EQTL molecular marker related to hypoxia resistance character of trachinotus ovatus and application of eQTL molecular marker

Abstract

The invention discloses an eQTL (quantitative trait loci) molecular marker related to the hypoxia resistance character of trachinotus ovatus and application of the eQTL molecular marker. The SNP molecular marker obviously related to the low-oxygen tolerance character of the trachinotus ovatus is obtained by integrating whole genome re-sequencing, transcriptome sequencing and chromatin open omics analysis, the eQTL molecular marker is positioned in a promoter region of 1711-1881bp upstream of a pla2g1b gene of the trachinotus ovatus, the genome position of the eQTL molecular marker is 16650700-16650870 bp of a chromosome 20, and the corresponding sequence is SEQ ID NO. 1. The eQTL molecular marker comprises four SNP (Single Nucleotide Polymorphism) sites, and the genomic positions of the four SNP sites are respectively 16650770 bp, 16650804 bp, 16650828 bp and 16650849 bp of a chromosome 20 of the four SNP sites. The eQTL molecular marker can be used as an auxiliary selection marker in trachinotus ovatus hypoxia adaptability molecular breeding, the screening efficiency of hypoxia tolerance strains can be effectively improved, and the breeding process of new varieties is accelerated.

Description

TECHNICAL FIELD

[0001] The embodiment of the present application relates to the field of molecular breeding of aquatic animals, and particularly relates to an eQTL molecular marker related to the low oxygen tolerance trait of Pampus argenteus and application thereof. BACKGROUND

[0002] Pampus argenteus and Trachinotus blochii are widely distributed in the warm and tropical waters of the Indian Ocean, the Pacific Ocean and the Atlantic Ocean, and are one of the most economically valuable marine fish in the coastal areas of South China. Pampus argenteus and Trachinotus blochii have the characteristics of high oxygen consumption and low oxygen tolerance. In the process of intensive aquaculture, Pampus argenteus and Trachinotus blochii are easily threatened by low oxygen due to high temperature in summer, falling tide level, typhoon, water eutrophication, ammonia nitrogen and parasitic infection. Once acute hypoxia occurs, Pampus argenteus and Trachinotus blochii will die in a short time, causing serious economic losses. With the intensification of global warming trend, the impact of marine hypoxia on biodiversity and aquaculture industry will become increasingly serious. At present, the molecular basis of the low oxygen tolerance trait of Pampus argenteus and Trachinotus blochii is not clear, and there is a lack of efficient and stable molecular markers that can be used for early screening. Traditional breeding methods have the problems of long cycle, low efficiency and resource waste. Therefore, it is urgent to develop a molecular assisted screening method for the low oxygen tolerance trait, to clarify the key regulatory factors of Pampus argenteus and Trachinotus blochii to low oxygen stress and their expression regulation mechanism, so as to realize precise breeding, improve breeding efficiency and aquaculture stability, and help the sustainable development of Pampus argenteus and Trachinotus blochii aquaculture industry.

[0003] Expression quantitative trait locus (eQTL) refers to a genomic locus that can regulate the variation of gene expression level, which mediates the difference of phenotype by affecting the transcription abundance of mRNA. As an important bridge connecting genotype variation and gene expression level variation, eQTL provides a core tool for analyzing the genetic regulation mechanism of complex traits. Compared with traditional molecular markers, eQTL can not only locate the genetic variation associated with traits, but also directly reveal the regulation mechanism of variation on gene expression, so as to more accurately analyze the genetic basis of complex traits. With the wide application of high-throughput sequencing and multi-omics integrated analysis methods, eQTL analysis has become an important tool for understanding the genetic structure and regulation mechanism of complex traits. Its advantages are as follows: 1) high resolution, which can locate the regulation site in a specific tissue or developmental stage; 2) strong function orientation, which directly links SNP-gene expression-phenotype; 3) wide application range, which is suitable for growth, stress resistance, metabolism and other multi-trait research. At present, eQTL has made breakthroughs in human diseases, crop resistance, economic traits of livestock and poultry, etc. However, there is no report on eQTL related to the low oxygen tolerance trait of Pampus argenteus. SUMMARY

[0004] The embodiment of the present application provides an eQTL molecular marker related to the low oxygen tolerance trait of Pampus argenteus and application thereof, so as to provide effective basis and scientific method for the research on the selection breeding of the low oxygen tolerance trait of Pampus argenteus.

[0005] In a first aspect, the eQTL molecular marker related to the low-oxygen tolerance trait of golden pompano provided by the embodiments of the present application comprises: Based on whole genome resequencing, transcriptome sequencing and chromatin open group analysis of golden pompano, the eQTL molecular marker is significantly related to the low-oxygen tolerance trait of golden pompano, and is used as a molecular marker for assisted selection of low-oxygen tolerance lines.

