung transplantation. Its efficacy and safety are highly dependent on the accurate control of blood trough concentration. The therapeutic window of this drug is significantly narrow (1.5-5.5 mg / L), and insufficient concentration may lead to failure of fungal clearance, while excessive concentration may easily cause dose-limiting toxicities such as hepatotoxicity, neurological dysfunction, and visual abnormalities. The maintenance of this therapeutic balance is particularly crucial for lung transplant patients with complex pathophysiological states.

[0003] The metabolic clearance of voriconazole is influenced by multiple factors. In the genetic aspect, CYP2C19 gene polymorphism constitutes a core determinant, and the US FDA and the Canadian Health Department have explicitly warned that the drug exposure of slow metabolizers can be up to 4 times that of fast metabolizers. It is worth noting that, in addition to the dominant metabolism of CYP2C19, CYP3A4 isozymes and drug transporters (such as ABCB1, SLCO2B1) also participate in the pharmacokinetic network, forming a multi-pathway interaction system. At the same time, non-genetic factors such as age, liver function status, and concomitant medication also play an important role. In addition, the lung transplant patient population has unique pharmacokinetic challenges. Lung transplant patients need to be combined with calcineurin inhibitors (such as tacrolimus, cyclosporine) for a long time after surgery, which competitively inhibit CYP3A4, further interfering with the clearance of voriconazole. At the same time, the early postoperative inflammatory response can down-regulate CYP enzyme activity, while the liver function recovers in the stable phase, which requires dose up-regulation.

[0004] Current clinical practice relies on therapeutic drug monitoring (TDM) for dose adjustment, but there are significant limitations: lagging behind: the first dose adjustment requires 72 hours after drug administration, delaying the optimal treatment opportunity; experience: ignoring the quantitative effects of genotypes and drug interactions, leading to repeated trial and error; existing pediatric pharmacokinetic models cannot be extrapolated to adult lung transplant populations - the latter have more complex concomitant medications and more dramatic changes in organ physiological status.

[0005] Therefore, there is an urgent need to develop a technical solution for predicting the blood concentration of voriconazole to achieve precise dosing of voriconazole in lung transplant patients. SUMMARY

[0006] The application aims to provide a primer set for a polymorphic site combination and a kit for predicting voriconazole blood concentration, which can effectively predict the blood concentration of voriconazole and overcome the lag and empirical limitations of traditional therapeutic drug monitoring.

[0007] In order to achieve the above objects and other advantages, according to one aspect of the application, the application provides a primer set for a polymorphic site combination in the preparation of a kit for predicting the blood concentration of voriconazole, wherein the polymorphic site combination comprises rs4244285, rs4986893, rs3740066, rs4149056 and rs4646437.

[0008] Further, the application method comprises the following steps: S1, obtaining the basic physical sign parameters of the patient, wherein the basic physical sign parameters comprise the body weight, body surface area, age and postoperative days of the patient; S2, obtaining the blood biochemical index parameters of the patient, wherein the blood biochemical index parameters comprise the concentration of glutamic-pyruvic transaminase, the concentration of total bilirubin and the concentration of urea; S3, obtaining the combined drug use state parameters of the patient, wherein the combined drug use state parameters comprise whether the patient simultaneously uses rabeprazole, atenolol or ethambutol; S4, obtaining the blood concentration of tacrolimus of the patient; S5, identifying the genotypes of rs4244285, rs4986893, rs3740066, rs4149056 and rs4646437; S6, inputting the parameters obtained in S1-S5 into a pre-established voriconazole blood concentration prediction formula, and outputting the blood concentration of voriconazole.

[0009] Further, the primer set for identifying the rs4244285 site is shown in SEQ ID No. 1 and SEQ ID No. 2; the primer set for identifying the rs4986893 site is shown in SEQ ID No. 3 and SEQ ID No. 4; the primer set for identifying the rs3740066 site is shown in SEQ ID No. 5 and SEQ ID No. 6; the primer set for identifying the rs4149056 site is shown in SEQ ID No. 7 and SEQ ID No. 8; and the primer set for identifying the rs4646437 site is shown in SEQ ID No. 9 and SEQ ID No. 10.

