A tomato whole genome 3.5k liquid breeding chip, and a single nucleotide polymorphism variation site and application thereof

By developing a 3.5K liquid-phase breeding chip for the whole tomato genome and utilizing a combination of probes for 3,458 single nucleotide polymorphism variation sites, we have achieved accurate detection and identification of the whole tomato genome, solved the problem of identifying multi-gene controlled traits in tomato breeding, and improved breeding efficiency and germplasm resource management.

CN120905426BActive Publication Date: 2026-05-19BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511092419.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-05
Publication Date
2026-05-19
Estimated Expiration
2045-08-05

AI Technical Summary

Technical Problem

In existing technologies, tomato breeding lacks an effective molecular marker system, making it difficult to efficiently identify and utilize complex quantitative traits controlled by multiple genes. Furthermore, the application of liquid phase chips in tomatoes has not been reported, which affects the independent control of germplasm resources and the breeding process.

Method used

A 3.5K liquid-phase breeding chip for the whole tomato genome was developed, containing a probe combination of 3458 single nucleotide polymorphism variation sites. Through liquid-phase reaction and high-throughput sequencing, the whole tomato genome can be accurately detected and identified.

Benefits of technology

It provides a high-throughput, accurate, and low-cost method that can quickly identify the authenticity and phylogenetic relationships of tomato varieties, construct fingerprint profiles, support early breeding and germplasm resource protection, and improve breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905426B_ABST
    Figure CN120905426B_ABST
Patent Text Reader

Abstract

The application discloses a tomato 3.5K liquid-phase breeding chip and a special single nucleotide polymorphism variation site and application thereof. The 3.5K liquid-phase breeding chip provided by the application comprises a probe combination for detecting 3458 single nucleotide polymorphism variation sites in a tomato genome, and the position information of the probe corresponding to each single nucleotide polymorphism variation site in the tomato reference genome can be seen from Table 3 in the specification. The single nucleotide polymorphism variation site involved in the liquid-phase breeding chip provided by the application has the advantages of high polymorphism, good repeatability, stable and reliable marker, and convenience in statistics, and the like. The application can also establish a DNA fingerprint database for identifying the authenticity of the tomato variety based on the liquid-phase breeding chip, and can be used for the authenticity of the tomato variety, early selection and identification of the tomato variety, identification of the tomato seed resource, and the like, thereby providing technical support for the enrichment of the tomato germplasm resource, selection of new varieties and protection of new varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of tomato variety identification technology, specifically to a tomato whole genome 3.5K liquid phase breeding chip and its dedicated single nucleotide polymorphism variation sites and applications. Background Technology

[0002] Tomatoes are rich in nutrients and have a unique flavor, making them an important dual-purpose crop for both fruit and vegetable cultivation. Widely cultivated worldwide, they have a significant impact on increasing agricultural efficiency, farmers' income, and adjusting the agricultural industrial structure. In recent years, my country's tomato industry has developed steadily, with domestic breeding units undertaking extensive work in germplasm innovation. New varieties developed have shown significant improvements in both disease resistance and quality. However, long-term artificial selection has also resulted in a narrow genetic background for tomatoes and limited varietal genetic diversity. With the advancement of modernization in my country, people have higher expectations for tomato quality, making the discovery, identification, and breeding utilization of superior tomato resources increasingly important.

[0003] Molecular markers play a crucial role in basic crop research and genetic breeding, and are also an important technical method for identifying and utilizing superior crop resources and genes. Currently, research on tomato molecular markers mainly targets a few trait gene loci, and there is still no effective molecular breeding system for complex quantitative traits controlled by multiple genes, such as yield and quality. Single nucleotide polymorphisms (SNPs) refer to polymorphisms in nucleic acid sequences at the genomic level caused by changes in a single nucleotide, including single base transitions, insertions, and deletions. As a third-generation molecular marker, SNPs are characterized by their large number, wide distribution, ease of rapid large-scale screening, and convenient genotyping, making them a widely recognized and highly promising molecular marker technology.