[0006] The eQTL molecular marker is located on the pla2g1b upstream-1711 ~ -1881 bp promoter region of the gene, the genomic position of which is 16650700 ~ 16650870 bp of chromosome 20, and the corresponding nucleotide sequence is shown as SEQ ID NO. 1; The eQTL comprises four SNP sites located at 16650770 bp, 16650804 bp, 16650828 bp and 16650849 bp of chromosome 20 of golden pompano. The four SNP sites are mutated to T→G, G→T, G→A and C→A.

[0007] In a second aspect, the primer pair for detecting the eQTL molecular marker of the first aspect provided by the embodiments of the present application comprises: Genomic DNA of golden pompano to be identified is extracted, and the obtained genomic DNA is used as a template to design a forward primer and a reverse primer based on the eQTL molecular marker fragment to amplify the target fragment by PCR, and Sanger sequencing is used to perform SNP typing on the amplified target fragment. When the haplotype of the SNP molecular marker is haplotype 1, it indicates that the golden pompano line has strong low-oxygen tolerance, and the bases are T / G / G / C; When the haplotype of the SNP molecular marker is haplotype 2, it indicates that the golden pompano line has poor low-oxygen tolerance, and the bases are G / T / A / A; Forward primer 5'-3': CGAATTTCCGATGTGTCTTT; Reverse primer 3'-5': CTGTCTTTATTTCCTCCCTAG.

[0008] In a third aspect, the eQTL molecular marker related to the low-oxygen tolerance trait of golden pompano of the first aspect and the primer pair of the eQTL molecular marker of the second aspect provided by the embodiments of the present application are applied to regulating the low-oxygen tolerance trait of golden pompano.

[0009] Optionally, the eQTL molecular marker is applied to molecular breeding of the low-oxygen tolerance trait of golden pompano.

[0010] Optionally, the eQTL molecular marker is applied in screening of low-oxygen tolerance lines and improving selection efficiency of low-oxygen adaptability related genes.

[0011] The beneficial effects of the embodiments of the present application are as follows: The embodiments of the present application obtain a SNP molecular marker significantly related to the low-oxygen tolerance trait of P. pfluegeri by integrating whole genome resequencing, transcriptome sequencing and chromatin open group analysis, and the eQTL molecular marker is located on the upstream (-1711 ~ -1881 bp) promoter region of the P. pfluegeri pla2g1b gene, the genomic position of which is 16650700 ~ 16650870 bp on chromosome 20, and the corresponding sequence is SEQ ID NO. 1. The eQTL molecular marker contains 4 SNP sites, the genomic positions of which are 16650770 bp, 16650804 bp, 16650828 bp and 16650849 bp on chromosome 20, respectively.

[0012] The eQTL molecular marker can be used as an auxiliary selection marker in molecular breeding of P. pfluegeri low-oxygen adaptability, and can effectively improve the screening efficiency of low-oxygen tolerance lines and accelerate the breeding process of new varieties. The present application also discloses a molecular level identification method for low-oxygen tolerance trait of P. pfluegeri, which comprises the following steps: extracting genomic DNA of P. pfluegeri, designing specific primers to amplify the fragment containing the marker site by PCR, and performing SNP typing analysis by Sanger sequencing, so as to realize efficient and accurate identification of low-oxygen tolerance ability of P. pfluegeri individuals. BRIEF DESCRIPTION OF DRAWINGS

[0013] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed in the embodiment description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0014] Figure 1 A schematic diagram of survival rates of P. pfluegeri and P. pfluegeri after 24 hours of acute hypoxic stress is provided for the embodiments of the present application; Figure 2 A schematic diagram of expression amounts of the P. pfluegeri and P. pfluegeri pla2g1b gene in the liver under hypoxic stress is provided for the embodiments of the present application; Figure 3 A schematic diagram of selection pressure analysis and identification of key evolutionary difference genes based on population differentiation index (FST) and cross-population extended haplotype homozygosity test (XP-EHH) is provided for the embodiments of the present application; F ST ) and cross-population extended haplotype homozygosity test (XP-EHH) is provided for the embodiments of the present application; pla2g1b ​Figure 4 A schematic diagram of linkage disequilibrium analysis of a pla2g1b gene upstream promoter sequence provided by an embodiment of the present application is shown in the figure; Figure 5 A schematic diagram of ATAC sequencing peak upstream of the pla2g1b gene provided by an embodiment of the present application is shown in the figure; Figure 6 A schematic diagram of the distribution frequency of a pla2g1b promoter haplotype in a hypoxia-resistant population and a hypoxia-sensitive population provided by an embodiment of the present application is shown in the figure; Figure 7 A schematic diagram of eQTL molecular marker function verification of the pla2g1b gene based on a dual-luciferase experiment provided by an embodiment of the present application is shown in the figure. DETAILED DESCRIPTION

