A yarrowia lipolytica engineering strain based on citric acid metabolism regulation for efficient production of eicosapentaenoic acid, method and application
By overexpressing extended desaturase, heterologous ATP-citrate lyase, and mitochondrial citrate carrier in Yersinia lipolytica, the problems of increased cost and carbon flux loss caused by citrate production were solved, resulting in a significant increase in EPA and oil production.
Patent Information
- Application Number
- CN202511048667.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-29
- Publication Date
- 2026-04-28
- Estimated Expiration
- 2045-07-29
AI Technical Summary
Existing technologies for producing eicosapentaenoic acid (EPA) from Yeast lipolyticis have drawbacks, such as increased pH adjustment costs and carbon flow loss due to the large production of citric acid, which affects the yield of oils and EPA.
In *Yarrowia lipolytica* strains, elongation desaturases in the fatty acid synthesis pathway were overexpressed, along with heterologous ATP-citrate lyases and mitochondrial citrate carriers, including Δ9 elongase, Δ8 desaturase, Δ5 desaturase, Δ17 desaturase, as well as ATP-citrate lyases and mitochondrial citrate carriers derived from different microorganisms.
It significantly improves the EPA and oil production of engineered *Saccharomyces limonene* strains, reduces citric acid efflux during fermentation, decreases costs, and improves strain stability and industrial applicability.
Smart Images

Figure CN120924417B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and in particular to a lipophilic yeast strain, method and application for the efficient production of eicosapentaenoic acid based on citric acid metabolism regulation. Background Technology
[0002] EPA (eicosapentaenoic acid) is mainly found in deep-sea fish (such as salmon and sardines) and diatoms, and has health benefits such as lowering cholesterol, reducing the risk of atherosclerosis, alleviating rheumatoid arthritis, and promoting brain development in infants and young children. In addition, EPA is also used to fortify dairy products and grains, as well as in lubricants, coatings, and synthetic reactions. Therefore, EPA has broad application prospects and value.
[0003] However, EPA production relies on fish oil (with an EPA content of approximately 15-30%), which is costly and environmentally polluting. Microbial synthesis of EPA is a promising strategy. Compared to traditional deep-sea fish extraction, microbial fermentation can shorten the production cycle from months of fishing and processing to days to weeks, offering greater controllability. Secondly, microbial synthesis eliminates dependence on marine fish resources, avoiding overfishing and ecological damage. For example, the carbon source for oil-producing yeast can be industrial waste molasses or renewable plant sugars, achieving a carbon conversion rate as high as 20%-30%. Finally, microbial synthesis can adapt to the demands of emerging markets, enabling customized production of various polyunsaturated fatty acid ratios to meet the needs of different industries.
[0004] Yarrowia lipolytica ( 解脂耶氏酵母 Erythritol (EPA) is recognized as a "Generally Recognized As Safe" (GRAS) substance by the U.S. Food and Drug Administration (FDA) and is widely used in food additives (such as erythritol and beta-carotene) and dietary supplements (such as Omega-3 fatty acids and selenium / chromium fortified products). Furthermore, *Yersinia lipolytica* can efficiently utilize carbon sources such as glucose, fructose, glycerol, and waste cooking oil (WCO), exhibiting a broad and sustainable substrate profile. *Yersinia lipolytica* also possesses advantages such as abundant acetyl-CoA supply, mature genetic tools and synthetic biology technologies, and significant industrial production potential, and has already been applied to the production of various polyunsaturated fatty acids. Therefore, *Yersinia lipolytica* is a potential strain for EPA production. However, some challenges remain in the production of EPA using *Yersinia lipolytica*. The main issue is the production of large amounts of citric acid during fermentation, necessitating the addition of alkali to adjust the pH during fermentation, increasing production costs. Simultaneously, the significant efflux of citric acid leads to carbon loss in *Yersinia lipolytica*, resulting in reduced oil yield and lower levels of EPA and other polyunsaturated fatty acids.
[0005] Cytoplasmic acetyl-CoA is a key precursor for EPA synthesis in *Yarrowia lipolytica*. *Yarrowia lipolytica* efficiently generates cytoplasmic acetyl-CoA via ATP-citrate lyase (ACL) and mitochondrial citrate carrier (YHM), which is a crucial precursor for EPA synthesis. YHM is responsible for transporting citrate generated in the mitochondria to the cytoplasm, providing a substrate for ACL. This transport is a critical step in maintaining the supply of acetyl-CoA in the cytoplasm. ACL catalyzes the cleavage of citrate into acetyl-CoA and oxaloacetate in the cytoplasm, consuming ATP in the process. Previous studies have explored the use of overexpressing endogenous ATP-citrate lyase and mitochondrial citrate carrier to increase citrate utilization efficiency in *Yarrowia lipolytica*. However, the effects of exogenous ATP-citrate lyase and mitochondrial citrate carrier on lipid yield and EPA content in *Yarrowia lipolytica* have not been investigated. Currently, patent publication number CN118613592 A shows that by overexpressing the LDAP protein gene in the Yersinia lipolytica strain Polf, the oil content reaches 0.26 g / L; patent authorization number CN 112391401 B shows that by knocking out the PLA2-3 gene in the Yersinia lipolytica strain Polg-G3, the oil yield reaches 4.78 g / L, which is 24% higher than the control strain.
[0006] The aforementioned patents focus on increasing the lipid content of *Yarrowia lipolytica*, without addressing the production of high-value fatty acids from *Yarrowia lipolytica*. There is still a need in the art for other methods to increase the production of high-value fatty acid-rich lipids from *Yarrowia lipolytica*. Summary of the Invention
[0007] The purpose of this invention is to overcome the shortcomings of the prior art and provide an engineered yeast strain for the efficient production of eicosapentaenoic acid based on citric acid metabolism regulation, its construction method, and its application.
[0008] The technical solution adopted by this invention to solve its technical problem is:
[0009] A *Yersinia lipolytica* strain for efficient production of eicosapentaenoic acid (EPA) based on citric acid metabolism regulation is described. The chassis strain of the engineered strain is *Yersinia lipolytica* Po1f, and this strain overexpresses partially elongating desaturases in the fatty acid synthesis pathway, including genes for Δ9 elongase, Δ8 desaturase, Δ5 desaturase, and Δ17 desaturase. In addition, heterologous ATP-citrate lyase (ACL) and mitochondrial citrate vector (YHM) are also overexpressed.
[0010] Furthermore, the Δ9 elongase is derived from 双游水霉 (SdΔ9EL), whose gene sequence is shown in SEQ ID No. 1;
[0011] The Δ8 desaturase comes from粘红酵母 NP11 (RtΔ8DE), whose gene sequence is shown in SEQ ID No. 2;
[0012] The Δ5 desaturase comes from 海洋微拟球藻 (NoΔ5DE), whose gene sequence is shown in SEQ ID No. 3;
[0013] The Δ17 desaturase is derived from Parietichytrium属 (PaΔ17DE), whose gene sequence is shown in SEQ ID No. 4;
[0014] The ATP-citrate lyase is derived from 裂殖壶菌属 HX-308 or 嗜热栖热放线菌 嗜热栖热放线菌 or 烟曲霉 or 柄篮状菌 One of them;
[0015] The mitochondrial citrate carrier is derived from 裂殖壶菌属 HX-308 or 白色念珠菌 or 法布里德巴利酵母 One of them;
[0016] The source 裂殖壶菌属 The ATP-citrate lyase of HX-308 is SpACL, and its gene sequence is shown in SEQ ID No. 5.
[0017] The source 嗜热栖热放线菌 The ATP-citrate lyase is CmACL, and its gene sequence is shown in SEQ ID No. 6;
[0018] The source 烟曲霉 The ATP-citrate lyase is AfACL, and its gene sequence is shown in SEQ ID No. 7;
[0019] The source 柄篮状菌 The ATP-citrate lyase is TsACL, and its gene sequence is shown in SEQ ID No. 8;
[0020] The source 酿酒酵母 The mitochondrial citrate carrier is ScYHM, and its gene sequence is shown in SEQ ID No. 9;
[0021] The source 白色念珠菌 The mitochondrial citrate carrier is CaYHM, and its gene sequence is shown in SEQ ID No. 10.
[0022] The source 法布里德巴利酵母 The mitochondrial citrate carrier is DfYHM, and its gene sequence is shown in SEQ ID No. 11.
[0023] The application of the engineered strains of Yersinia lipophila as described above in the production of EPA and oils.