[0010] Further, the voriconazole blood concentration prediction formula is as follows: ln(C t )=θ1+θ2·X_dw+θ3·X_bsa+θ4·X_age+θ5·X_pod+θ6·X_tac+θ7·X_alt+θ8·X_tbil+θ9·X_urea+θ 10 ·R+θ 11 ·A+θ 12 ·E+θ 13• G_c2a + θ 14 • G_c2b + θ 15 • G_abc + θ 16 • G_slc + θ 17 • I_ga + θ 18 • I_gg + (1 | ID); C tVORICONAZOLE blood concentration; X dw is the standardized dose weight ratio, calculated by the formula ln(dose / weight)-ln(l), dose is the voriconazole dose expected to be used by the patient, and weight is the body weight of the patient; X bsa is the standardized body surface area, calculated by the formula ln(BSA)-ln(l), BSA is the body surface area of the patient; X age is the standardized age, calculated by the formula ln(age)-ln(60), age is the age of the patient; X pod is the standardized post-transplant day, calculated by the formula ln(POD)-ln(l), POD is the post-transplant day; X tac is the standardized tacrolimus blood concentration, calculated by the formula ln(Tac_conc)-ln(l), Tac_conc is the tacrolimus blood concentration of the patient; X alt is the standardized alanine aminotransferase concentration, calculated by the formula ln(ALT)-ln(42), ALT is the alanine aminotransferase concentration of the patient; X tbil is the standardized total bilirubin concentration, calculated by the formula ln(Tbil)-ln(23), Tbil is the total bilirubin concentration of the patient; X urea is the standardized urea concentration, calculated by the formula ln(Urea)-ln(7.85), Urea is the urea concentration of the patient; R represents the use of rabeprazole, with a value of 0 for non-use and a value of 1 for use; A represents the use of atenolol, with a value of 0 for non-use and a value of 1 for use; E represents the use of ethambutol, with a value of 0 for non-use and a value of 1 for use; G_c2a represents the rs4244285 genotype, with a value of 0 for the GG genotype and a value of 1 for the GA or AA genotype; G_c2b represents the rs4986893 genotype, with a value of 0 for the GG genotype and a value of 1 for the GA or AA genotype; G_abc represents the rs3740066 genotype, with a value of 0 for the CC genotype, a value of 1 for the CT genotype, and a value of 2 for the TT genotype; G_slc represents the rs4149056 genotype, with a value of 0 for the CC genotype, a value of 1 for the TC genotype, and a value of 2 for the TT genotype; I_ga represents the interaction of tacrolimus blood concentration and the rs4646437 GA genotype, with I_ga=X_tacx1 when the patient's rs4646437 genotype is GA, and I_ga=0 when the patient's rs4646437 genotype is not GA; I_gg represents the interaction of tacrolimus blood concentration and the rs4646437 GG genotype, with I_gg=X_tacx2 when the patient's rs4646437 genotype is GG, and I_gg=0 when the patient's rs4646437 genotype is not GG; (1|ID) represents the individual random effect, with a value of 0 for prediction of new patients; θ1, θ2, θ3, θ4, … θ 18 is a coefficient.

[0011] Further, the fixed effect value of θ1 is -5.2519, the fixed effect value of θ2 is 1.1183, the fixed effect value of θ3 is 2.6762, the value of θ4 is 0.5777, the value of θ5 is 0.1174, the value of θ6 is 0.6078, the value of θ7 is 0.1264, the value of θ8 is 0.0577, the value of θ9 is 0.2004, the value of θ 10 is 0.7626, the value of θ 11 is -0.3207, the value of θ 12 is -0.5744, the value of θ 13 is 0.2399, the value of θ 14 is 0.2541, the value of θ 17 is -0.0395, the value of θ 18 is -0.0513; when the genotype of the patient rs3740066 is CT, the value of θ 15 is 0.2455, when the genotype of the patient rs3740066 is TT, the value of θ 15 is -0.1356; when the genotype of the patient rs4149056 is TC, the value of θ 16 is 0.9347, when the genotype of the patient rs4149056 is TT, the value of θ 16 is 0.7592.

[0012] The application further provides a kit for predicting the blood concentration of voriconazole, comprising primers for identifying the rs4244285 site, the rs4986893 site, the rs3740066 site, the rs4149056 site and the rs4646437 site.

[0013] Further, the primer group for identifying the rs4244285 site is shown as SEQ ID No. 1, SEQ ID No. 2; the primer group for identifying the rs4986893 site is shown as SEQ ID No. 3, SEQ ID No. 4; the primer group for identifying the rs3740066 site is shown as SEQ ID No. 5, SEQ ID No. 6; the primer group for identifying the rs4149056 site is shown as SEQ ID No. 7, SEQ ID No. 8; and the primer group for identifying the rs4646437 site is shown as SEQ ID No. 9, SEQ ID No. 10.