[0015] In order to make the purpose, technical solutions and advantages of the present application clearer, the present application will be further described in detail below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0016] The experimental methods in the following embodiments are all conventional methods unless otherwise specified. The test materials used in the following embodiments are all purchased from commercial channels unless otherwise specified. The following embodiments define the present application and describe that the present application identifies the key gene pla2g1b determining the hypoxia-resistant trait of Pampus argenteus by integrating multi-omics analysis, finds that the haplotype SNP in the promoter region is highly associated with the hypoxia-resistant phenotype, and can be used as a molecular marker for breeding of Pampus argenteus hypoxia-resistant strains. Based on the description and embodiments of the present application, those skilled in the art can adjust the technical solutions to adapt to different breeding conditions and breeding needs without deviating from the core of the present application.

[0017] One of the purposes of the embodiments of the present application is to provide an eQTL molecular marker related to the hypoxia-resistant trait of Pampus argenteus, which provides an effective basis and scientific method for future research on selection and breeding of the hypoxia-resistant trait of Pampus argenteus.

[0018] The second purpose of the embodiments of the present application is to provide a primer pair of an eQTL molecular marker related to the hypoxia-resistant trait of Pampus argenteus.

[0019] The third purpose of the embodiments of the present application is to provide a screening method for identifying a molecular marker related to the hypoxia-resistant trait of Pampus argenteus.

[0020] The first object can be achieved by the following technical scheme: a haplotype SNP marker related to the low-oxygen tolerance of golden pompano, wherein the marker is located at the 51st, 85th, 109th and 130th bases of the nucleotide sequence shown in SEQ ID NO. 1.

[0021] Specifically, SEQ ID NO. 1 is pla2g1b The sequence of the upstream-1711~ -1881 bp region of the gene, and the genomic position is 16650700~ 16650870 bp of chromosome 20. The eQTL molecular marker comprises four SNP sites, which are the mutation T→G at 16650770 bp of chromosome 20, the mutation G→T at 16650804 bp of chromosome 20, the mutation G→A at 16650828 bp of chromosome 20 and the mutation C→A at 16650849 bp of chromosome 20.

[0022] The nucleotide sequence shown in SEQ ID NO. 1 is as follows: GCTTAAAGGCTACACAGAAAAAGATCTTTAATGCAGCTTTTTCCTAATTAATTTCATAGTAAATTATGTTGTATACACTTAAAATGTTGTATTTACAATATACATTACTTGGCAAAGAAGTACAAAGGAACCTTTAAGCAAACGTGGCTAGGGAGGAAATAAAGACAGAGAAAGAT.

[0023] The mutation of the 51st base is T→G, the mutation of the 85th base is G→T, the mutation of the 109th base is G→A, and the mutation of the 130th base is C→A.

[0024] The dual luciferase experiment and significance test prove that when the 51st, 85th, 109th and 130th bases of the sequence shown in SEQ ID NO. 1 are G, T, A and A, the haplotype formed by the sequence makes the transcription level of the pla2g1b gene under low oxygen higher, and the low-oxygen tolerance of the golden pompano is significantly enhanced.

[0025] The low-oxygen tolerance of the golden pompano according to the embodiment of the present application specifically refers to the survival time of the golden pompano under the condition that the water body dissolved oxygen is below the suffocation point.

[0026] In order to study the genetic difference of the hypoxia response of the Pampus argenteus, two groups with obvious morphological characteristics, i.e., long-fin Pampus argenteus and short-fin Pampus argenteus, are selected as candidate reference groups. The survival rate and molecular expression characteristics of individuals of the two groups after acute hypoxia stress are collected. The experimental results show that the long-fin Pampus argenteus has a higher survival rate under the condition of hypoxia stress, and is therefore used as a hypoxia-resistant reference strain, and the short-fin Pampus argenteus is a hypoxia-sensitive strain. Based on this, the two groups are used for subsequent comparative omics and molecular marker screening analysis.

[0027] The above-mentioned second object of the embodiment of the present application can be realized by the following technical scheme: a primer pair for detecting the haplotype SNP molecular marker, which is used for detecting the genotype of the eQTL molecular marker site.

[0028] According to the nucleotide sequence shown in SEQ ID NO. 1, the embodiment of the present application designs a specific primer pair for the eQTL molecular marker, and the nucleotide sequence of the primer pair is: Forward primer 5'-3': CGAATTTCCGATGTGTCTTT; Reverse primer 5'-3': CTGTCTTTATTTCCTCCCTAG.