[0004] Liquid-phase microarrays are a novel single nucleotide polymorphism (SNP) detection method based on targeted sequencing. According to the base pairing principle, oligonucleotide probes complementary to the target region sequence can be designed under liquid-phase reaction conditions. Through target capture combined with high-throughput next-generation sequencing, this method is an effective way to detect genetic variations in genomic regions or sites of interest, offering high flexibility and scalability, and is particularly suitable for the analysis of complex traits in crops. Liquid-phase microarrays have already seen relatively mature applications in germplasm resource evaluation, DNA fingerprinting, marker-assisted selection, and genome-wide selection breeding in crops such as maize, rice, and wheat. However, there are no reports of their application in tomatoes. Therefore, developing a liquid-phase microarray for tomatoes is of great significance for achieving independent control over germplasm resources and tackling core breeding technologies. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the present invention aims to provide a tomato whole-genome 3.5K liquid-phase breeding chip, its dedicated single nucleotide polymorphism (SNP) variation sites, and its applications. This liquid-phase breeding chip can accurately obtain the genotypes of SNP variation sites throughout the tomato genome.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] Option 1:

[0008] A probe array for detecting combinations of single nucleotide polymorphism (SNP) sites in the tomato genome is disclosed. Each SNP site corresponds to one probe, and the SNP site array includes 3458 SNP sites. The locations and base types of the 3458 SNP sites in the tomato genome are shown in Table 1 of this specification. The locations of the 3458 SNP sites in the genome are determined based on the tomato Heinz 1706 reference genome version V3. In Table 1, the numbers on the left indicate the chromosome number where the SNP site is located, the values ​​in the middle indicate the physical location of the chromosome where the SNP site is located, and the letters on the right indicate the two base types of the SNP site.

[0009] In the probe combination of Scheme 1 of the present invention, as a preferred embodiment, the corresponding positions of the sequences of each probe in the probe combination in the genome are shown in Table 3 of the present invention specification. The corresponding positions are determined based on the tomato Heinz1706 reference genome version V3. In Table 3, the information of the corresponding position of each probe includes three data. From left to right, the first data represents the chromosome number where the single nucleotide polymorphism variation site is located, the second data represents the start position on the chromosome where the probe is located, and the third data represents the end position on the chromosome where the probe is located.

[0010] Option 2:

[0011] A 3.5K liquid phase breeding chip for the whole genome of tomato includes the probe combination described in Scheme 1 of this invention for detecting single nucleotide polymorphism variation sites in the whole genome of tomato.

[0012] The liquid-phase breeding chip targeting scheme one is used to detect single nucleotide polymorphism variation sites in the tomato whole genome to obtain base information of polymorphic sites.

[0013] Liquid-phase breeding chips can also contain other commonly used reagents or equipment.

[0014] Option 3:

[0015] The use of the probe combination of Scheme 1 described above for detecting single nucleotide polymorphism variant sites in the tomato genome includes any one of the following uses (1) to (8):

[0016] (1) A kit for preparing a tomato variety identification kit;

[0017] (2) A kit for preparing a test kit to identify the authenticity of tomato varieties;

[0018] (3) Kits for preparing and analyzing the genetic relationships of tomato varieties;

[0019] (4) Used for identifying tomato varieties;

[0020] (5) Used to identify genuine tomato varieties;

[0021] (6) Used to analyze the genetic relationships of tomato varieties;

[0022] (7) Used to identify whether the tomato variety to be tested contains any of the 28 superior tomato genes shown in Table 2 or which of the 28 superior tomato genes shown in Table 2 it contains;

[0023] (8) Used to construct a fingerprint database of tomato varieties to be tested.

[0024] Option 4:

[0025] The uses of the tomato whole genome 3.5K liquid phase breeding chip in Scheme 2 above include any one of the following uses (A) to (E);

[0026] (A) Used to identify tomato varieties;

[0027] (B) Used to identify genuine tomato varieties;

[0028] (C) Used to analyze the genetic relationships of tomato varieties;

[0029] (D) Used to identify whether the tomato variety to be tested contains any of the 28 superior tomato genes shown in Table 2 of this application specification, or which of the 28 superior tomato genes shown in Table 2 it contains;

[0030] (E) Used to construct a fingerprint database of the tomato varieties to be tested.

[0031] Option 5:

[0032] A method for constructing a fingerprint database of tested tomato varieties includes the following steps:

[0033] S1-1: Obtain the genomic DNA of the tested tomato variety;

[0034] S1-2: The genomic DNA obtained in step S1-1 is fragmented, end-repaired, adapter-ligated, and purified to obtain a DNA library;

[0035] S1-3: Combine the DNA library with the probes from Scheme 1 above to form a hybridization system and perform hybridization capture. After purification, obtain the sequencing library.