[0014] Further, the kit further comprises reagents for detecting the concentration of glutamic-pyruvic transaminase, glutamic-oxaloacetic transaminase, total bilirubin, urea and the blood concentration of tacrolimus of the patient.

[0015] The application at least comprises the following beneficial effects: The present application realizes effective prediction of voriconazole blood concentration through specific polymorphism site combination, integrates genetic factors and clinical dynamic parameters (such as dose, body surface area, combined medication, etc.), overcomes the lag and empirical limitations of traditional therapeutic drug monitoring, can early and accurate intervention, optimizes the antifungal therapy of adult patients with lung transplantation, the prediction accuracy of clinical effective concentration reaches 84.4%, which helps to maintain the balance of therapeutic window, reduces the risk of toxicity reaction and treatment failure.

[0016] Other advantages, objects, and features of the present application will be apparent to those skilled in the art from the following specification. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1A The correlation of body weight corrected dose to voriconazole concentration is shown. Figure 1B The correlation of body surface area BSA to voriconazole concentration is shown. Figure 1C The correlation of age to voriconazole concentration is shown. Figure 1D The correlation of body weight to voriconazole concentration is shown.

[0018] Figure 2 The correlation between the predicted value and the true value of voriconazole concentration based on (A) the base model (Base Model only contains dose / weight and body surface area) and (B) the final model (Final Model). DETAILED DESCRIPTION

[0019] The present application will be further described in detail below, so that those skilled in the art can implement it according to the description of the specification.

[0020] It should be understood that the terms such as "have", "contain", and "include" used in the embodiments of the present application do not exclude the presence or addition of one or more other elements. All directional indications (such as upper, lower, left, right, front, back, etc.) in the embodiments of the present application are only used to explain the relative position relationship, movement condition, etc. between components in a certain specific posture, and when the specific posture changes, the directional indications also change accordingly. When an element is referred to as "fixed to" or "disposed on" another element, it can be directly on another element or can have a middle element. When an element is referred to as "connected to" another element, it can be directly connected to another element or indirectly connected to another element through a middle element. The embodiments of the present application refer to "first", "second", etc. for the purpose of description only, and cannot be understood as indicating or implying the relative importance of the indicated technical features or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first", "second" can explicitly or implicitly include at least one of the features.

[0021] It should be noted that the technical solutions of various embodiments of the present application can be combined with each other, but it must be based on the realization of a person skilled in the art, when the combination of technical solutions appears contradictory or unachievable, it should be considered that the combination of technical solutions does not exist, nor within the scope of protection claimed by the present application.

[0022] A single-center, retrospective cohort study was conducted to collect patients who underwent lung transplantation surgery at China-Japan Friendship Hospital from July 2017 to February 2023 as research subjects. The inclusion criteria were: (1) postoperative use of voriconazole treatment; (2) postoperative use of tacrolimus immunosuppressive therapy; (3) age greater than 18 years old; the exclusion criteria were: (1) less than 5 days of voriconazole use; (2) not participating in genetic testing; (3) voriconazole concentration did not reach steady state (continuous use of the same dose for more than 5 days).

[0023] The study included 76 patients, and 441 steady-state voriconazole blood concentration detection results were obtained from the patients. In addition, the parameters of the patients before using voriconazole were collected, specifically, the basic physical parameters of the patients were obtained, including the body weight, body surface area, age and days after lung transplantation of the patients; the blood biochemical index parameters of the patients were obtained, including the concentration of glutamic-pyruvic transaminase, the concentration of total bilirubin and the concentration of urea; the combined medication state parameters of the patients were obtained, including whether the patients simultaneously used rabeprazole, atenolol or ethambutol; the blood concentration of tacrolimus of the patients was obtained; the single nucleotide polymorphism (SNP) detection was performed on the patients to identify the genotypes of rs4244285 site, rs4986893 site, rs3740066 site, rs4149056 site and rs4646437 site.

[0024] The primer set for identifying the rs4244285 site is shown in SEQ ID No. 1 and SEQ ID No. 2; the primer set for identifying the rs4986893 site is shown in SEQ ID No. 3 and SEQ ID No. 4; the primer set for identifying the rs3740066 site is shown in SEQ ID No. 5 and SEQ ID No. 6; the primer set for identifying the rs4149056 site is shown in SEQ ID No. 7 and SEQ ID No. 8; and the primer set for identifying the rs4646437 site is shown in SEQ ID No. 9 and SEQ ID No. 10.