[0024] The method for constructing the engineered *Yarrowia lipophila* strain as described above includes the following steps:
[0025] Construction of S1 recombinant plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE
[0026] Using plasmid pUC-IntC-HUH-TE as a backbone, the SdΔ9EL and RtΔ8DE genes were inserted into the backbone to obtain the recombinant plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE.
[0027] Construction of S2 recombinant plasmid pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE
[0028] Using plasmid pUC-SCP2-HUH-TE as a backbone, the NoΔ5DE and PaΔ17DE genes were inserted into the backbone to obtain the recombinant plasmid pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE.
[0029] Construction of S3 recombinant plasmid pUC-A08-HUH-TE-SpACL
[0030] Using plasmid pUC-A08-HUH-TE as a backbone, the SpACL gene was inserted into the backbone to obtain the recombinant plasmid pUC-A08-HUH-TE-SpACL;
[0031] Construction of S4 recombinant plasmid pUC-A08-HUH-TE-CmACL
[0032] Using plasmid pUC-A08-HUH-TE as a backbone, the CmACL gene was inserted into the backbone to obtain the recombinant plasmid pUC-A08-HUH-TE-CmACL;
[0033] Construction of S5 recombinant plasmid pUC-A08-HUH-TE-AfACL
[0034] Using plasmid pUC-A08-HUH-TE as a backbone, the AfACL gene was inserted into the backbone to obtain the recombinant plasmid pUC-A08-HUH-TE-AfACL;
[0035] Construction of S6 recombinant plasmid pUC-A08-HUH-TE-TsACL
[0036] Using plasmid pUC-A08-HUH-TE as a backbone, the TsACL gene was inserted into the backbone to obtain the recombinant plasmid pUC-A08-HUH-TE-TsACL;
[0037] Construction of S7 recombinant plasmid pUC-A08-HUH-TE-ScYHM
[0038] Using plasmid pUC-A08-HUH-TE as a backbone, the ScYHM gene was inserted into the backbone to obtain the recombinant plasmid pUC-A08-HUH-TE-ScYHM.
[0039] Construction of S8 recombinant plasmid pUC-A08-HUH-TE-CaYHM
[0040] Using plasmid pUC-A08-HUH-TE as a backbone, the CaYHM gene was inserted into the backbone to obtain the recombinant plasmid pUC-A08-HUH-TE-CaYHM.
[0041] Construction of S9 recombinant plasmid pUC-A08-HUH-TE-DfYHM
[0042] Using plasmid pUC-A08-HUH-TE as a backbone, the DfYHM gene was inserted into the backbone to obtain the recombinant plasmid pUC-A08-HUH-TE-DfYHM.
[0043] Construction of S10 recombinant plasmid pUC-A08-HUH-TE-SpACL-ScYHM
[0044] Using plasmid pUC-A08-HUH-TE-SpACL as a backbone, the ScYHM gene was inserted into the backbone to obtain the recombinant plasmid pUC-A08-HUH-TE-SpACL-ScYHM;
[0045] Construction of an engineered S11 lipophilic yeast strain for EPA production
[0046] The plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8EL was transformed into the uracil-auxotrophic *Yersinia lipolytica* strain Po1f (Po1f-ΔURA) to obtain recombinant *Yersinia lipolytica* strain 1, Po1f-B1. Po1f-B1 was inoculated onto YPD-5-FOA solid medium. After single-cell growth, it was streaked again on YPD solid medium for activation, yielding *Yersinia lipolytica* Po1f-B1-ΔURA. The plasmid pUC-SCP2-HUH-TE... -NoΔ5DE-PaΔ17DE was transferred into the recombinant strain Po1f-B1-ΔURA of Yersinia lipolytica to obtain recombinant strain 2 of Yersinia lipolytica, namely Po1f-B2, which is the Yersinia lipolytica engineered strain capable of producing EPA; Po1f-B2 was inoculated into YPD-5-FOA solid medium, and after single cells grew, it was streaked again in YPD solid medium to activate it, thus obtaining Yersinia lipolytica Po1f-B2-ΔURA;
[0047] Construction of S12 engineered Yersinia lipophila strain heterologously expressing ATP-citrate lyase
[0048] Plasmids pUC-A08-HUH-TE-SpACL, pUC-A08-HUH-TE-CmACL, pUC-A08-HUH-TE-AfACL, and pUC-A08-HUH-TE-TsACL were respectively transformed into the recombinant *Yersinia lipolytica* strain Po1f-B2-ΔURA to obtain recombinant *Yersinia lipolytica* strains 3 (Po1f-B3), 4 (Po1f-B4), 5 (Po1f-B5), and 6 (Po1f-B6), which are the heterologous *Yersinia lipolytica* engineered strains Po1f-B3, Po1f-B4, Po1f-B5, and Po1f-B6 expressing ATP-citrate lyase.
[0049] Construction of a lipophilic Yersinia lipase engineered strain expressing the S13 heterologous mitochondrial citrate vector
[0050] Plasmids pUC-A08-HUH-TE-ScYHM, pUC-A08-HUH-TE-CaYHM, and pUC-A08-HUH-TE-DfYHM were respectively transformed into the recombinant *Yersinia lipolytica* strain Po1f-B2-ΔURA to obtain recombinant *Yersinia lipolytica* strain 7 (Po1f-B7), recombinant *Yersinia lipolytica* strain 8 (Po1f-B8), and recombinant *Yersinia lipolytica* strain 9 (Po1f-B9), which are the heterologous *Yersinia lipolytica* engineered strains Po1f-B7, Po1f-B8, and Po1f-B9 expressing ATP-citrate lyase.
[0051] Construction of S14: A Lipid-Solubilizing Yersinia oryzae Engineered Strain Po1f-B10 for Efficient Eicosapentaenoic Acid Production Based on Citric Acid Metabolic Regulation
[0052] The plasmid pUC-A08-HUH-TE-SpACL-ScYHM was transformed into the recombinant Yersinia lipolytica strain Po1f-B2-ΔURA to obtain recombinant Yersinia lipolytica strain 10, namely Po1f-B10, which is the Yersinia lipolytica engineered strain Po1f-B10 based on the efficient production of eicosapentaenoic acid by citric acid metabolism regulation.
[0053] Furthermore, during the strain construction process, the promoters of each extended desaturase gene expression cassette were P. TEF promoter, P EXP promoter, P FBA promoter or P YAT One type of promoter, with T as the terminator. CYC1t Termination, T xpr2t One of the terminators;
[0054] Alternatively, in step S10, the strain transformation method is achieved through lithium acetate transformation.
[0055] The method for producing EPA and oils by fermentation using the engineered strain of *Yarrowia lipolyticis* as described above includes the following steps:
[0056] In the process of fermenting the engineered strain of Yersinia lipophila to produce EPA and lipids, a shaker culture was used, with a fermentation time of 96-120 h, a temperature of 28-30℃, and a shaker speed of 180-220 rpm.
[0057] Further, the steps are as follows:
[0058] Activation of S1 Yersinia lipophila engineered strain
[0059] The engineered strain of *Yersinia lipolytica* was streaked onto YPD solid medium and cultured in an incubator at 30°C for 72 h. Single colonies of *Yersinia lipolytica* were picked and inoculated into YPD liquid medium and cultured in a shaker at 28°C and 280 r / min for 24 h to obtain the fermentation seed liquid.
[0060] Fermentation by S2 lipophilic yeast strain
[0061] The seed culture was inoculated into the fermentation medium at an inoculation rate of 1%, and cultured in a shaker at 30℃ and 220 r / min for 120 h to obtain the fermentation broth.
[0062] Furthermore, the YPD liquid culture medium has the following composition: pH 6.5, containing 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, and water as the solvent, and is sterilized at 115°C for 30 minutes.
[0063] The YPD solid medium is YPD liquid medium with 2% agar added to the base.
[0064] The fermentation medium has a pH of 6.5 and consists of 1.7 g / L of amino acid-free and ammonium sulfate-free YNB, 2.5 g / L of yeast extract, 60 g / L of glucose, and is sterilized at 115°C for 30 minutes using pure water as the solvent.
[0065] Furthermore, the method also includes the following steps:
[0066] S3 fermentation product analysis
[0067] The analysis of fermentation broth products after fermentation mainly includes two parts: one is the determination of cell dry weight, and the other is the determination of lipid content and fatty acid profile.