[0036] S1-4: Sequencing and data analysis were performed on the sequencing library to obtain the genotyping information of the 3458 single nucleotide polymorphism (SNP) variant sites shown in Table 1 of this specification. Based on the genotyping information of the 3458 SNP variant sites, a fingerprint database of the tested tomato varieties was constructed.

[0037] Option Six:

[0038] A method for identifying a tomato variety to be tested includes the following steps:

[0039] S2-1: Obtain the genomic DNA of the tomato variety to be tested and the standard tomato variety, respectively;

[0040] S2-2: The genomic DNA of each variety obtained in step S2-1 is broken, end-repaired, adapter-ligated, and purified to obtain the DNA library of the corresponding variety.

[0041] S2-3: Combine the DNA libraries of each variety with the probes of Scheme 1 above to form a hybridization system and perform hybridization capture. After purification, obtain the sequencing libraries of each variety.

[0042] S2-4: Sequencing and data analysis were performed on the sequencing libraries of each variety to obtain the genotyping information of the 3458 single nucleotide polymorphism variant sites shown in Table 1 of this specification in each variety.

[0043] S2-5: The genotyping results of 3458 single nucleotide polymorphism (SNP) variants in the tested tomato variety were compared with those of 3458 SNP variants in the standard tomato variety. The similarity (LS) of the SNP variants between the two tomato varieties was calculated. The formula for LS is: LS = (1 - D / T) × 100%, where D is the number of differentially expressed SNP variants between the two varieties, and T is the total number of SNP variants compared. Then, the following judgments were made:

[0044] If the locus similarity between the tomato variety being tested and a standard tomato variety is ≥98.0%, then the tomato variety being tested and the standard tomato variety are the same variety or are suspected to be the same variety; the fewer the number of different loci, the higher the locus similarity.

[0045] If the site similarity between the tomato variety to be tested and a certain standard tomato variety is between 96.0% and 98.0% but does not include 98%, then the tomato variety to be tested and the standard tomato variety are similar varieties.

[0046] If the site similarity between the tomato variety to be tested and a certain standard tomato variety is <96.0%, then the tomato variety to be tested and the standard tomato variety are different varieties.

[0047] The standard tomato varieties mentioned in this invention refer to known tomato varieties, such as the 134 tomato varieties recorded in Table 4 of this invention.

[0048] In the above-mentioned scheme five method for constructing the fingerprint database of the tested tomato varieties or the above-mentioned scheme six method for identifying the tomato varieties to be tested, as one possible implementation method, in step S1-2 or S2-2, the fragmentation and end repair are carried out by a system containing fragmentation and end repair enzymes. The system is: 300 ng DNA, 2.6 μL of fragmentation and end repair enzymes, 4 μL of end repair reaction buffer, and ultrapure water to make up to 20 μL.

[0049] In the above-mentioned scheme five method for constructing the fingerprint database of the tested tomato varieties or the above-mentioned scheme six method for identifying the tomato varieties to be tested, as one possible implementation method, in step S1-2 or S2-2, the reaction system for the adapter ligation is 10 ng of end-repaired DNA, 2 μL of DNA ligase, 8 μL of buffer, 4 μL of Illumina TrueSeq universal adapter sequence, and ultrapure water to a final volume of 20 μL.

[0050] In either the method for constructing the fingerprint database of the tested tomato varieties in Scheme 5 or the method for identifying the tomato varieties to be tested in Scheme 6, as one possible implementation, in step S1-3 or S2-3, the hybridization system consists of 2.5 μg of the concentrated DNA library obtained in step S2-2, 4 μL of probe working solution with a concentration of 50 ng / μL, and ultrapure water to make up the system to 16 μL.

[0051] The beneficial effects of this invention are:

[0052] (1) The single nucleotide polymorphism variation site combination provided by the present invention has the advantages of high polymorphism, good repeatability, uniform distribution on chromosomes, stable and reliable markers and easy statistics, which can reflect the genetic kinship of the tested tomato varieties to the greatest extent.

[0053] (2) The material background of the single nucleotide polymorphism variation site combination involved in the liquid phase breeding chip of the present invention covers a wider range of tomato varieties, with high representativeness and rich diversity information.