[0029] The above-mentioned third object of the embodiment of the present application can be realized by the following technical scheme: a mutation T→G at 16650770 bp of chromosome 20 of Pampus argenteus, a mutation G→T at 16650804 bp of chromosome 20, a mutation G→A at 16650828 bp of chromosome 20, and a mutation C→A at 16650849 bp of chromosome 20 are associated with the hypoxia-resistant trait of Pampus argenteus, and the specific steps include: (1) Sample extraction and library sequencing: the hypoxia-resistant group and the hypoxia-sensitive group of Pampus argenteus are distinguished through acute hypoxia stress experiment, total RNA of liver tissue is extracted for transcriptome sequencing and chromatin openness (ATAC) sequencing, and fin strip samples are taken to extract DNA samples for whole genome sequencing.

[0030] (2) Data processing and quality control: Illumina NovaSeq 6000 sequencing platform is used for transcriptome sequencing and ATAC sequencing of RNA samples, and DNBSEQ-T7 sequencing platform of Huada Gene is used for whole genome resequencing of DNA samples to obtain raw sequencing data.

[0031] (3) Expression difference and selection signal analysis: quality control, sequence alignment and gene expression quantification analysis are performed on the transcriptome data to obtain the gene expression profile of each sample; the genome data is filtered, sequence aligned and variant detected to obtain the whole genome SNP marker information.

[0032] (4) Selection pressure analysis on the genomic data, using F ST and XP-EHH method to screen the selected genomic region, and identify the regulatory sequence variation and candidate genes by variation annotation and functional classification.

[0033] (5) Identification of key regulatory sites and candidate genes: transcriptome analysis is performed to identify differentially expressed genes under hypoxia and normoxia conditions in each variety; the results of selection pressure analysis and transcriptome analysis are integrated to identify key genes related to the hypoxia tolerance trait of P. peneus; further combined with ATAC-seq data analysis of chromatin openness, the spatial consistency of the key sites and transcription factor binding sites is verified to clarify the regulatory mechanism.

[0034] (6) Constructing different haplotypes into a promoter-luciferase reporter vector, transfecting into 293T cells, and comparing the fluorescence intensity to verify the difference in promoter activity.

[0035] Preferably, the acute hypoxic stress condition in step (1) is that the dissolved oxygen concentration is controlled at 1.5 ± 0.2 mg / L, the stress time lasts for 24 hours, and the water temperature is maintained at 28 ± 1℃.

[0036] Preferably, in step (4), the VCFtools software is used to calculate the population genetic differentiation index (Fst) F ST ), the window size is 2 kb, and the step size is 1 kb.

[0037] Preferably, in step (5), the MACS2 software is used for peak recognition analysis of ATAC-seq data, and the q-value threshold is set to 0.05.

[0038] The present embodiment finds that the P. peneus pla2g1b The present embodiment finds that the P. peneus

[0039] The present embodiment also provides a method for detecting the hypoxia tolerance of P. peneus, which comprises the following steps: (1) Extracting the genomic DNA of the P. peneus to be tested; (2) Using the above primers to perform PCR amplification on the genomic DNA of the P. peneus to be tested to obtain an amplification product; (3) Performing electrophoresis detection on the PCR amplification product, and purifying the target band using a gel recovery kit; (4) The purified product is connected to pMD19-T vector, and after transformation of DH5a competent cells, single clone is picked for sequencing; (5) The amplified product is directly subjected to Sanger sequencing, and the sequence SNP information is directly obtained from software.

[0040] Preferably, in step (1), part of fin strip of Pampus argenteus is cut to extract total DNA, and the quality of the DNA sample is ensured, i.e. the ratio of A260 / A280 is between 1.8 and 2.0, and the DNA concentration is greater than 100 μg / μL.

[0041] Preferably, in step (2), the PCR system is shown in Table 1 when PCR amplification is performed: Table 1 Reaction components Volume Final concentration 5 x Prime STAR Buffer 5 μL 1 × Prime STAR HS DNA Pol 0.5 μL 1.25 U / 25 μL DNA template 1-5 μL 0-100 ng dNTP Mixture (2.5 mM) 2 μL 200 μM Upstream primer (10 μM) 0.5 μL 0.2 μM Downstream primer (10 μM) 0.5 μL 0.2 μM ddH2O up to 25 μL The PCR amplification procedure is shown in Table 2: Table 2 Preferably, when the 51 / 85 / 109 / 130 positions of SEQ ID NO. 1 are G / T / A / A, it is determined that the low-oxygen-resistant haplotype can be used as a parent for breeding of low-oxygen-resistant Pampus argenteus.

[0042] In summary, the embodiment of the present application discloses an eQTL molecular marker and a haplotype SNP combination significantly associated with the low-oxygen-resistant trait of Pampus argenteus, which belongs to the technical field of molecular breeding of aquatic animals, and also discloses an eQTL screening and genotype identification method. The low-oxygen-resistant performance of Pampus argenteus can be accurately predicted early by detecting the haplotype polymorphism site, the breeding selection efficiency is significantly improved, and a new molecular breeding technical means is provided for breeding of a new low-oxygen-resistant Pampus argenteus variety.