[0025] SEQ ID No. 1: ACAACCAGAGCTTGGCATATTG SEQ ID No. 2: CCCGAGGGTTGTTGATGTCC SEQ ID No. 3: CTGCTCCATTATTTTCCAGAAACG SEQ ID No. 4: AAAGACTGTAAGTGGTTTCTCAGG SEQ ID No. 5: TAAGAGGCCTCCGCCAGATT SEQ ID No. 6: CCATCCAGGCCTTCCTTCAC SEQ ID No. 7: ATAGGTTGTTTAAAGGAATCTGGG SEQ ID No. 8: AGAAAGCCCCAATGGTACTA SEQ ID No. 9: CCCCTCTTTCAGGCCAGTGG SEQ ID No. 10: CAAGGGGCTGCTGATCTCAC The baseline information of patients before using voriconazole is shown in Table 1.

[0026] Table 1. Baseline information of study population All SNP sites detected are shown in Table 2.

[0027] Table 2. Information of SNP to be tested and distribution in study population Table 2 shows all SNPs tested in this study, all SNPs meet Hardy-Weinberg equilibrium, and all sites are included in further analysis.

[0028] We used linear mixed effect model to verify the effects of various factors on voriconazole concentration. Data were analyzed using the lmer package in the statistical computing language R; voriconazole concentrations below the lower limit of quantification (LLOQ, 0.1 mg / L) were set to 0.05 mg / L; the core model for analysis was: ln(concentration) ~ ln(dose / weight) + covariate + (1|subject ID); the effects of clinical factors, genetic information, and concomitant medications on voriconazole concentration were verified. First, we plotted the effects of basic factors such as dose (dose corrected for weight), body surface area, age, gender, etc. on voriconazole concentration (Figure Figures 1A-1D ), and found that dose corrected for weight and body surface area had significant effects on voriconazole concentration. The basic model was further constructed by including body surface area. That is: ln(C t ) = θ 1+ θ 2×(ln(dose / weight)-ln(1mg / kg))+ θ 3×(ln(BSA)-ln(1m 2 ))+(1|ID). Age and gender did not show significant effects on voriconazole concentration and were not included in the basic model.

[0029] The covariants were added to the basic model. The forms of covariants included the following: (1) when the covariants were continuous variables (ALT, AST, POD, tacrolimus concentration, etc.), the difference between the logarithm (ln) value and the logarithm (ln) reference value was used, i.e., ln (variable value)-ln (variable reference value); (2) factor variables (gender, administration route, and fungal treatment type) were added in the form of factor levels (0, 1, or 0, 1, 2, etc.); (3) the numerical value of combined medication was represented as 0 (no combined medication on the day) and 1 (combined medication on the day); (4) the numerical value of genetic information was represented as 0 (reference genotype), 1 (heterozygous type), or 2 (variant homozygous type), or 0 (reference genotype), 1 (heterozygous type + variant homozygous type), and was added to the model in the form of binary classification (G_c2a, G_c2b, I_ga, I_gg) or ternary classification (G_abc and G_slc) according to the specific meaning of the genotype. In the genotype, the subject pseudo-identifier (ID) was used as a grouping factor with a random intercept.

[0030] During the construction of the model, the patient weight-corrected dose, body surface area, age, gender, transplantation type, treatment start time, fungal treatment type, and biochemical indicators (including ALT, AST, Tbil, Dbil, Urea, UA, CR, and HCT) were first evaluated as potential covariants; the corresponding residual (ln (measured concentration)-ln (predicted concentration)) was plotted with respect to the combined medication and genetic variation; then, the combined medication and genetic variation with suspected differences in the residual were evaluated as covariants in the model; finally, the interaction between the drug and the gene was tested; if the corresponding p value of the effect (or interaction) was <0.05 and the-2 times log likelihood (-2LL) was significantly reduced (-2LL difference >3.84 per additional degree of freedom), the covariant was added to the model; the model was constructed by alternately adding and removing covariants or interactions.