[0054] (3) The 3.5K liquid phase breeding chip provided by the present invention can be applied to the identification of the authenticity of tomato varieties, identification of kinship, hybridization and selection and fingerprint pattern construction, which is conducive to accelerating the process of tomato research and breeding.

[0055] (4) This invention provides for the first time a method for constructing a DNA fingerprint database for identifying the authenticity of tomato varieties based on high-throughput sequencing. It can be used to identify tomato varieties at an early stage of seed or seedling stage, ensuring the authenticity of varieties, effectively protecting the rights and interests of producers and breeders, and providing technical support for the protection of tomato germplasm resources and new varieties.

[0056] (5) The method for identifying tomato varieties provided by the present invention can identify both unknown tomato varieties and the authenticity of known varieties.

[0057] (6) The method provided by the present invention has the advantages of high throughput, accuracy, low cost, simple operation, and saving manpower and material resources, and has a very broad application prospect. Attached Figure Description

[0058] Figure 1 This is a distribution map of single nucleotide polymorphism variation sites in the tomato genome using the 3.5K liquid phase breeding chip of the present invention.

[0059] Figure 2 The genotype deletion rate of the 3.5K liquid phase breeding chip of the present invention in 134 representative tomato varieties.

[0060] Figure 3 The MAF values ​​of the genotypes in 134 representative tomato varieties are obtained using the 3.5K liquid phase breeding chip of this invention.

[0061] Figure 4 The results of the analysis of the superior gene carrying status of 134 tomato varieties using the 3.5K liquid phase breeding chip of the present invention are as follows.

[0062] Figure 5 This is a distribution of background recovery rate for 117 individual plants in the BC2F1 population using the 3.5K liquid phase chip of the present invention. Detailed Implementation

[0063] The following embodiments and accompanying drawings are provided to facilitate a better understanding of the present invention. They are intended to explain in detail one aspect or certain features of the present invention, but do not constitute a limitation on the present invention.

[0064] Unless otherwise stated, the technical and scientific terms used in this invention have their common meaning in the art.

[0065] Any improvements or extensions to the embodiments of the present invention without departing from the spirit or scope of the present invention shall fall within the protection scope of the present invention.

[0066] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. For liquid-phase chip application methods not described in detail in the specification, please refer to (Targeted Sequencing Genotyping (GBTS) Technology and Its Application, 2020).

[0067] Unless otherwise specified, all experimental materials used in the following examples were purchased from conventional biochemical reagent stores. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0068] Example 1: Obtaining single nucleotide polymorphism (SNP) variation sites from a 3.5K liquid-phase breeding chip in the tomato whole genome.

[0069] This invention utilizes 96 tomato resequencing datasets published in the VegSNP DB (www.vegsnpdb.cn), a large-scale platform for single nucleotide polymorphism (SNP) variation in the vegetable genome, to screen for high-quality SNP sites that represent the genetic information of the entire genome and are suitable for targeted sequencing. Specifically, the SNP screening criteria are as follows: minimum allele frequency (MAF) > 0.1, genotype heterozygosity < 0.1, genotype deletion rate < 0.1, and no other SNPs, SSRs, or Indels within 50 bp flanking the SNP. Additionally, this is combined with 28 key SNPs linked to important agronomic traits screened by our team. Ultimately, the inventors of this invention screened 3458 SNP sites evenly distributed throughout the tomato genome for use in a 3.5K liquid-phase breeding microarray, exhibiting high polymorphism information content (PIC value). The locations and variant bases of these 3458 single nucleotide polymorphism (SNP) sites on tomato chromosomes are shown in Table 1, and their distribution on the 12 tomato chromosomes is shown in [Table 1]. Figure 1 The base types and physical locations on chromosomes of the aforementioned single nucleotide polymorphism variants were determined based on the tomato Heinz 1706v3.0 reference genome (https: / / plants.ensembl.org / Solanum_lycopersicum / Info / Index?db=core).

[0070] The single nucleotide polymorphism (SNP) variant sites involved in the 3.5K breeding liquid phase chip for tomatoes are evenly distributed on chromosomes, with an average physical distance of 232.4 kb between each site, and 23.2% of the variant sites are located in the exon regions of genes.

[0071] Table 1. Location and base information of 3458 single nucleotide polymorphisms on chromosomes.

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084] Note: In the single nucleotide polymorphism (SNP) site information, the data to the left of the underscore is the chromosome where the SNP variation site is located, the middle value is the physical location of the SNP variation site on the chromosome, and the value to the right of the underscore is the two genotypes of the SNP variation site.