[0043] In order to better explain the technical solutions in the embodiments of the present application, the above technical solutions will be described below with specific embodiments.

[0044] Example 1 - Establishment of low-oxygen-resistant population and sensitive population: (1) 300 Pampus argenteus of each of two main domestic varieties, long-fin Pampus argenteus and short-fin Pampus argenteus, are collected, and the samples are all from Hainan breeding groups with a weight of 50.0±3 g. Under laboratory conditions, the water temperature is controlled at 27±0.5°C, the salinity is 20-30‰, the ammonia nitrogen is less than 0.02 mg / L, the natural light is used, the air pump is used for aeration to maintain saturated dissolved oxygen, and the feed is fed in the morning and evening every day. Two days before the formal start of the experiment, the feeding of the feed was stopped.

[0045] (2) Hypoxia stress experiment at 1.5 ± 0.2 mg / L, hypoxia stress environment is mainly completed by self-made dissolved oxygen adjusting device. The experiment is divided into two groups of longfin and shortfin, each group has three parallels, and each parallel randomly allocates 80 fish. Take 5 fish from each group, each parallel, as the normoxic group, with 27°C saturated dissolved oxygen as the starting setting condition. Use self-made dissolved oxygen adjusting device to reduce dissolved oxygen to 1.5 mg / L within 2 hours, which is recorded as the experimental starting point (0h), and take 7 fish in good condition without floating head phenomenon from each barrel, and take the liver tissue into liquid nitrogen for transcriptome pool sequencing (mix 7 tail samples). After 24h, take samples again in the same way. After 24 hours of hypoxia stress, the survival rates of the two pompano varieties are calculated, and the group with higher survival rate is used as the hypoxia-tolerant group, and the group with lower survival rate is used as the hypoxia-sensitive group.

[0046] Example 2 - Acquisition of multi-omics data: (1) RNA extraction, quality control and transcriptome sequencing: The liver tissues of the hypoxia-tolerant group and the hypoxia-sensitive group under normoxic, hypoxia 0h and hypoxia 24h conditions were subjected to total RNA extraction by TRIzol method, and the genomic DNA contamination was removed by DNase I digestion. The RNA integrity (RIN≥8.0) was detected by Agilent 2100 Bioanalyzer, the purity (A260 / A280=1.9-2.1) and concentration (≥200 ng / μL) were determined by Nanodrop 2000. The qualified RNA samples were subjected to library construction, and 150 bp double-end sequencing was performed on Illumina NovaSeq 6000 platform, and ≥20 million clean reads were obtained for each sample. The sequencing data was subjected to quality control and filtration, and the qualified data was aligned to the pompano reference genome, and the gene expression quantitative analysis was performed by HTSeq to obtain the population gene expression profile data.

[0047] (2) DNA extraction, quality control and whole genome sequencing: Fins were sampled from 50 fish in each population. Total DNA was extracted using phenol-chloroform method, and the integrity of the DNA was confirmed by 1% agarose gel electrophoresis. The purity (A260 / A280 = 1.8-2.0) and concentration (≥50 ng / μL) of the DNA were determined using a Nanodrop 2000. The qualified DNA samples were fragmented to 350 bp by Covaris S220, and whole genome sequencing libraries were constructed. The sequencing was performed on a DNBSEQ-T7 platform of Huada Genomics, with a sequencing depth of ≥20× for each sample. The sequencing data was quality controlled and filtered. The qualified data was aligned to the reference genome sequence of P. elephas, and SNPs in the population were obtained and further filtered. SNPs with a minor allele frequency (MAF) <0.05, a genotype missing rate >0.1, or a Hardy-Weinberg index (HW) <0.0001 were deleted.

[0048] (3) ATAC-seq library construction and quality control: 50 mg of fresh liver tissue was quickly frozen in liquid nitrogen and then subjected to chromatin open fragmentation treatment using Tn5 transposase. The reaction system contained 25 μL TD Buffer and 2.5 μL Tn5 enzyme, and was incubated at 37°C for 30 minutes with shaking. The DNA fragments were purified using AMPure XP magnetic beads, and the fragment distribution was detected by an Agilent 2100 bioanalyzer. The main peak was required to be located at 200-600 bp, there was no obvious primer dimer peak, and the library concentration was ≥2 nM. The qualified library was subjected to 150 bp double-end sequencing on an Illumina NovaSeq 6000 platform, and ≥50 million reads were obtained for each sample. The experiment included three technical replicates. The raw data was quality controlled by FastQC, and the Q30 was required to be ≥85%. Subsequent peak identification analysis, open region analysis, and sequence motif prediction were performed.