[0031] The final generated model was: ln(C t )=θ1+θ2·X_dw+θ3·X_bsa+θ4·X_age+θ5·X_pod+θ6·X_tac+θ7·X_alt+θ8·X_tbil+θ9·X_urea+θ 10 ·R+θ 11 ·A+θ 12 ·E+θ 13 ·G_c2a+θ 14 ·G_c2b+θ 15 ·G_abc+θ 16 ·G_slc+θ 17 ·I_ga+θ 18• I_gg+ (1 | ID); C t denotes voriconazole plasma concentration; X_dw denotes the normalized dose weight ratio, calculated as ln(dose / weight)-ln(l), dose is the voriconazole dose intended for the patient, weight is the patient weight; X_bsa denotes the normalized body surface area, calculated as ln(BSA)-ln(l), BSA is the patient body surface area; X_age denotes the normalized age, calculated as ln(age)-ln(60), age is the patient age (years); X_pod denotes the normalized post- transplant days, calculated as ln(POD)-ln(l), POD is the post-lung transplant days (days); X_tac denotes the normalized tacrolimus plasma concentration, calculated as ln(Tac_conc)-ln(l), Tac_conc is the patient tacrolimus plasma concentration; X_alt denotes the normalized alanine aminotransferase concentration, calculated as ln(ALT)-ln(42), ALT is the patient alanine aminotransferase concentration; X_tbil denotes the normalized total bilirubin concentration, calculated as ln(Tbil)-ln(23), Tbil is the patient total bilirubin concentration; X_urea denotes the normalized urea concentration, calculated as ln(Urea)-ln(7.85), Urea is the patient urea concentration; R denotes the rabeprazole medication status, not used is assigned 0, used is assigned 1; A denotes the atenolol medication status, not used is assigned 0, used is assigned 1; E denotes the ethambutol medication status, not used is assigned 0, used is assigned 1; G_c2a denotes the rs4244285 genotype, GG genotype is assigned 0, GA or AA genotype is assigned 1; G_c2b denotes the rs4986893 genotype, GG genotype is assigned 0, GA or AA genotype is assigned 1; G_abc denotes the rs3740066 genotype, CC genotype is assigned 0, CT genotype is assigned 1, TT genotype is assigned 2; G_slc denotes the rs4149056 genotype, CC genotype is assigned 0, TC genotype is assigned 1, TT genotype is assigned 2; I_ga represents the interaction term of tacrolimus blood concentration and rs4646437 GA genotype, when the patient's rs4646437 genotype is GA, I_ga = X_tac x 1, when the patient's rs4646437 genotype is not GA, I_ga = 0; I_gg represents the interaction term of tacrolimus blood concentration and rs4646437 GG genotype, when the patient's rs4646437 genotype is GG, I_gg = X_tac x 2, when the patient's rs4646437 genotype is not GG, I_gg = 0; (1|ID) represents the random effect of an individual, which is assigned as 0 when predicting a new patient; if the concentration of a specific individual (the individual used for model construction) needs to be predicted, the random effect of the individual needs to be considered: the value of the random effect follows a normal distribution N(0, σ²_id), where σ_id = 0.298 (Table 1). When calculating, a random value b_i (representing the random offset of the individual) is extracted from N(0, 0.298 2 ) and substituted into the formula for calculation.

[0032] The following exemplary lists 10 IDs corresponding to (1|ID), specifically ZRLT001: -0.133788359; ZRLT002: 0.005826071; ZRLT003: 0.103545152; ZRLT004: 0.107865396; ZRLT005 0.067198467; ZRLT007: -0.298297015; ZRLT009: 0.060090301; ZRLT010: -0.027757161.

[0033] Wherein, the description of each variable parameter is shown in Table 3. Among them θ 1 to θ 18 The values of 1 to 9 are the corresponding numerical values in the fixed effect column of Table 3, θ 2 represents the expected dose of voriconazole used by the patient, θ 3 represents the body surface area of the patient, θ 4 represents the age of the patient, θ 5 represents the number of days after transplantation, θ 6 represents the recent tacrolimus concentration, θ 7 to θ 9 represent the patient's own biochemical test indicators, and the corresponding variables can be calculated by entering the real values of the patient, θ 10 to θ 12 Item 10 represents the combined medication (0 for no combined medication, 1 for combined medication), θ 13 toθ 16 Item represents patient gene test (0 if the genotype of the corresponding site is the reference value genotype; if it is other sites, it is calculated according to the respective fixed effect, and the specific: θ 13 CYP2C19 rs4244285 GA and AA are assigned as 1; θ 14 CYP2C19 rs4986893 GA and AA are assigned as 1; θ 15 ABCC2 rs3740066 CT is assigned as 1, θ 15 ABCC2 rs3740066 TT is assigned as 2; θ 16 SLCO1B1 rs4149056 TC is assigned as 1, θ 16 SLCO1B1 rs4149056 TT is assigned as 2, θ 17 to θ 18 Item represents an interaction term, θ 17 ln(Tacrolimus concentration, ng / mL) - ln(1ng / mL)): rs4646437 GA in rs4646437 GA is assigned as 1, and the interaction is calculated by multiplying the ln value of Tacrolimus (Tacrolimus) concentration, θ 18 ln(Tacrolimus concentration, ng / mL) - ln(1ng / mL)): rs4646437 GG in rs4646437 GG is assigned as 2, and the interaction is calculated by multiplying the ln value of Tacrolimus concentration.