[0085] The important functional genes and variation information of tomatoes involved in the tomato 3.5K liquid phase breeding chip of this invention are shown in Table 2.

[0086] Table 2. Important functional genes and variation information in the 3.5K liquid phase breeding chip for tomatoes.

[0087]

[0088]

[0089] In Table 2, "-" in the "Variation Type" column indicates a base deletion.

[0090] Example 2: Probe preparation for a 3.5K liquid phase breeding chip for tomatoes

[0091] The tomato 3.5K liquid-phase breeding chip includes 3458 probe combinations, each probe hybridizing with a single nucleotide polymorphism (SNP) variant region to form a double strand. Based on the base pairing principle, oligonucleotide probes complementary to the target sequence are designed, with the probe combination design principles as follows:

[0092] (1) The average probe length is 149 bp, the single nucleotide polymorphism variation site is in the middle of the probe, and the probe sequence length varies from 109 to 214 bp.

[0093] (2) The probe is located in a relatively conservative region (with no other variations in the 50bp on both sides), avoiding regions with repetitive sequences and structural variations;

[0094] (3) The GC content of the probe is 40%-60%, with a stronger capture ability in the 50% region, avoiding high GC and high AT regions.

[0095] Table 3 shows the unknown information of the 3458 probes in the 3.5K liquid phase breeding chip for tomatoes.

[0096] The probe sequences in Table 3 are synthesized from single-stranded nucleotides, ranging in length from 109 bp to 214 bp, with an average of 149 bp. They are polystyrene microspheres with a biotin group modified at the 5' end and covalently coupled to biotin.

[0097] Table 3. Probe location information for the 3.5K liquid phase breeding chip for tomatoes.

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114] Note: In the single nucleotide polymorphism (SNP) variation site information, the leftmost data is the chromosome number where the SNP variation site is located, the middle data is the start position on the chromosome where the probe is located, and the rightmost value is the end position on the chromosome where the probe is located.

[0115] Example 3: Evaluation of the genotype detection efficiency of tomato 3.5K liquid phase breeding chip

[0116] A 3.5K liquid-phase breeding chip for the whole genome of tomato involves single nucleotide polymorphism (SNP) variant sites listed in Table 1 of Example 1 above. This liquid-phase breeding chip includes the probe combination from Example 2. Specifically, 3458 SNP variant sites correspond to 3458 probes, and each probe hybridizes with one SNP variant site to form a double strand.

[0117] To evaluate the genotyping efficiency of 3458 single nucleotide polymorphism (SNP) variant sites, the tomato 3.5K liquid phase breeding chip of this invention was used to perform SNP genotyping on 134 tomato hybrids collected from China.

[0118] The basic information of the 134 tomato varieties tested in this embodiment is shown in Table 4. All 134 tomato varieties tested are common and excellent varieties in production or some are introduced varieties from abroad.

[0119] Table 4.134 Information on Tomato Varieties

[0120]

[0121]

[0122] The experimental method for detecting tomatoes using a 3.5K liquid phase breeding chip includes specific steps such as obtaining genomic DNA, library construction, hybridization capture, sequencing, and data analysis.

[0123] 1. Obtaining genomic DNA from the tested tomato varieties

[0124] Genomic DNA was extracted from the leaves of 134 tested tomato varieties using the SDS magnetic bead method.

[0125] The quality and concentration of genomic DNA from the tested tomato varieties must meet the requirements for PCR. The standards are as follows: 1% agarose gel electrophoresis shows a single DNA band without obvious diffusion; the A260 / A230 ratio is between 1.5 and 2.0, and the A260 / A280 ratio is between 1.8 and 2.0, as detected by a Nanodrop 2000 (Thermo) UV spectrophotometer; the concentration of genomic DNA from the tested tomato varieties is >50 ng / μL.

[0126] 2. Library Construction

[0127] Take 300 ng of quality-tested DNA, add 2.6 μL of fragmentation and end-repair enzyme, 4 μL of end-repair reaction buffer, and ultrapure water to a final volume of 20 μL. Then, incubate at 37°C for 30 min and 72°C for 30 min. After fragmentation and repair by the end-repair enzyme, an A will be added to the 3' end of the DNA.