[0068] The determination of cell dry weight mainly involves taking 30 mL of fermentation broth and placing it in a pre-weighed centrifuge tube. After centrifuging to remove the supernatant, the centrifuge tube is placed in a freeze dryer for freeze drying. After freeze drying, the sample is placed in an oven until constant weight is achieved. The weight of the centrifuge tube is weighed, and the weight of the empty tube is subtracted to obtain the cell dry weight of 30 mL of fermentation broth.
[0069] The oil content and fatty acid profile were determined using gas chromatography: 200 μL of fermentation broth was centrifuged and lyophilized. 500 μL of NaOH-methanol solution was added to the lyophilized sample, and the mixture was shaken for 6 h. Then, 40 μL of concentrated sulfuric acid was added to terminate the reaction. Subsequently, 2 g / L methyl undecanoate solution was added as an internal standard and n-hexane for extraction, with 500 μL of n-hexane and 100 μL of internal standard added. After shaking for 2 h, the upper organic phase was collected for gas chromatography analysis.
[0070] The advantages and positive effects of this invention are as follows:
[0071] This invention uses *Yarrowia lipolyticis* strain Po1f as the chassis strain and overexpresses heterologous Δ9 elongase, Δ8 desaturase, Δ5 desaturase, and Δ17 desaturase genes to obtain strain Po1f-B2, with oil yield and EPA yield reaching 0.75 g / L and 0.20 g / L, respectively. Simultaneously, by overexpressing heterologous ATP-citrate lyase and mitochondrial citrate vector genes, strains Po1f-B3, Po1f-B4, Po1f-B5, Po1f-B6, Po1f-B7, Po1f-B8, and Po1f-B9 were obtained, with oil yields of 1.82 g / L, 1.06 g / L, 0.99 g / L, 0.80 g / L, 1.54 g / L, 0.91 g / L, and 0.85 g / L, respectively, and EPA contents of 0.40 g / L, 0.23 g / L, 0.29 g / L, and 0.22 g / L, respectively. g / L, 0.35 g / L, 0.28 g / L, 0.24 g / L; By regulating citric acid metabolism in *Yersinia lipolytica*, the production of EPA and lipids in engineered strains of *Yersinia lipolytica* was significantly increased; This invention is applicable to the construction of genetically engineered strains with significantly increased EPA and lipid production, providing new insights into reducing citric acid efflux during fermentation of *Yersinia lipolytica*, thereby reducing fermentation costs, while further increasing EPA and lipid production.
[0072] 2. This invention constructs three recombinant plasmids, pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8EL, pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE, and pUC-intF3-HUH-TE-SpG6PDH-SpME2, and transforms them into *Yarrowia lipophila* Po1f, ultimately constructing the Po1f-B10 strain. The lipid and EPA yields reached 2.59 g / L and 0.52 g / L, respectively, significantly improving the lipid and EPA yields of the engineered *Yarrowia lipophila* strain, and the strain exhibits good stability.
[0073] 3. This invention provides a method for constructing and applying an engineered strain of *Yersinia lipolytica* that efficiently produces eicosapentaenoic acid (EPA) based on citric acid metabolic regulation. The strain expresses elongation desaturase genes from multiple sources in the *Yersinia lipolytica* Po1f strain, enabling it to produce EPA. Furthermore, it utilizes genes derived from... 裂殖壶菌属 HX-308 or 嗜热栖热放线菌 嗜热栖热放线菌 or 烟曲霉 or 柄篮状菌 ATP-citrate lyase, and derived from 酿酒酵母 or 白色念珠菌 or 法布里德巴利酵母A mitochondrial citrate carrier was transferred into an engineered strain of *Yersinia lipolytica*, and the ATP-citrate lyase (SpACL) and mitochondrial citrate carrier (ScYHM) were found to have the best regulatory effect on citrate metabolism in *Yersinia lipolytica*. This expands the library of components for regulating citrate metabolism in *Yersinia lipolytica*, laying the foundation for constructing a *Yersinia lipolytica* strain that produces high levels of EPA-rich oils and has excellent performance for industrial applications. This further increases EPA and oil production while reducing fermentation costs.
[0074] 4. This invention will be derived from... 裂殖壶菌属 and 酿酒酵母 The co-expression of the ATP-citrate lyase (SpACL) and mitochondrial citrate carrier (ScYHM) genes in an engineered *Yersinia lipophila* strain significantly increased EPA and lipid yields. Compared with the control strain Po1f-B2, the co-expression of SpACL and ScYHM genes resulted in strain Po1f-B10, with lipid and EPA yields increased by 243.35% and 161.85%, respectively. Furthermore, the strain exhibited good stability and industrial adaptability, making it suitable for industrial fermentation production of functional lipids. Attached Figure Description
[0075] Figure 1 This is a skeleton diagram of the recombinant plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE in Example 1 of the present invention;
[0076] Figure 2 This is a skeleton diagram of the recombinant plasmid pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE in Example 1 of the present invention;
[0077] Figure 3 This is a skeleton diagram of the recombinant plasmid pUC-A08-HUH-TE-SpACL in Example 1 of the present invention;
[0078] Figure 4 This is a skeleton diagram of the recombinant plasmid pUC-A08-HUH-TE-ScYHM in Example 1 of the present invention;
[0079] Figure 5 This is a skeleton diagram of the recombinant plasmid pUC-A08-HUH-TE-SpACL-ScYHM in Example 1 of the present invention;
[0080] Figure 6 This is a colony PCR result diagram in Example 2 of the present invention, verifying whether the left homologous arm of strain Po1f-B10 is connected to the target gene;
[0081] Figure 7This is a colony PCR result diagram in Example 2 of the present invention, verifying whether the right homologous arm of strain Po1f-B10 is connected to the target gene;
[0082] Figure 8 This is a comparison chart of the dry weight and oil yield of the engineered Yersinia lipophila strains Po1f-B2, Po1f-B3, Po1f-B4, Po1f-B5, Po1f-B6, Po1f-B7, Po1f-B8, and Po1f-B9 in this invention.
[0083] Figure 9 This is a comparison chart of the EPA fatty acid content and yield of the engineered strains Po1f-B2, Po1f-B3, Po1f-B4, Po1f-B5, Po1f-B6, Po1f-B7, Po1f-B8, and Po1f-B9 in this invention.
[0084] Figure 10 This is a comparison chart of the dry weight and oil yield of the engineered Yersinia lipophila strains Po1f-B2 and Po1f-B10 in this invention.
[0085] Figure 11 This is a comparative diagram of the fatty acid composition of the engineered Yersinia lipophila strains Po1f-B2 and Po1f-B10 in this invention. Detailed Implementation
[0086] The present invention will be further described below with reference to the embodiments. The following embodiments are descriptive and not limiting, and should not be used to limit the scope of protection of the present invention.
[0087] The various experimental operations involved in the specific embodiments are all conventional techniques in the field. For parts not specifically annotated in this document, those skilled in the art can refer to various commonly used reference books, scientific and technological documents or related instructions and manuals prior to the filing date of this invention to carry out the operations.
[0088] A *Yersinia lipolytica* strain for efficient production of eicosapentaenoic acid (EPA) based on citric acid metabolism regulation is described. The chassis strain of the engineered strain is *Yersinia lipolytica* Po1f, and this strain overexpresses partially elongating desaturases in the fatty acid synthesis pathway, including genes for Δ9 elongase, Δ8 desaturase, Δ5 desaturase, and Δ17 desaturase. In addition, heterologous ATP-citrate lyase (ACL) and mitochondrial citrate vector (YHM) are also overexpressed.
[0089] Preferably, the Δ9 elongase is derived from 双游水霉 (SdΔ9EL), whose gene sequence is shown in SEQ ID No. 1;
[0090] The Δ8 desaturase comes from 粘红酵母NP11 (RtΔ8DE), whose gene sequence is shown in SEQ ID No. 2;
[0091] The Δ5 desaturase comes from 海洋微拟球藻 (NoΔ5DE), whose gene sequence is shown in SEQ ID No. 3;
[0092] The Δ17 desaturase is derived from Parietichytrium属 (PaΔ17DE), whose gene sequence is shown in SEQ ID No. 4;
[0093] The ATP-citrate lyase is derived from 裂殖壶菌属 HX-308 or 嗜热栖热放线菌 嗜热栖热放线菌 or 烟曲霉 or 柄篮状菌 One of them;
[0094] The mitochondrial citrate carrier is derived from 裂殖壶菌属 HX-308 or 白色念珠菌 or 法布里德巴利酵母 One of them;
[0095] The source 裂殖壶菌属 The ATP-citrate lyase of HX-308 is SpACL, and its gene sequence is shown in SEQ ID No. 5.