[0049] Example 3 - Screening of key genes and eQTL positioning: (1) Identification of hypoxia-responsive genes using transcriptome analysis: The TPM quantified gene expression level was calculated using StringTie ver.1.3.4d software, and the TPM was normalized using the R package LIMMA. The R package DESeq2 was used for differential expression gene analysis: 1) between populations (short-fin P. elephas vs. long-fin P. elephas), the differential genes under normoxia were detected, i.e., constitutive differential expression genes; 2) within the population, the differential genes between hypoxia 0h and normoxia, and between hypoxia 24h and normoxia were identified. The differential expression genes obtained from the above analysis were defined as data set 1. (2) Identification of selected genes using genome analysis: To identify the genes related to adaptive divergence between P. longimana and P. brevimanus, two methods were used to screen potential selected loci, 1) PLINK v1.9 software was used to calculate the genetic differentiation index (Fst) of 2Kbp sliding window between populations F ST ); 2) The cross-population extended haplotype homozygosity test (XP-EHH) value between P. brevimanus and P. longimana was calculated, negative values indicate that P. brevimanus is under positive selection, positive values indicate that P. brevimanus is under negative selection, and the highest 5% threshold and the lowest 5% threshold were calculated. The genomic regions with F ST and XP-EHH values located in the highest 5% threshold and the lowest 5% threshold were identified as selected regions, and the genes and variation sites contained or related in the region were defined as dataset 2.

[0050] (3) Chromatin accessibility sequencing (ATAC-seq) was used to identify the regulatory elements of hypoxia-responsive genes: Chromatin accessibility sequencing was performed on 3 tails of P. brevimanus on the Illumina HiSeq 4000 platform. The BWA v 0.7.17 software was used to align the effective sequences (clean reads) filtered from the ATAC-Seq sequencing data to the reference genome of P. brevimanus. Peak-calling was performed using Genrich v0.6 software, and the sequencing peaks related to genes (within 5000bp upstream and downstream of the start and end coordinates of the longest transcript of each gene) were annotated using Bedtools software, and the SNPs overlapping with them were identified. The MEME software was used to predict the motifs of the overlapping regulatory elements in the open regions, and the possible transcription factor binding sites were determined by comparing with the known motifs in the database.

[0051] (4) Key gene and eQTL positioning: The genes common to datasets 1 and 2 were identified as hypoxia regulation candidate genes. GO enrichment and KEGG pathway analysis were used to annotate the functions and metabolic pathways of candidate genes, and genes related to hypoxia response and metabolism were focused on. SNP annotation, linkage disequilibrium analysis, and promoter sequence analysis were performed on the selected regions of the key candidate genes, combined with ATAC-seq to identify regulatory sequence variations affecting hypoxia transcription, i.e. eQTL.

[0052] (5) Data analysis results: The results of acute hypoxia stress experiment showed that the hypoxia survival rate of P. longimana (67%) was significantly higher than that of P. brevimanus (38%), as shown in Figure 1 .

[0053] Transcriptome analysis found that hypoxia stress led to a significant up-regulation of phospholipase encoding gene pla2g1b in shortfin pompano, but the expression of this gene in longfin pompano did not change significantly, as shown in Figure 2 .

[0054] Whole genome selection pressure analysis found that multiple phospholipase encoding genes were under selection, among which pla2g1b had strong selection signals, as shown in Figure 3 based on F ST XP-EHH identified key evolutionary difference genes pla2g1b . As can be seen from Figure 3 , pla2g1b the genomic region where the gene is located is under strong positive selection in shortfin pompano, with an XP-EHH value of -3.38 (the highest 5% threshold is 2.08, and the lowest 5% threshold is = -1.21; XP-EHH analysis uses longfin pompano as the reference population, negative numbers indicate that shortfin pompano is under positive selection, and positive numbers indicate that shortfin pompano is under negative selection), F ST the value is 0.47 (the highest 5% threshold is 0.44).

[0055] Figure 4 shows pla2g1b linkage disequilibrium analysis of the upstream promoter sequence of the gene. There are 35 tightly linked SNPs in the range of -1959 ~ -7 bp upstream of the gene. Among them, the 4 core SNPs are Figure 4 the 5th to 8th from left to right in the upper row, which have a very strong genetic correlation with the rest of the SNPs (r²> 0.97) and can be used as representative tag SNPs for this block.

[0056] ATAC sequencing found that pla2g1b there is a peak in the range of -1741bp ~ -1642bp upstream (as shown in Figure 5 ). The above results show that pla2g1b participated in the hypoxia response of pompano, and mutations in the promoter region of the gene regulate gene transcription, which is negatively correlated with the hypoxia tolerance of pompano.