[0128] Using 10 ng of the repaired DNA obtained in the previous step, 2 μL of DNA ligase, 8 μL of buffer, 4 μL of the Illumina TrueSeq universal adapter sequence (AATGATACGGCGACCACCGAGATCTACAC, sequence 1), and ultrapure water to a final volume of 20 μL, the mixture was incubated at 22°C for 60 min. The DNA fragment with added DNA (A) was ligated to the adapter. PCR amplification was used to ligate the index and the sequence from the sequencer to both ends of the adapter-containing DNA fragment, forming a complete library structure. The library was purified and fragments were selected by adding purification beads and mixing by pipetting or vortexing. The purified and selected fragments were then mixed in equal volumes to form a mixed library.

[0129] 3. Hybrid capture

[0130] The mixed library was concentrated to a dry powder state and then added to the hybridization system for hybridization capture. 2.5 μg of the concentrated library was added to 4 μL of 50 ng / μL probe working solution, and ultrapure water was added to bring the total volume to 16 μL. The mixture was then incubated at 95°C for 10 min and then at 65°C for 2–4 h. After hybridization, 16 μL of the hybridization capture solution was transferred to prepared magnetic beads. The enriched product was purified to complete the preparation of the sequencing library.

[0131] 4. Sequencing and data analysis

[0132] The purified products were mixed in equal volumes and subjected to high-throughput sequencing using a BGI T7 sequencer. The raw sequencing bases were split according to the barcodes of different samples, low-quality sequencing data were filtered out, and the data were compared with the tomato Heinz 1706 reference genome (V3) to mine single nucleotide polymorphism (SNP) variants. Based on the obtained SNP variant information, the corresponding SNP genotypes were derived, thereby constructing the fingerprint profile of the tested varieties.

[0133] 5. Efficiency Evaluation

[0134] After testing 134 tomato samples, the average genotypic data detection rate of the tomato 3.5K liquid phase breeding chip was 99.4%. Figure 2 ).

[0135] By statistically analyzing the minimum allele frequency (MAF) of 3458 single nucleotide polymorphism (SNP) variants, 90.95% of the SNP sites had an MAF value greater than 0.05, with an average MAF of 0.24. Figure 3 This indicates that the tomato 3.5K liquid phase breeding chip developed in this invention has high polymorphism in 134 tomato test varieties.

[0136] Example 4: Evaluation of the number of superior alleles carried by 134 tomato varieties

[0137] The tomato 3.5K liquid phase breeding chip developed in this invention can be used to identify whether the tested varieties contain the 28 known superior tomato genes or which of the 28 known superior tomato genes they contain.

[0138] Based on the single nucleotide polymorphism (SNP) information of the 134 tested tomato varieties obtained in Example 3 and the correspondence between the linkage variations of superior genes listed in Table 2 and the SNPs in Example 1, the number of superior genes carried by the 134 tomato varieties can be quickly obtained (see Example 3). Figure 4 This provides data support for precision gene aggregation breeding.

[0139] Example 5: Method for detecting whether a tomato variety belongs to one of 134 tested tomato varieties

[0140] 1. Obtaining genomic DNA from the tomato variety to be tested

[0141] The leaves of the tomato variety "Jingfan Baiyutang" were taken from the experimental base of the Vegetable Research Institute of Beijing Academy of Agricultural and Forestry Sciences.

[0142] Following the method in step 1 of Example 3, replace "the leaf of the tomato variety being tested" with "the leaf of the tomato variety to be tested", and keep all other steps unchanged to obtain the genomic DNA of the tomato variety to be tested.

[0143] 2. Preparation of sequencing libraries

[0144] Following the method in step 2 of Example 3, replace "genomic DNA of the tested tomato variety" with "genomic DNA of the tomato variety to be tested", and keep all other steps unchanged to obtain the sequencing library of the tomato variety to be tested.

[0145] 3. Hybrid capture

[0146] Perform the procedure according to step 3 in Example 3.

[0147] 4. Sequencing

[0148] Sequencing libraries of the tomato varieties to be tested were obtained and sequenced.

[0149] The sequencing results of 3458 single nucleotide polymorphism (SNP) amplification products of the tested tomato varieties in the tomato 3.5K liquid phase breeding chip were compared with 3458 SNP variant sites of 134 tested tomato varieties (as shown in Table 4). The site similarity (LS) between the two tomato varieties was calculated, where:

[0150] The LS calculation formula is: LS=(1-D / T)×100%, where D is the number of differential loci between the two samples being compared, and T is the total number of loci being compared.