[0096] The source 嗜热栖热放线菌 The ATP-citrate lyase is CmACL, and its gene sequence is shown in SEQ ID No. 6;
[0097] The source 烟曲霉 The ATP-citrate lyase is AfACL, and its gene sequence is shown in SEQ ID No. 7;
[0098] The source 柄篮状菌 The ATP-citrate lyase is TsACL, and its gene sequence is shown in SEQ ID No. 8;
[0099] The source 酿酒酵母 The mitochondrial citrate carrier is ScYHM, and its gene sequence is shown in SEQ ID No. 9;
[0100] The source 白色念珠菌 The mitochondrial citrate carrier is CaYHM, and its gene sequence is shown in SEQ ID No. 10.
[0101] The source 法布里德巴利酵母 The mitochondrial citrate carrier is DfYHM, and its gene sequence is shown in SEQ ID No. 11.
[0102] The application of the engineered strains of Yersinia lipophila as described above in the production of EPA and oils.
[0103] The method for constructing the engineered *Yarrowia lipophila* strain as described above includes the following steps:
[0104] Construction of S1 recombinant plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE
[0105] Using plasmid pUC-IntC-HUH-TE as a backbone, the SdΔ9EL and RtΔ8DE genes were inserted into the backbone to obtain the recombinant plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE.
[0106] Construction of S2 recombinant plasmid pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE
[0107] Using plasmid pUC-SCP2-HUH-TE as a backbone, the NoΔ5DE and PaΔ17DE genes were inserted into the backbone to obtain the recombinant plasmid pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE.
[0108] Construction of S3 recombinant plasmid pUC-A08-HUH-TE-SpACL
[0109] Using plasmid pUC-A08-HUH-TE as a backbone, the SpACL gene was inserted into the backbone to obtain the recombinant plasmid pUC-A08-HUH-TE-SpACL;
[0110] Construction of S4 recombinant plasmid pUC-A08-HUH-TE-CmACL
[0111] Using plasmid pUC-A08-HUH-TE as a backbone, the CmACL gene was inserted into the backbone to obtain the recombinant plasmid pUC-A08-HUH-TE-CmACL;
[0112] Construction of S5 recombinant plasmid pUC-A08-HUH-TE-AfACL
[0113] Using plasmid pUC-A08-HUH-TE as a backbone, the AfACL gene was inserted into the backbone to obtain the recombinant plasmid pUC-A08-HUH-TE-AfACL;
[0114] Construction of S6 recombinant plasmid pUC-A08-HUH-TE-TsACL
[0115] Using plasmid pUC-A08-HUH-TE as a backbone, the TsACL gene was inserted into the backbone to obtain the recombinant plasmid pUC-A08-HUH-TE-TsACL;
[0116] Construction of S7 recombinant plasmid pUC-A08-HUH-TE-ScYHM
[0117] Using plasmid pUC-A08-HUH-TE as a backbone, the ScYHM gene was inserted into the backbone to obtain the recombinant plasmid pUC-A08-HUH-TE-ScYHM.
[0118] Construction of S8 recombinant plasmid pUC-A08-HUH-TE-CaYHM
[0119] Using plasmid pUC-A08-HUH-TE as a backbone, the CaYHM gene was inserted into the backbone to obtain the recombinant plasmid pUC-A08-HUH-TE-CaYHM.
[0120] Construction of S9 recombinant plasmid pUC-A08-HUH-TE-DfYHM
[0121] Using plasmid pUC-A08-HUH-TE as a backbone, the DfYHM gene was inserted into the backbone to obtain the recombinant plasmid pUC-A08-HUH-TE-DfYHM.
[0122] Construction of S10 recombinant plasmid pUC-A08-HUH-TE-SpACL-ScYHM
[0123] Using plasmid pUC-A08-HUH-TE-SpACL as a backbone, the ScYHM gene was inserted into the backbone to obtain the recombinant plasmid pUC-A08-HUH-TE-SpACL-ScYHM;
[0124] Construction of an engineered S11 lipophilic yeast strain for EPA production
[0125] The plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8EL was transformed into the uracil-auxotrophic *Yersinia lipolytica* strain Po1f (Po1f-ΔURA) to obtain recombinant *Yersinia lipolytica* strain 1, Po1f-B1. Po1f-B1 was inoculated onto YPD-5-FOA solid medium. After single-cell growth, it was streaked again on YPD solid medium for activation, yielding *Yersinia lipolytica* Po1f-B1-ΔURA. The plasmid pUC-SCP2-HUH-TE... -NoΔ5DE-PaΔ17DE was transferred into the recombinant strain Po1f-B1-ΔURA of Yersinia lipolytica to obtain recombinant strain 2 of Yersinia lipolytica, namely Po1f-B2, which is the Yersinia lipolytica engineered strain capable of producing EPA; Po1f-B2 was inoculated into YPD-5-FOA solid medium, and after single cells grew, it was streaked again in YPD solid medium to activate it, thus obtaining Yersinia lipolytica Po1f-B2-ΔURA;
[0126] Construction of S12 engineered Yersinia lipophila strain heterologously expressing ATP-citrate lyase
[0127] Plasmids pUC-A08-HUH-TE-SpACL, pUC-A08-HUH-TE-CmACL, pUC-A08-HUH-TE-AfACL, and pUC-A08-HUH-TE-TsACL were respectively transformed into the recombinant *Yersinia lipolytica* strain Po1f-B2-ΔURA to obtain recombinant *Yersinia lipolytica* strains 3 (Po1f-B3), 4 (Po1f-B4), 5 (Po1f-B5), and 6 (Po1f-B6), which are the heterologous *Yersinia lipolytica* engineered strains Po1f-B3, Po1f-B4, Po1f-B5, and Po1f-B6 expressing ATP-citrate lyase.
[0128] Construction of a lipophilic Yersinia lipase engineered strain expressing the S13 heterologous mitochondrial citrate vector
[0129] Plasmids pUC-A08-HUH-TE-ScYHM, pUC-A08-HUH-TE-CaYHM, and pUC-A08-HUH-TE-DfYHM were respectively transformed into the recombinant *Yersinia lipolytica* strain Po1f-B2-ΔURA to obtain recombinant *Yersinia lipolytica* strain 7 (Po1f-B7), recombinant *Yersinia lipolytica* strain 8 (Po1f-B8), and recombinant *Yersinia lipolytica* strain 9 (Po1f-B9), which are the heterologous *Yersinia lipolytica* engineered strains Po1f-B7, Po1f-B8, and Po1f-B9 expressing ATP-citrate lyase.
[0130] Construction of S14: A Lipid-Solubilizing Yersinia oryzae Engineered Strain Po1f-B10 for Efficient Eicosapentaenoic Acid Production Based on Citric Acid Metabolic Regulation
[0131] The plasmid pUC-A08-HUH-TE-SpACL-ScYHM was transformed into the recombinant Yersinia lipolytica strain Po1f-B2-ΔURA to obtain recombinant Yersinia lipolytica strain 10, namely Po1f-B10, which is the Yersinia lipolytica engineered strain Po1f-B10 based on the efficient production of eicosapentaenoic acid by citric acid metabolism regulation.
[0132] Preferably, during strain construction, the promoter of each extended desaturase gene expression cassette is P. TEF promoter, P EXP promoter, P FBA promoter or P YAT One type of promoter, with T as the terminator. CYC1t Termination, T xpr2t One of the terminators;
[0133] Alternatively, in step S10, the strain transformation method is achieved through lithium acetate transformation.
[0134] The method for producing EPA and oils by fermentation using the engineered strain of *Yarrowia lipolyticis* as described above includes the following steps:
[0135] In the process of fermenting the engineered strain of Yersinia lipophila to produce EPA and lipids, a shaker culture was used, with a fermentation time of 96-120 h, a temperature of 28-30℃, and a shaker speed of 180-220 rpm.
[0136] Preferably, the steps are as follows:
[0137] Activation of S1 Yersinia lipophila engineered strain
[0138] The engineered strain of *Yersinia lipolytica* was streaked onto YPD solid medium and cultured in an incubator at 30°C for 72 h. Single colonies of *Yersinia lipolytica* were picked and inoculated into YPD liquid medium and cultured in a shaker at 28°C and 280 r / min for 24 h to obtain the fermentation seed liquid.
[0139] Fermentation by S2 lipophilic yeast strain
[0140] The seed culture was inoculated into the fermentation medium at an inoculation rate of 1%, and cultured in a shaker at 30℃ and 220 r / min for 120 h to obtain the fermentation broth.