[0057] Sequence analysis shows that pla2g1b the promoter region within 2kb upstream of the gene contains 35 tightly linked SNPs, and the combination of these SNPs constitutes 4 major haplotypes, namely Hap 1, Hap 2, Hap 3, and Hap 4 (see Table 3). As Figure 6As shown, in hypoxia-tolerant longfin pomfret (N = 40), the frequencies of Hap 1, Hap 2, Hap 3, and Hap 4 were approximately 36.2%, 30.2%, 29.8%, and 3.8%, respectively; in hypoxia-sensitive shortfin pomfret (N = 40), the frequencies of these four haplotypes were approximately 92.5%, 0%, 5.0%, and 2.5%, respectively. Specifically, Hap 1 was almost fixed (extremely high rate) in hypoxia-sensitive shortfin pomfret; Hap 2 was a medium-frequency type in longfin pomfret, and was extremely low or undetectable in the shortfin population; Hap 3 and Hap 4 were both low-frequency types, mainly found in the longfin population, and may be background-linked genetic variations.

[0058] Because of the high linkage rate among SNPs, utilizing pla2g1b Four bases at the upstream positions (-1811 / -1777 / -1753 / -1732 bp, genomic locations on chromosome 20 at 16650770 bp, 16650804 bp, 16650828 bp, and 16650849 bp) can distinguish Hap 1 from Hap 2, 3, and 4. When the bases at these four positions are T / G / G / C, it can be identified as Hap 1; when the bases are G / T / A / A, it belongs to one of the other three haplotypes.

[0059] Table 3 Serial number Position Haplotype 1 (Hap 1) Haplotype 2 (Hap 2) Haplotype 3 (Hap 3) Haplotype 4 (Hap 4) 1 16650622 G A A A 2 16650647 G C C C 3 16650683 G A A G 4 16650697 G C C G 5 16650711 G A A G 6 16650770 T G G G 7 16650804 G T T T 8 16650828 G A A A 9 16650849 C A A A 10 16650916 C T T T 11 16651053 T A A A 12 16651124 C T T T 13 16651138 A G G G 14 16651201 T A A A 15 16651214 A T A T 16 16651370 G T T T 17 16651392 A G G G 18 16651410 G T T T 19 16651457 A G G G 20 16651479 G A A A 21 16651605 A G G G 22 16651640 T C C C 23 16651942 T C C C 24 16651982 A G G G 25 16652017 A G G G 26 16652047 A T T T 27 16652083 C A A A 28 16652129 C T T T 29 16652165 T C C C 30 16652251 T G G G 31 16652395 T C C C 32 16652433 T C C C 33 16652476 A G G G 34 16652573 T C C C 35 16652574 G A A A

[0060] Example 4 - Molecular functional verification of eQTL: synthesis pla2g1b The promoter sequences Hap1 (T / G / G / C) and Hap2 (G / T / A / A) were constructed into the pGL3-basic vector, and the full-length coding sequence of hypoxia-inducible factor 1α (HIF1α) was inserted into the pcDNA3.1(+) vector. All constructs were verified by Sanger sequencing. The transfection experiment was performed as follows: HEK293T cells were seeded at 60-70% confluence in 24-well plates and cultured in DMEM medium containing 10% fetal bovine serum (Gibco). The plasmid mixture was transfected using Lipofectamine 2000 (Invitrogen) and contained: (i) 400 ng pGL3 series reporter vectors: empty vector (pGL3-basic), positive control vector (pGL3-promoter), and reporter vector ( pla2g1b Promoter haplotype 1 and pla2g1bPromoter-haplotype 2, (ii) 40 ng internal control vector (pRL-TK), and (iii) 400 ng pcDNA3.1-HIF1α overexpression plasmid or empty vector, maintaining a firefly / Kidney luciferase plasmid ratio of 10:1. After 4-6 hours of transfection, the medium was replaced with complete medium and cultured for another 48 hours. The plasmid transfection combinations are shown in Table 4. Luciferase activity was detected using a dual-luciferase reporter gene detection system. The results showed that co-transfection of the Hap1 haplotype promoter with HIF-1a resulted in stronger transcriptional activity, as shown in the table below. Figure 7 As shown. Based on the above analysis results, pla2g1b The gene was identified as a key gene for the regulation of hypoxia in golden pomfret, and the haplotype SNP in the promoter region of this gene was identified as an eQTL molecular marker for the regulation of hypoxia in golden pomfret.