[0034] Table 3 Fitting parameters of the final model and reference values We compared the fitting effect of the basic model, i.e. the model only using body weight corrected dose and body surface area, with the final model and the actual measured concentration value, and the results are shown in Figure 2 The final model has good fitting effect on voriconazole concentration ( Figure 2 B). The R² of the final model (fixed + random effect): 0.6645549, the marginal R² (only fixed effect): 0.4634273. The correlation between predicted concentration and actual concentration: r = 0.749 p < 0.001. The prediction accuracy of the clinical effective concentration: 84.4 %.

[0035] In clinical application, a kit for predicting the blood concentration of voriconazole is constructed, the kit comprising primers for identifying rs4244285 site, rs4986893 site, rs3740066 site, rs4149056 site and rs4646437 site, and reagents for detecting the concentration of glutamic-pyruvic transaminase, the concentration of total bilirubin, the concentration of urea and the blood concentration of tacrolimus of the patient. The basic physical sign parameters of the patient are obtained, the basic physical sign parameters comprising the weight, the body surface area, the age and the postoperative days of the patient after lung transplantation; the blood biochemical index parameters and the blood concentration of tacrolimus of the patient are obtained by using the reagents of the kit, the blood biochemical index parameters comprising the concentration of glutamic-pyruvic transaminase, the concentration of total bilirubin and the concentration of urea; the combined medication state parameters of the patient are obtained, the combined medication state parameters comprising whether the patient simultaneously uses rabeprazole, atenolol or ethambutol; the obtained parameters and the dose to be administered are input into the final model, and the predicted concentration of voriconazole of the patient in the situation is obtained, whether the dose is appropriate is judged, and the goal of individualized administration is achieved. It is tested that the above parameters are obtained within 5 days, and have high accuracy.

[0036] Although the embodiments of the present application have been disclosed as above, it is not limited to the application listed in the specification and the embodiments, and can be fully applied to various fields suitable for the present application, and other modifications can be easily realized by those skilled in the art, and therefore the present application is not limited to specific details and the embodiments shown and described herein, without departing from the general concept defined by the claims and the equivalent scope.

Claims

1. Use of a primer set of a combination of polymorphic sites in the preparation of a kit for predicting the blood concentration of voriconazole, characterized in that, The combination of polymorphic sites includes rs4244285 site, rs4986893 site, rs3740066 site, rs4149056 site and rs4646437 site.

2. Use of the primer set of the combination of the polymorphic sites according to claim 1 for the manufacture of a kit for predicting the blood concentration of voriconazole, characterized in that, The application method comprises: S1: acquiring patient basic physical sign parameters, the basic physical sign parameters including patient weight, body surface area, age and post-lung transplantation days; S2: acquiring patient blood biochemical index parameters, the blood biochemical index parameters including glutamic-pyruvic transaminase concentration, total bilirubin concentration and urea concentration; S3: acquiring patient combined drug use state parameters, the combined drug use state parameters including whether the patient simultaneously uses rabeprazole, atenolol or ethambutol; S4: acquiring patient tacrolimus blood drug concentration; S5: identifying the genotypes of rs4244285 site, rs4986893 site, rs3740066 site, rs4149056 site and rs4646437 site: S6: inputting the parameters acquired in S1-S5 into a pre-established voriconazole blood drug concentration prediction formula, and outputting the voriconazole blood drug concentration.

3. Use of the primer set of the combination of the polymorphic sites according to claim 2 for the manufacture of a kit for predicting the blood concentration of voriconazole, characterized in that, The primer set for identifying the rs4244285 site is shown in SEQ ID No. 1 and SEQ ID No. 2; The primer set for identifying the rs4986893 site is shown in SEQ ID No. 3 and SEQ ID No. 4; The primer set for identifying the rs3740066 site is shown in SEQ ID No. 5 and SEQ ID No. 6; The primer set for identifying the rs4149056 site is shown in SEQ ID No. 7 and SEQ ID No. 8; The primer set for identifying the rs4646437 site is shown in SEQ ID No. 9 and SEQ ID No.