[0141] Preferably, the YPD liquid culture medium has the following composition: pH 6.5, containing 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, and water as the solvent, and is sterilized at 115°C for 30 minutes.
[0142] The YPD solid medium is YPD liquid medium with 2% agar added to the base.
[0143] The fermentation medium has a pH of 6.5 and consists of 1.7 g / L of amino acid-free and ammonium sulfate-free YNB, 2.5 g / L of yeast extract, 60 g / L of glucose, and is sterilized at 115°C for 30 minutes using pure water as the solvent.
[0144] Preferably, the method further includes the following steps:
[0145] S3 fermentation product analysis
[0146] The analysis of fermentation broth products after fermentation mainly includes two parts: one is the determination of cell dry weight, and the other is the determination of lipid content and fatty acid profile.
[0147] The determination of cell dry weight mainly involves taking 30 mL of fermentation broth and placing it in a pre-weighed centrifuge tube. After centrifuging to remove the supernatant, the centrifuge tube is placed in a freeze dryer for freeze drying. After freeze drying, the sample is placed in an oven until constant weight is achieved. The weight of the centrifuge tube is weighed, and the weight of the empty tube is subtracted to obtain the cell dry weight of 30 mL of fermentation broth.
[0148] The oil content and fatty acid profile were determined using gas chromatography: 200 μL of fermentation broth was centrifuged and lyophilized. 500 μL of NaOH-methanol solution was added to the lyophilized sample, and the mixture was shaken for 6 h. Then, 40 μL of concentrated sulfuric acid was added to terminate the reaction. Subsequently, 2 g / L methyl undecanoate solution was added as an internal standard and n-hexane for extraction, with 500 μL of n-hexane and 100 μL of internal standard added. After shaking for 2 h, the upper organic phase was collected for gas chromatography analysis.
[0149] Specifically, the relevant preparation and testing methods are as follows:
[0150] The lithium acetate conversion method of Yeast lipolyticis was prepared according to the method described in the paper "High-efficiency yeast transformation using the LiAc / SScarrier DNA / PEG method" published in Nature Protocols, Vol. 2, 2007, pp. 31-34.
[0151] The cell dry weight determination mainly involves taking 30 mL of fermentation broth and placing it in a pre-weighed centrifuge tube. After centrifuging to remove the supernatant, the centrifuge tube is placed in a freeze dryer for freeze drying. After freeze drying, the sample is placed in an oven until constant weight is achieved. The weight of the centrifuge tube is then measured, and the weight of the empty tube is subtracted to obtain the cell dry weight of 30 mL of fermentation broth.
[0152] Oil content and fatty acid profile were determined by gas chromatography. 200 μL of fermentation broth was centrifuged and lyophilized. 500 μL of NaOH-methanol solution (1M) was added to the lyophilized sample, and the mixture was shaken for 6 h. The reaction was then terminated by adding 40 μL of concentrated sulfuric acid. Methyl undecanoate solution (2 g / L) was added as an internal standard, and hexane was used for extraction. 500 μL of hexane and 100 μL of internal standard were added. After shaking for 2 h, the upper organic phase was collected for gas chromatography analysis.
[0153] The chromatographic column used in the experiment was DB-23 (60.0m × 0.25mm × 0.25μm); the detection conditions were: injection port temperature 250℃, injection volume 1.0μL, split ratio 69.8:1; the chromatographic conditions were: initial temperature 100℃, increased to 196℃ at 25℃ / min, then increased to 220℃ at 2℃ / min and held for 21 min.
[0154] After the gas chromatography analysis was completed, different fatty acids were identified by comparison with relevant external standards (Sigma, USA). In this gas chromatography analysis, non-endogenous fatty acids (C11:0) were used as internal standards, and the content of individual fatty acids was estimated from the peak area on the chromatogram.
[0155] YPD liquid medium: pH 6.5, composition includes 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, solvent is water, sterilized at 115℃ for 30 minutes, YPD plate medium is supplemented with 2% agar by mass.
[0156] Fermentation medium: pH 6.5, consisting of 1.7 g / L amino acid-free and ammonium sulfate-free YNB, 2.5 g / L yeast extract, 60 g / L glucose, and pure water as solvent, sterilized at 115℃ for 30 minutes.
[0157] The YNB solid culture medium formula is: YNB (amino acid-free and ammonium sulfate-free) 1.7 g / L, ammonium sulfate 5 g / L, glucose 20 g / L, and agar 30 g / L.
[0158] Example 1 Construction of recombinant plasmid
[0159] The plasmid extraction and gel recovery kits used in this embodiment were from Nanjing Qingke, the restriction enzymes were from Nanjing Bio-Shenggong, the PCR high-fidelity enzymes were from Dalian Baosheng Biotechnology, and the ligases were from Nanjing Novizan. All related experimental operations were performed in accordance with the instruction manual.
[0160] Construction of S1 recombinant plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE
[0161] Primers were designed as follows: 9EL-F / 9EL-R (SEQ ID NO.12 / SEQ ID NO.13) and 8DE-F / 8DE-R (SEQ ID NO.14 / SEQ ID NO.15). Using the synthesized SdΔ9EL and RtΔ8DE genes as templates, PrimerStar high-fidelity polymerase was used to obtain the desired Δ9 elongase and Δ8 desaturase gene fragments by PCR. Product purification was performed using a gel extraction kit, following the manufacturer's instructions.
[0162] First, the pUC-IntC-HUH-TE plasmid was digested with BamHI restriction enzyme (disclosed in patent publication number CN119432633 A). The digested plasmid backbone was verified and recovered by agarose gel electrophoresis. The backbone and SdΔ9EL fragment were cloned in one step using the ClonExpress MultiS One Step Cloning Kit, following the product instructions, to construct the plasmid pUC-IntC-HUH-TE-SdΔ9EL. Second, the pUC-IntC-HUH-TE-SdΔ9EL plasmid was digested with PacI restriction enzyme. The digested plasmid backbone was verified and recovered by agarose gel electrophoresis. The backbone and RtΔ8DE fragment were cloned in one step using the ClonExpress MultiS One Step Cloning Kit, following the product instructions, to construct the plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE. Figure 1 ).
[0163] Construction of S2 recombinant plasmid pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE
[0164] Primers were designed as 5DE-F / 5DE-R (SEQ ID NO.16 / SEQ ID NO.17) and 17DE-F / 17DE-R (SEQ ID NO.18 / SEQ ID NO.19), respectively. Using the NoΔ5DE and PaΔ17DE genes synthesized by the company as templates, the required Δ5 desaturase and Δ17 desaturase gene fragments were obtained by PCR.
[0165] First, the pUC-SCP2-HUH-TE plasmid (disclosed in patent publication CN 119432633A) was cloned in one step using the ClonExpress MultiS One Step Cloning Kit with BamHI restriction enzyme to construct the plasmid pUC-SCP2-HUH-TE-NoΔ5DE. Second, the pUC-SCP2-HUH-TE-NoΔ5DE plasmid was digested with PacI restriction enzyme, and the digested plasmid backbone was verified and recovered by agarose gel electrophoresis. The backbone and PaΔ17DE fragment were then cloned in one step using the ClonExpress MultiS One Step Cloning Kit to construct the plasmid pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE. Figure 2 ).
[0166] Construction of a recombinant plasmid expressing heterologous ATP-citrate lyase S3
[0167] Primers were designed as follows: SpACL-F / SpACL-R (SEQ ID NO.20 / SEQ ID NO.21), CmACL-F / CmACL-R (SEQ ID NO.22 / SEQ ID NO.23), AfACL-F / AfACL-R (SEQ ID NO.24 / SEQ ID NO.25), and TsACL-F / TsACL-R (SEQ ID NO.26 / SEQ ID NO.27). Using the synthesized SpACL, CmACL, AfACL, and TsACL genes from the company as templates, the desired heterologous ATP-citrate lyase gene fragments were amplified by PCR.
[0168] The pUC-A08-HUH-TE plasmid (constructed in the laboratory, differing from the pUC-SCP2-HUH-TE plasmid in that its integration site is A08; the sequences of A08-UP and A08-DW in this plasmid are SEQ ID NO.28 / SEQ ID NO.29, respectively) was cloned using the BamHI restriction enzyme. The backbone and the SpACL, CmACL, AfACL, and TsACL gene fragments were then cloned in one step using the ClonExpress MultiS One Step Cloning Kit, constructing the plasmids pUC-A08-HUH-TE-SpACL, pUC-A08-HUH-TE-CmACL, pUC-A08-HUH-TE-AfACL, and pUC-A08-HUH-TE-TsACL, respectively. Figure 3(Taking pUC-A08-HUH-TE-SpACL as an example).