[0061] Table 4 Serial number Transfection plasmid combination 1 pcDNA3.1 empty + pGL3-basic + PRL-TK 2 HIF1a-pcDNA3.1 + pGL3-basic + PRL-TK 3 pcDNA3.1 empty + Hap1- pGL3-promoter + PRL-TK 4 HIF1a-pcDNA3.1 + Hap1- pGL3-promoter + PRL-TK 5 pcDNA3.1 empty + Hap2- pGL3-promoter + PRL-TK 6 HIF1a-pcDNA3.1 + Hap2- pGL3-promoter + PRL-TK The beneficial effects of the embodiments of the present invention are: This invention provides an eQTL molecular marker significantly associated with hypoxia tolerance in golden pomfret. By integrating whole-genome resequencing, transcriptome sequencing, and open chromatin omics data, eQTL markers located in... pla2g1b A specific combination of mutation sites (haplotypes) in the upstream regulatory region of a gene is identified as a molecular marker that is significantly correlated with the hypoxia tolerance of golden pomfret individuals. This marker can be used to efficiently and accurately assess the hypoxia adaptation of golden pomfret individuals. The primer pairs and genotyping methods provided in this invention enable specific amplification and genotyping of the target marker region. The operation is simple, highly sensitive, and suitable for large-scale screening in breeding populations. This technology can serve as an effective tool for molecularly-assisted selection of hypoxia tolerance traits in golden pomfret, improving breeding efficiency, shortening the breeding cycle of new lines, and providing a reliable molecular basis for the cultivation of hypoxia-tolerant new varieties.

[0062] This invention is described with reference to flowchart illustrations and / or block diagrams of methods, apparatus (systems), and computer program products according to embodiments of the invention. It will be understood that each block of the flowchart illustrations and / or block diagrams, and combinations of blocks in the flowchart illustrations and / or block diagrams, can be implemented by computer program instructions. These computer program instructions can be provided to a processor of a general-purpose computer, special-purpose computer, embedded processor, or other programmable data processing apparatus to produce a machine, such that the instructions, which execute via the processor of the computer or other programmable data processing apparatus, generate instructions for implementing the flowchart illustrations and / or block diagrams. Figure 1 One or more processes and / or boxes Figure 1 A device that provides the functions specified in one or more boxes.

[0063] These computer program instructions can also be stored in a computer- readable memory that can direct a computer or other programmable data processing apparatus to function in a particular manner, such that the instructions stored in the computer-readable memory produce an article of manufacture including instructions which implement the Figure 1 function specified in the flow or flows and / or blocks Figure 1 of the block or blocks.

[0064] The computer program instructions can also be loaded onto a computer or other programmable data processing apparatus to cause a series of operational steps to be performed on the computer or other programmable apparatus to produce a computer implemented process such that the instructions that are executed on the computer or other programmable apparatus provide steps for implementing the Figure 1 function specified in the flow or flows and / or blocks Figure 1 of the block or blocks.

[0065] While the preferred embodiments of the application have been described, additional variations and modifications can be made to the embodiments by those skilled in the art once they learn of the basic inventive concepts. Therefore, the appended claims are intended to cover all such additional variations and modifications as fall within the scope of the application.

[0066] Obviously, numerous modifications and variations of the present application are possible in light of the above teachings. It is therefore to be understood that within the scope of the appended claims and their equivalents, the application can be practiced otherwise than as specifically described.

Claims

1. An eQTL molecular marker related to the hypoxia tolerance trait of golden pompano (Trachinotus ovatus), characterized in that: based on whole genome resequencing, transcriptome sequencing and chromatin open group analysis of golden pompano, the eQTL molecular marker is significantly related to the hypoxia tolerance trait of golden pompano, and is used for assisted selection of a hypoxia tolerance strain as a molecular marker; the eQTL molecular marker is located in the 16650700 ~ 16650870 bp segment of chromosome 20 of golden pompano, and the corresponding nucleotide sequence is shown as SEQ ID NO. 1; the eQTL contains four SNP sites located at 16650770 bp, 16650804 bp, 16650828 bp and 16650849 bp of chromosome 20, respectively; and the four SNP sites are mutated to T→G, G→T, G→A and C→A.

2. A primer pair for detecting the eQTL molecular marker of claim 1, characterized in that: genomic DNA of golden pompano to be identified is extracted, and the extracted genomic DNA is used as a template to design a forward primer and a reverse primer based on a fragment containing the eQTL molecular marker for PCR amplification of a target fragment, and Sanger sequencing is used to perform SNP typing on the amplified target fragment; when the haplotype of the SNP molecular marker is haplotype 1, it indicates a golden pompano strain with strong hypoxia tolerance, and the bases are T / G / G / C; when the haplotype of the SNP molecular marker is haplotype 2, it indicates a golden pompano strain with poor hypoxia tolerance, and the bases are G / T / A / A; the forward primer is 5'-3': CGAATTTCCGATGTGTCTTT; and the reverse primer is 3'-5': CTGTCTTTATTTCCTCCCTAG.

3. Use of the eQTL molecular marker related to the hypoxia tolerance trait of golden pompano of claim 1 and the primer pair of the eQTL molecular marker of claim 2 in regulating the hypoxia tolerance trait of golden pompano.

4. The use of claim 3, characterized in that: the eQTL molecular marker is used in molecular breeding of the hypoxia tolerance trait of golden pompano.

5. The use of claim 4, characterized in that: the eQTL molecular marker is used in screening of a hypoxia tolerance strain and improving selection efficiency of a hypoxia adaptation related gene. ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​

Images