[0151] Then, the following judgment is made:

[0152] If the locus similarity between the tomato variety being tested and a standard tomato variety (the tested tomato variety) is ≥98.0%, then the tomato variety being tested and the standard tomato variety are suspected to be the same variety; the fewer the number of different loci, the higher the locus similarity.

[0153] If the site similarity between the tomato variety to be tested and a certain standard tomato variety (the tomato variety being tested) is between 96.0% and 98.0% but does not include 98%, then the tomato variety to be tested and the standard tomato variety are similar varieties.

[0154] If the site similarity between the tomato variety to be tested and a certain standard tomato variety is <96.0%, then the tomato variety to be tested and the standard tomato variety are different varieties.

[0155] The results showed that the genetic similarity of the tested tomato variety to 134 tested tomato varieties was 81% at 3458 single nucleotide polymorphism variation sites. Therefore, the tested tomato variety does not belong to any of the 134 tested tomato varieties, that is, the tested tomato variety "Jingfan Baiyutang" is different from any of the 134 tested tomato varieties.

[0156] Example 6: Constructing a DNA fingerprint database of 134 tomato varieties

[0157] The tomato 3.5K liquid phase breeding chip developed in this invention can be used to construct a DNA fingerprint database of 134 tomato varieties, establishing a unique DNA fingerprint molecular identity card for each variety resource.

[0158] Based on the 3458 nucleotide variation information in Example 1 and the 134 tested tomato varieties in Implementation Case 3, the method in Example 3 can be used to quickly construct a DNA fingerprint database of 134 tomato varieties, providing data support for whether to introduce newly collected variety resources into the DNA fingerprint database in the future.

[0159] Example 7: Screening for single plants that rapidly restore background in backcross breeding.

[0160] The tomato 3.5K liquid phase breeding chip developed in this invention can be used to quickly determine the donor and recipient genome percentages of each individual plant in backcross selection progeny, providing data support for screening backcross progeny with high background recovery rates.

[0161] Based on the 3458 nucleotide variation information in Example 1, seedling genotyping was performed on 117 individual plants from the BC2F1 population constructed from the donor parent FZ0825 and the recurrent parent JF107. 1864 SNP variations showing differences between the donor and recurrent parents were screened. The proportion of individual plants with the same genotype as the recurrent parent was calculated. A genotype proportion of 95% from the recurrent parent was used as the selection criterion for restoring the recurrent parent background. Finally, 3 individual plants were selected. Figure 5 Furthermore, its field phenotype is not significantly different from that of the recurrent parent, which significantly improves identification efficiency and saves field planting costs.

Claims

1. A probe array for detecting combinations of single nucleotide polymorphism (SNP) variant sites in the tomato genome, wherein each SNP corresponds to one probe, and the SNP combination comprises 3,458 SNP sites. The locations and base types of the 3,458 SNP sites in the genome are shown in Table 1. The numbers on the left indicate the chromosome number where the single nucleotide polymorphism (SNP) variant site is located, the numbers in the middle indicate the physical location of the SNP variant site on the chromosome, and the letters on the right indicate the two base types of the SNP variant site. Table 1 is as follows: The nucleotide sequences of each probe in the probe combo are shown in Table 2. The information for each probe position contains three data points. From left to right, the first data point represents the chromosome number where the single nucleotide polymorphism variation site is located, the second data point represents the start position of the probe on the chromosome, and the third data point represents the end position of the probe on the chromosome. Table 2 is as follows: The locations of the 3,458 single nucleotide polymorphism (SNP) variant sites in the genome and the corresponding locations of the nucleotide sequences of each probe in the genome were determined based on the Heinz 1706 reference genome version V3.

2. A 3.5K liquid-phase breeding chip for the whole genome of tomato, characterized in that, This includes the probe combination for detecting combinations of single nucleotide polymorphism variation sites in the tomato genome as described in claim 1.

3. The use of a probe assembly, characterized in that, The probe combination is the probe combination for detecting single nucleotide polymorphism variation sites in the whole genome of tomato as described in claim 1, and the use includes any one of the following (1) to (7): (1) A kit for preparing a tomato variety identification kit; (2) A kit for preparing a test kit to identify the authenticity of tomato varieties; (3) A kit for preparing and analyzing the genetic relationships of tomato varieties; (4) Used for identifying tomato varieties; (5) Used to identify the authenticity of tomato varieties; (6) Used to analyze the genetic relationships of tomato varieties; (7) Used to construct a fingerprint database of tomato varieties to be tested.