[0169] Construction of recombinant plasmids expressing heterologous citrate mitochondrial vectors in S4
[0170] Primers were designed as follows: ScYHM-F / ScYHM-R (SEQ ID No. 30 / SEQ ID No. 31), CaYHM-F / CaYHM-R (SEQ ID No. 32 / SEQ ID No. 33), and DfYHM-F / DfYHM-R (SEQ ID No. 34 / SEQ ID No. 35). Using the ScYHM, CaYHM, and DfYHM genes synthesized by the company as templates, the desired heterologous citrate mitochondrial vector gene fragments were amplified by PCR.
[0171] The pUC-A08-HUH-TE plasmid was digested with BamHI restriction enzyme. The backbone and the ScYHM, CaYHM, and DfYHM gene fragments were then cloned in one step using the ClonExpress MultiS One Step Cloning Kit to construct the plasmids pUC-A08-HUH-TE-ScYHM, pUC-A08-HUH-TE-CaYHM, and pUC-A08-HUH-TE-DfYHM, respectively. Figure 4 (Taking pUC-A08-HUH-TE-ScYHM as an example).
[0172] Construction of S5 recombinant plasmid expressing heterologous ATP-citrate lyase and citrate mitochondrial vector
[0173] The pUC-A08-HUH-TE-SpACL plasmid was digested with PacI restriction enzyme, and the digested plasmid backbone was verified and recovered by agarose gel electrophoresis. Primers such as ScYHM-F-2 / ScYHM-R-2 (SEQ ID No. 36 / SEQ ID No. 37) were designed and used as templates of the synthesized ScYHM gene to amplify the desired citrate mitochondrial vector gene fragment by PCR.
[0174] The backbone and ScYHM fragment were cloned in one step using the ClonExpress MultiS One Step Cloning Kit to construct plasmid pUC-A08-HUH-TE-SpACL-ScYHM. Figure 5 ).
[0175] The relevant gene sequences mentioned in Example 1 are as follows:
[0176] SEQ ID No. 1 SdΔ9EL gene fragment:
[0177]
[0178] SEQ ID No. 2 RtΔ8DE gene fragment:
[0179]
[0180] SEQ ID No. 3 NoΔ5DE gene sequence:
[0181]
[0182] SEQ ID No. 4 PaΔ17DE gene sequence:
[0183]
[0184] SEQ ID No. 5 SpACL gene sequence:
[0185]
[0186] SEQ ID No. 6 CmACL gene sequence:
[0187]
[0188] SEQ ID No. 7 AfACL gene sequence:
[0189]
[0190] SEQ ID No. 8 TsACL gene sequence:
[0191]
[0192] SEQ ID No.9 ScYHM gene sequence:
[0193] ATGTCCAGTAAAGCTACCAAAAGTGACGTAGATCCATTGCACTCGTTTCTGGCAGGGTCCCTAGCCGGTGCTGCTGAAGCATGTATAACATATCCTTTTGAGTTTGCCAAAACAAGGCTGCAGCTGATTGATAAGGCCTCCAAGGCATCAAGAAATCCTCTGGTATTGATATATAAAACTGCAAAAACTCAGGGCATTGGTTCCATTTATGTCGGATGTCCCGCATTTATTATTGGAAACACCGCTAAGGCGGGTATTAGATTTCTTGGCTTTGATACCATTAAAGACATGCTAAGAGATAGTGAAACTGGAGAACTAAGTGGTACAAGAGGGGTGATAGCTGGGTTAGGTGCGGGACTATTAGAAAGTGTTGCCGCAGTGACTCCTTTTGAAGCAATCAAAACTGCTTTGATCGATGATAAACAATCTGCTACACCAAAATACCATAATAATGGGCGCGGTGTAGTACGAAACTATTCATCATTAGTCCGTGATAAAGGATTTTCTGGTCTTTATCGTGGTGTTTTGCCAGTTTCCATGAGACAGGCCGCAAACCAAGCCGTTAGATTGGGTTGTTACAATAAGATTAAGACCTTGATCCAAGATTATACGGATTCGCCAAAAGACAAACCTTTATCATCCGGGTTAACCTTCTTAGTGGGTGCATTTAGTGGTATTGTGACGGTCTATTCCACCATGCCCCTTGATACTGTGAAAACAAGAATGCAAAGTTTGGATTCCACCAAATACTCCTCTACAATGAATTGTTTTGCAACCATTTTCAAAGAAGAAGGGTTAAAGACGTTTTGGAAAGGTGCTACGCCTAGACTTGGGAGATTGGTCTTGAGTGGTGGTATTGTTTTCACTATCTATGAAAAGGTCTTAGTTATGCTAGCCTGA
[0194] SEQ ID No.10 CaYHM gene sequence:
[0195] ATGTCTAAACAAATTGAAAAGAAACCAATCAGCTTTGCTAATATTGCTCTTGGGGCAGGTTTAAACCTTGCTGAAGTGACTACTTTGGGTCAACCATTAGAGGTCATTAAAACCACCATGGCTGCCAATCGTTCTTTGACCATGCCACAAGCTGCTAAATTTGTTTGGTCTCGTGGCGGGATTTTAGGATTCTATCAAGGTTTGATCCCATGGGCTTGGATTGAAGCCAGTACTAAAGGTGCTGTGTTATTGTTTGTTTCTGCTGAAGCCGAATACCAATTCAAGAAATTGGGTATGAACAACTTTGTCAGTGGAATGGGTGGTGGTATCACTGGTGGGTTAGCACAAGCTTATTTGACTATGGGATTCTGTACATGTATGAAAACTGTGGAAATCACTCGTTCCAAACAAGCCAATACTCCAGGTGTACCACAACAAACTTCATTCCAAGTATTCAAAGAAATTTACCGTAAAGAAGGGATTAGAGGTATAAATAAAGGTGTCAATGCTGTTGCCATTAGACAAATGACCAATTGGGGTTCAAGATTCGGGTTCAGTAGATTGGCTGAAGAATCAATCAGAAGTTTGACCGGGAAATCAGAATCACAAAAGTTGCTGGCCTGGGAAAAGATTGCCAGTAGTGTTATTGGTGGTGGGTTGAGTGCTTGGAACCAGCCAATTGAAGTTATTAGAGTTGAAATGCAAAGTAAAACAAATGATCCGAACCGTCCAAAGAACTTGAGTGTTGCTGGGGCTTTCAAATACATTTACCAACAAAATGGTATCAAGGGTTTATATAGAGGTGTCACTCCAAGAATTGGGTTAGGTGTTTGGCAAACAGTGTTTATGGTTGCCTTTGGTGATATCTTTAAAAGAATGTTGAATACCGATGGTACTGGTCATTAA
[0196] SEQ ID No.11 DfYHM gene sequence:
[0197] ATGACTGACACTAAAAATGCAAATCAAGATGGAAGTCCTCAGATCGAAAAGAAGCCTGTGAGCTGGTCCAACATAGGGGTTGGCGCTGTTTTAAACCTGTCTGAAGTGACTACTTTGGGACAACCGTTCGAGGTTATGAAGACCACCATGGCTGCAAATCGTGACTTATCTCTTATCGGCTCTATCAAGCACATATTTTCTAGAGGAGGATTTAAAGGCTTTTACCAGGGATTGATTCCATGGGGCTGGATAGAGGCTGCAACTAAGGGCTCAGTTCTTCTTCCAGTCTCTACAGAAGCTGAATATAGACTTAAACTTTTGGGTTGTGATCCATTTCTTGCTGGTATAGGTGGAGGTATGACAGGAGGTGTTGCACAGGCATACCTTACTATGGGTTTCTGCACGTGCATGAAGACGGCAGAAATTACAAGAAAGAAGGACGTTGGCCCAGAAGGAAAGGCGCCAAAGACTACTTGGGAGGTGTTCAAAGGTATTTACAAGAAAGATGGTATTAGAGGTATTAATCGTGGTGTCAACGCAGTTGCATTGAGACAATGTACTAACTGGGGTACAAGATTTGGTGTTTCTCGCTTGGCCGAAGAAGCAATTAGGAAATTCAGAAACAAGAGTGACGGTCAGAGACTATCACCTTATGAGAAAATCTTGGCCTCAGTTATCGGTGGCGCTATATCGGCCTGGAATCAGCCAATCGAGGTGGTTCGAGTCGAGATGCAGTCACGTACTCCGGATCCAAACAGACCAAAAAATCTTTCTGTCTGGCAAACAATGAAGTACGTTTACAAAACCAATGGAATTAGGGGTCTTTATAGGGGTGCAACCCCTAGAATCTGCTTGGGAATCTGGCAGACCGTTTTCATGGTCTGCTTCGGTGATTACGCAAAAGAGTACCTTGCTGACAGAAACCAAAAGAATGTGATTTAA
[0198] SEQ ID NO.12:
[0199] CACAGGGAACCCGAAACTAAGCCACCATGACCTCTCACGCCAAGGG
[0200] SEQ ID NO.13:
[0201] GCGTGACATAACTAATTACATGATCATGCTGCTTTCGCCTTGG
[0202] SEQ ID NO.14:
[0203] CCCCAAGTCGCTCGTTCAACAATGGCCGATGCCACCCCTGC
[0204] SEQ ID NO.15:
[0205] CACAAGTTCCGTAGTTGGATCTCAATGTTGGAGCTCGCCCTTG
[0206] SEQ ID No.16:
[0207] GTATAAGAATCATTCAAAATGGCCATTGACAAGGCTGC
[0208] SEQ ID No.17:
[0209] CGTGACATAACTAATTACATGATCAATGGAGCTTCTTCTCTC
[0210] SEQ ID No.18:
[0211] CACAAGACATATCTACAGCAATGGCTGTAGAGGCCAATTTG
[0212] SEQ ID No.19:
[0213] CAACACAAGTTCCGTAGTTGGATCTCATTTAGCCCGAGCAGGAG
[0214] SEQ ID No.20:
[0215] CCTTCTGAGTATAAGAATCATTCAAAATGGCCAACTTTAACGTGAACG
[0216] SEQ ID No.21:
[0217] GTGACATAACTAATTACATGATTACAGCTTGGACTGCTTGAAC
[0218] SEQ ID No.22:
[0219] CTGAGTATAAGAATCATTCAAAATGGAGGGTGAGAGGAAGTAC
[0220] SEQ ID No.23:
[0221] GTGACATAACTAATTACATGATCAGCCATGGGTATTAACAGC
[0222] SEQ ID No.24:
[0223] GAGTATAAGAATCATTCAAAATGGTCCAGCCTTCGCCC
[0224] SEQ ID No.25:
[0225] GCGTGACATAACTAATTACATGATTAAATGTTAACCTCAACACGACCC
[0226] SEQ ID No.26:
[0227] CTGAGTATAAGAATCATTCAAAATGCCTTCTCTTGCTCCCTC
[0228] SEQ ID No.27:
[0229] GTAAGCGTGACATAACTAATTACATGATTATAGGCTGACCTCGACAC
[0230] SEQ ID No.28:
[0231]
[0232] SEQ ID No.29:
[0233]
[0234] SEQ ID No. 30:
[0235] CTGAGTATAAGAATCATTCAAAATGTCCAGTAAAGCTACCAAAAGTG
[0236] SEQ ID No. 31:
[0237] GCGTGACATAACTAATTACATGATCAGGCTAGCATAACTAAGACCTTTTC
[0238] SEQ ID No. 32:
[0239] GAGTATAAGAATCATTCAAAATGTCTAAACAAATTGAAAAGAAACCAATC
[0240] SEQ ID No. 33:
[0241] GTGACATAACTAATTACATGATTAATGACCAGTACCATCGGTATTC
[0242] SEQ ID No. 34:
[0243] CTGAGTATAAGAATCATTCAAAATGACTGACACTAAAAATGCAAATCAAG
[0244] SEQ ID No. 35:
[0245] GCGTGACATAACTAATTACATGATTAAATCACATCTTTTGGTTTCTGTC
[0246] SEQ ID No. 36:
[0247] CACACAAGACATATCTACAGCAATGTCCAGTAAAGCTACCAAAAGTG
[0248] SEQ ID No. 37:
[0249] CAACACAAGTTCCGTAGTTGGATCTCAGGCTAGCATAACTAAGACCTTTTC
[0250] Example 2 Construction of recombinant strains
[0251] Construction of the S1 engineered Yersinia lipophila strain (Po1f-ΔURA)
[0252] The uracil auxotrophic yeast *Yersinia lipolytica* Polf (Po1f-ΔURA) was constructed by knocking out the uracil-encoding gene in *Yersinia lipolytica* Po1f using CRISPR / Cas9 technology. For specific construction methods, please refer to the paper titled "Harnessing" published in the *Journal of Agricultural and Food Chemistry*, Vol. 69, No. 46, 2021, pp. 13831-13837. 解脂耶氏酵母 It was prepared by the method described in "Peroxisomes as a Subcellular Factory for α-Humulene Overproduction".
[0253] Construction of the engineered Yersinia lipophila strain (Po1f-B2) for EPA production (S2)
[0254] The pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE plasmid was transformed into the *Yarrowia lipolytica* strain Po1f-ΔURA using the lithium acetate transformation method. After transformants grew on YNB plates, colony PCR and Sanger sequencing were performed to verify correct gene integration. The selected positive strains were the engineered strain Po1f-B1. Po1f-B1 was streaked onto YPD plates containing 5-FOA (1 g / L) to obtain the *Yarrowia lipolytica* strain Po1f-B1-ΔURA, which had the selection marker removed.
[0255] The pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE plasmid was transformed into the *Yersinia lipolytica* strain Po1f-B1-ΔURA using the lithium acetate transformation method. After transformants grew on YNB plates, colony PCR and Sanger sequencing were performed to verify correct gene integration. The selected positive strains were the engineered strain Po1f-B2. Po1f-B2 was streaked onto YPD plates containing 5-FOA (1 g / L) to obtain the *Yersinia lipolytica* strain Po1f-B2-ΔURA, which had the selection marker removed.
[0256] Construction of an engineered *Yersinia lipophila* strain expressing heterologous ATP-citrate lyase S3
[0257] Using lithium acetate transformation, the plasmids pUC-A08-HUH-TE-SpACL, pUC-A08-HUH-TE-CmACL, pUC-A08-HUH-TE-AfACL, and pUC-A08-HUH-TE-TsACL were transformed into *Yersinia lipolytica* Po1f-B2-ΔURA to obtain engineered *Yersinia lipolytica* strains Po1f-B3, Po1f-B4, Po1f-B5, and Po1f-B6.
[0258] Construction of S4 engineered Yersinia lipophilica strain expressing heterologous citrate mitochondrial vector
[0259] Using lithium acetate transformation, the plasmids pUC-A08-HUH-TE-ScYHM, pUC-A08-HUH-TE-CaYHM, and pUC-A08-HUH-TE-DfYHM were transformed into *Yersinia lipolytica* Po1f-B2-ΔURA, respectively, to obtain *Yersinia lipolytica* engineered strains Po1f-B7, Po1f-B8, and Po1f-B9.
[0260] Construction of a *Yersinia lipophila* strain S5 co-expressing heterologous ATP-citrate lyase and citrate mitochondrial vector
[0261] The pUC-A08-HUH-TE-SpACL-ScYHM plasmid was transformed into *Yersinia lipolytica* Po1f-B2-ΔURA using lithium acetate transformation to obtain the engineered strain Po1f-B10. Colony PCR primer sequences were designed as TEST-LF / TEST-LR (SEQ ID No. 38 / SEQ ID No. 39) and TEST-RF / TEST-RR (SEQ ID No. 40 / SEQ ID No. 41) to verify successful ligation of the target gene with the left and right homologous arms. The enzyme used for colony PCR was Novizan 2xRapid TaqMaster Mix, and the system and temperature were performed according to the manufacturer's instructions. After PCR amplification, the PCR products were verified by agarose gel chromatography. The band sizes were 3809 bp and 2538 bp, respectively. Figure 6 , Figure 7 As shown in the figure, the results were in line with the experimental expectations. The PCR was sent to the company for sequencing to verify the correctness of the sequence, which ultimately proved that the target gene was successfully integrated into the A08 site.
[0262] SEQ ID No. 38:
[0263] CGAGCATCTGAAGCTGCTGG
[0264] SEQ ID No. 39:
[0265] CCAAGCACACTCATAGTTGG
[0266] SEQ ID No. 40:
[0267] GGTGGTCTTTTATACCCTTGGC
[0268] SEQ ID No. 41:
[0269] CATAGTGCAGTGGACCCATTCG
[0270] Example 3: Fermentation production of EPA and lipids using engineered Yersinia lipophila strains Po1f-B2, Po1f-B3, Po1f-B4, Po1f-B5, Po1f-B6, Po1f-B7, Po1f-B8, and Po1f-B9.