10.

4. Use of the primer set of the combination of the polymorphic sites according to claim 3 for the manufacture of a kit for predicting the blood concentration of voriconazole, characterized in that, The voriconazole blood drug concentration prediction formula is as follows: ln(C t )=θ1+θ2·X_dw+θ3·X_bsa+θ4·X_age+θ5·X_pod+θ6·X_tac+θ7·X_alt+θ8·X_tbil+θ9·X_urea+θ 10 ·R+θ 11 ·A+θ 12 ·E+θ 13 ·G_c2a+θ 14 ·G_c2b+θ 15 ·G_abc+θ 16 ·G_slc+θ 17 ·I_ga+θ 18 ·I_gg+(1|ID); C t Voriconazole plasma concentration is represented by C; X_dw represents a standardized dose-weight ratio, the calculation formula is ln(dose / weight)-ln(1), dose is the voriconazole dose expected to be used by the patient, and weight is the patient weight; X_bsa represents a standardized body surface area, the calculation formula is ln(BSA)-ln(1), BSA is the patient body surface area; X_age represents a standardized age, the calculation formula is ln(age)-ln(60), age is the patient age; X_pod represents a standardized post-transplantation day, the calculation formula is ln(POD)-ln(1), POD is the post-lung transplantation day; X_tac represents a standardized tacrolimus blood drug concentration, the calculation formula is ln(Tac_conc)-ln(1), Tac_conc is the patient tacrolimus blood drug concentration; X_alt represents a standardized glutamic-pyruvic transaminase concentration, the calculation formula is ln(ALT)-ln(42), ALT is the patient glutamic-pyruvic transaminase concentration; X_tbil represents a standardized total bilirubin concentration, the calculation formula is ln(Tbil)-ln(23), Tbil is the patient total bilirubin concentration; X_urea represents the standardized urea concentration, and the calculation formula is ln(Urea)-ln(7.85), wherein Urea is the urea concentration of the patient; R represents the use state of rabeprazole, and the non-use is assigned a value of 0, and the use is assigned a value of 1; A represents the use state of atenolol, and the non-use is assigned a value of 0, and the use is assigned a value of 1; E represents the use state of ethambutol, and the non-use is assigned a value of 0, and the use is assigned a value of 1; G_c2a represents the rs4244285 genotype, and the GG genotype is assigned a value of 0, and the GA or AA genotype is assigned a value of 1; G_c2b represents the rs4986893 genotype, and the GG genotype is assigned a value of 0, and the GA or AA genotype is assigned a value of 1; G_abc represents the rs3740066 genotype, and the CC genotype is assigned a value of 0, the CT genotype is assigned a value of 1, and the TT genotype is assigned a value of 2; G_slc represents the rs4149056 genotype, and the CC genotype is assigned a value of 0, the TC genotype is assigned a value of 1, and the TT genotype is assigned a value of 2; I_ga represents the interaction term of tacrolimus blood concentration and rs4646437 GA genotype, when the rs4646437 genotype of the patient is GA, I_ga=X_tac×1, and when the rs4646437 genotype of the patient is not GA, I_ga=0; I_gg represents the interaction term of tacrolimus blood concentration and rs4646437 GG genotype, when the rs4646437 genotype of the patient is GG, I_gg=X_tac×2, and when the rs4646437 genotype of the patient is not GG, I_gg=0; (1|ID) represents the individual random effect, and is assigned a value of 0 when predicting a new patient; θ1, θ2, θ3, θ4,... θ 18 are coefficients.

5. Use of the primer set of the combination of polymorphic sites according to claim 4 for the preparation of a kit for predicting the blood concentration of voriconazole, characterized in that, The fixed effect value of θ1 is -5.2519, the fixed effect value of θ2 is 1.1183, the fixed effect value of θ3 is 2.6762, the value of θ4 is 0.5777, the value of θ5 is 0.1174, the value of θ6 is 0.6078, the value of θ7 is 0.1264, the value of θ8 is 0.0577, the value of θ9 is 0.2004, the value of θ 10 is 0.7626, the value of θ 11 is -0.3207, the value of θ 12 is -0.5744, the value of θ 13 is 0.2399, the value of θ 14 is 0.2541, the value of θ 17 is -0.0395, the value of θ 18 is -0.0513; When the patient rs3740066 genotype is CT, the value of θ 15 is 0.2455, and when the patient rs3740066 genotype is TT, the value of θ 15 is -0.1356. When the patient's rs4149056 genotype is TC, the value of 0 16 is 0.9347, and when the patient's rs4149056 genotype is TT, the value of 0 16 is 0.7592.