4. The application of a 3.5K liquid-phase breeding chip for the whole genome of tomato, characterized in that, The tomato whole genome 3.5K liquid phase breeding chip is the tomato whole genome 3.5K liquid phase breeding chip according to claim 2, and the use includes any one of the following (A) to (D); (A) Used for identifying tomato varieties; (B) Used to identify the authenticity of tomato varieties; (C) Used to analyze the genetic relationships of tomato varieties; (D) Used to construct a fingerprint database of the tomato varieties to be tested.

5. A method for constructing a fingerprint database of tested tomato varieties, characterized in that, Includes the following steps: S1-1: Obtain genomic DNA from the tested tomato varieties; S1-2: The genomic DNA obtained in step S1-1 is fragmented, end-repaired, adapter-ligated, and purified to obtain a DNA library; S1-3: The DNA library is combined with the probes described in claim 1 for detecting combinations of single nucleotide polymorphism variant sites in the tomato genome to form a hybridization system and hybridization capture is performed. The resulting sequencing library is then purified. S1-4: Sequencing and data analysis of the sequencing library to obtain the genotyping information of the 3,458 single nucleotide polymorphism (SNP) variant sites as described in claim 1, and constructing a fingerprint database of the tested tomato varieties based on the genotyping information of the 3,458 SNP variant sites.

6. A method for identifying a tomato variety to be tested, characterized in that, Includes the following steps: S2-1: Obtain the genomic DNA of the tomato variety to be tested and the standard tomato variety, respectively; S2-2: The genomic DNA of each variety obtained in step S2-1 is broken, end-repaired, adapter-ligated, and purified to obtain the DNA library of the corresponding variety; S2-3: The DNA libraries of each variety are combined with the probes described in claim 1 for detecting single nucleotide polymorphism variation sites in the whole genome of tomato to form a hybridization system and hybridization capture is performed. The sequencing libraries of each variety are then purified. S2-4: Sequencing and data analysis of the sequencing libraries of each variety to obtain the genotyping information of the 3,458 single nucleotide polymorphism variant sites as described in Table 1 of claim 1 in each variety; S2-5: The genotyping results of 3,458 single nucleotide polymorphism (SNP) variants in the tested tomato variety were compared with those of 3,458 SNP variants in the standard tomato variety. The similarity (LS) of the SNP variants between the two tomato varieties was calculated using the formula: LS = (1-D / T)×100%, where D is the number of differentially expressed SNP variants between the two varieties, and T is the total number of SNP variants compared. Then, the following judgments were made: If the site similarity between the tomato variety to be tested and a certain standard tomato variety is greater than or equal to 98.0%, then the tomato variety to be tested and the standard tomato variety are the same variety. If the site similarity between the tomato variety to be tested and a certain standard tomato variety is between 96.0% and 98.0% but does not include 98%, then the tomato variety to be tested and the standard tomato variety are similar varieties. If the site similarity between the tomato variety to be tested and a certain standard tomato variety is less than 96.0%, then the tomato variety to be tested and the standard tomato variety are different varieties.

7. The method for identifying the tomato variety to be tested according to claim 6, characterized in that, In step S2-2, the fragmentation and end repair are performed using a system containing fragmentation and end repair enzymes. The system consists of: 300 ng DNA, 2.6 μL of fragmentation and end repair enzymes, 4 μL of end repair reaction buffer, and ultrapure water to bring the total volume to 20 μL.

8. The method for identifying the tomato variety to be tested according to claim 6, characterized in that, In step S2-2, the reaction system for adapter ligation consists of 10 ng of end-repaired DNA, 2 μL of DNA ligase, 8 μL of buffer, 4 μL of Illumina TrueSeq universal adapter sequence, and ultrapure water to a final volume of 20 μL.

9. The method for identifying the tomato variety to be tested according to claim 6, characterized in that, In step S2-3, the hybridization system consists of 2.5 μg of concentrated DNA library obtained in step S2-2, 4 μL of probe working solution with a concentration of 50 ng / μL, and ultrapure water to make up the system to 16 μL.