6. A kit for the prediction of blood plasma concentration of voriconazole, characterized in that, The primers for identifying the rs4244285 site, the rs4986893 site, the rs3740066 site, the rs4149056 site and the rs4646437 site are included.

7. The kit of claim 6, wherein The primer set for identifying the rs4244285 site is shown in SEQ ID No. 1 and SEQ ID No. 2; The primer set for identifying the rs4986893 site is shown in SEQ ID No. 3 and SEQ ID No. 4; The primer set for identifying the rs3740066 site is shown in SEQ ID No. 5 and SEQ ID No. 6; The primer set for identifying the rs4149056 site is shown in SEQ ID No. 7 and SEQ ID No. 8; The primer set for identifying the rs4646437 site is shown in SEQ ID No. 9 and SEQ ID No.

10.

8. The kit of claim 6, wherein The reagents for detecting the concentrations of glutamic-pyruvic transaminase, glutamic-oxaloacetic transaminase, total bilirubin, urea, and the blood concentration of tacrolimus in the patient are also included.

9. The kit of claim 6, wherein The blood concentration prediction formula of voriconazole is as follows: ln(C t )=θ1+θ2·X_dw+θ3·X_bsa+θ4·X_age+θ5·X_pod+θ6·X_tac+θ7·X_alt+θ8·X_tbil+θ9·X_urea+θ 10 ·R+θ 11 ·A+θ 12 ·E+θ 13 ·G_c2a+θ 14 ·G_c2b+θ 15 ·G_abc+θ 16 ·G_slc+θ 17 ·I_ga+θ 18 ·I_gg+(1|ID); C t Voriconazole plasma concentration is represented by C; X_dw represents the standardized dose-weight ratio, and the calculation formula is ln(dose / weight)-ln(1), wherein dose is the voriconazole dose expected to be used by the patient, and weight is the body weight of the patient; X_bsa represents the standardized body surface area, and the calculation formula is ln(BSA)-ln(1), wherein BSA is the body surface area of the patient; X_age represents the standardized age, the calculation formula is ln(age)-ln(60), and age is the patient's age; X_pod represents the standardized postoperative days, the calculation formula is ln(POD)-ln(1), and POD is the postoperative days of lung transplantation; X_tac represents the standardized tacrolimus blood concentration, the calculation formula is ln(Tac_conc)-ln(1), and Tac_conc is the patient's tacrolimus blood concentration; X_alt represents the standardized alanine aminotransferase concentration, the calculation formula is ln(ALT)-ln(42), and ALT is the patient's alanine aminotransferase concentration; X_tbil represents the standardized total bilirubin concentration, the calculation formula is ln(Tbil)-ln(23), and Tbil is the patient's total bilirubin concentration; X_urea represents the standardized urea concentration, the calculation formula is ln(Urea)-ln(7.85), and Urea is the patient's urea concentration; R represents the use of rabeprazole, and the value is 0 for non-use and 1 for use; A represents the use of atenolol, and the value is 0 for non-use and 1 for use; E represents the use of ethambutol, and the value is 0 for non-use and 1 for use; G_c2a represents the rs4244285 genotype, and the value is 0 for GG genotype and 1 for GA or AA genotype; G_c2b represents the rs4986893 genotype, and the value is 0 for GG genotype and 1 for GA or AA genotype; G_abc represents the rs3740066 genotype, and the value is 0 for CC genotype, 1 for CT genotype, and 2 for TT genotype; G_slc represents the rs4149056 genotype, and the value is 0 for CC genotype, 1 for TC genotype, and 2 for TT genotype; I_ga represents the interaction between tacrolimus blood concentration and rs4646437 GA genotype, when the patient's rs4646437 genotype is GA, I_ga=X_tac×1, and when the patient's rs4646437 genotype is not GA, I_ga=0; I_gg represents the interaction between tacrolimus blood concentration and rs4646437 GG genotype, when the patient's rs4646437 genotype is GG, I_gg=X_tac×2, and when the patient's rs4646437 genotype is not GG, I_gg=0; (1|ID) represents the individual random effect, and the value is 0 for new patient prediction. θ1, θ2, θ3, θ4,... θ 18 are coefficients.

Images