[0271] S1 picked single colonies of the engineered strains of Yersinia lipolytica, Po1f-B2, Po1f-B3, Po1f-B4, Po1f-B5, Po1f-B6, Po1f-B7, Po1f-B8, and Po1f-B9, and cultured them in YPD liquid medium at 28°C and 280 r / min for 24 h to obtain the seed culture of the engineered strains of Yersinia lipolytica.
[0272] S2 Take 500 μL of seed culture and inoculate it into 50 mL of fermentation medium. Place the fermentation medium in a 250 mL shake flask and incubate it in a shaker at 30℃ and 220 r / min for 120 h to obtain the fermentation broth.
[0273] After S3 fermentation, cell dry weight, oil yield, and fatty acid profile were determined according to the above detection methods. The results are as follows: Figure 8 and Figure 9As shown, compared with Po1f-B2, the expression of exogenous ATP-citrate lyase gene and mitochondrial citrate vector gene did not significantly affect the growth of the strains, and the lipid content of strains Po1f-B3, Po1f-B4, Po1f-B5, Po1f-B6, Po1f-B7, Po1f-B8, and Po1f-B9 increased by 141.55%, 40.43%, 30.53%, 58.70%, 104.58%, 21.04%, and 13.09%, respectively. Notably, while the proportion of EPA in the fatty acid profile decreased with increasing oil content, the final yield still showed an upward trend. The EPA yields of strains Po1f-B3, Po1f-B4, Po1f-B5, Po1f-B6, Po1f-B7, Po1f-B8, and Po1f-B9 increased by 97.60%, 11.96%, 44.07%, 9.21%, 76.63%, 42.56%, and 20.77%, respectively. This indicates that the expression of exogenous ATP-citrate lyase genes and mitochondrial citrate carrier genes can enhance the utilization of citric acid by the strains, directing more carbon flux towards oil synthesis and thus significantly increasing oil yield. Furthermore, among the expressed exogenous ATP-citrate lyase genes and mitochondrial citrate carrier genes, those from *Schizochytrium* HX-308 and *Saccharomyces cerevisiae*, respectively, exhibited the best oil yields. Overexpression of the ATP-citrate lyase gene from Schizochytrium HX-308 resulted in an oil yield of 1.82 g / L, while overexpression of the mitochondrial citrate carrier gene from Saccharomyces cerevisiae resulted in an oil yield of 1.54 g / L.
[0274] The YPD liquid culture medium has a pH of 6.5 and consists of 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, and water as the solvent. It is sterilized at 115°C for 30 minutes.
[0275] The YPD solid medium is YPD liquid medium with 2% agar added to the base.
[0276] The fermentation medium has a pH of 6.5 and consists of 1.7 g / L of amino acid-free and ammonium sulfate-free YNB, 2.5 g / L of yeast extract, 60 g / L of glucose, and is sterilized at 115°C for 30 minutes using pure water as the solvent.
[0277] Example 4: Fermentation production of EPA and lipids using engineered Yersinia lipophila strains Po1f-B2 and Po1f-B10
[0278] S1 picked single colonies of the engineered strains of Yersinia lipolytica, Po1f-B2 and Po1f-B10, and placed them in YPD liquid medium. They were cultured at 28°C and 280 r / min in a shaker for 24 h to obtain the seed culture of the engineered strains of Yersinia lipolytica.
[0279] S2. Take 500 μL of seed culture and inoculate it into 50 mL of fermentation medium. Place the fermentation medium in a 250 mL shake flask and incubate it in a shaker at 30℃ and 220 r / min for 120 h to obtain the fermentation broth.
[0280] After S3 fermentation, cell dry weight, oil yield, and fatty acid profile were determined according to the above detection methods. The results are as follows: Figure 10 and Figure 11 As shown, the cell dry weight, lipid content, and EPA yield of strain Po1f-B10 reached 10.33 g / L, 2.59 g / L, and 0.52 g / L, respectively. Compared with strains Po1f-B2, Po1f-B3, Po1f-B4, Po1f-B5, Po1f-B6, Po1f-B7, Po1f-B8, and Po1f-B9, the lipid yield increased by 47.62%, 42.15%, 144.50%, 163.05%, 224.33%, 67.83%, 183.68%, and 203.62%, respectively; and the EPA yield increased by 243.35%, 32.51%, 133.87%, 81.74%, 139.77%, 48.24%, 83.67%, and 116.81%, respectively. This indicates that the combined overexpression of the exogenous ATP-citrate lyase gene and the mitochondrial citrate carrier gene can significantly increase the production of lipids and EPA in Yersinia lipolytica.
[0281] The YPD liquid culture medium has a pH of 6.5 and consists of 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, and water as the solvent. It is sterilized at 115°C for 30 minutes.
[0282] The YPD solid medium is YPD liquid medium with 2% agar added to the base.
[0283] The fermentation medium has a pH of 6.5 and consists of 1.7 g / L of amino acid-free and ammonium sulfate-free YNB, 2.5 g / L of yeast extract, 60 g / L of glucose, and is sterilized at 115°C for 30 minutes using pure water as the solvent.
[0284] The patent published with patent number CN119432633A describes a method for achieving an oil yield of 1.772 g / L by overexpressing endogenous lipase (ME) and glucose-6-phosphate dehydrogenase (G6PDH) in *Yersinia lipolytica* Po1f. In contrast, this invention, through heterologous expression of ATP-citrate lyase genes and mitochondrial citrate vector genes from different sources in *Yersinia lipolytica* Po1f, ultimately constructs the *Yersinia lipolytica* strain Po1f-B10, achieving an oil content of 2.59 g / L and an EPA yield of 0.52 g / L. Therefore, this invention significantly improves the oil content and high-value fatty acid yield of the *Yersinia lipolytica* strain Po1f.
[0285] Although embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the invention and the appended claims. Therefore, the scope of the invention is not limited to the contents disclosed in the embodiments.
Claims
1. A *Yarrowia lipolyticis* strain that efficiently produces eicosapentaenoic acid (EPA) based on citric acid metabolic regulation, characterized by: The chassis strain of the engineered strain is Yersinia lipolyticis Po1f, and in this strain, partial elongation desaturases in the fatty acid synthesis pathway are overexpressed, including Δ9 elongase, Δ8 desaturase, Δ5 desaturase and Δ17 desaturase genes. On this basis, heterologous ATP-citrate lyase and mitochondrial citrate vector are also overexpressed. The Δ9 elongation enzyme comes from Saprolegnia diclina (SdΔ9EL), whose gene sequence is shown in SEQ ID No. 1; The Δ8 desaturase comes from Rhodotorula toruloides NP11 (RtΔ8DE), its gene sequence is shown in SEQ ID No. 2; The Δ5 desaturase comes from Nannochloropsis oceanica (NoΔ5DE), whose gene sequence is shown in SEQ ID No. 3; The Δ17 desaturase is derived from Parietichytrium sp (PaΔ17DE), whose gene sequence is shown in SEQ ID No. 4; The ATP-citrate lyase is derived from Schizochytrium sp. HX-308; The mitochondrial citrate carrier is derived from Saccharomyces cerevisiae ; The source Schizochytrium sp. The ATP-citrate lyase of HX-308 is SpACL, and its gene sequence is shown in SEQ ID No.
5. The source Saccharomyces cerevisiae The mitochondrial citrate carrier is ScYHM, and its gene sequence is shown in SEQ ID No.
9.
2. The application of the engineered strain of Yersinia lipophila as described in claim 1 in the production of EPA and oils.
3. The method for constructing the engineered strain of *Yarrowia lipophila* as described in claim 1, characterized in that: Includes the following steps: Construction of S1 recombinant plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE Using plasmid pUC-IntC-HUH-TE as a backbone, the SdΔ9EL and RtΔ8DE genes were inserted into the backbone to obtain the recombinant plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE. Construction of S2 recombinant plasmid pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE Using plasmid pUC-SCP2-HUH-TE as a backbone, the NoΔ5DE and PaΔ17DE genes were inserted into the backbone to obtain the recombinant plasmid pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE. Construction of S3 recombinant plasmid pUC-A08-HUH-TE-SpACL-ScYHM Using plasmid pUC-A08-HUH-TE-SpACL as a backbone, the ScYHM gene was inserted into the backbone to obtain the recombinant plasmid pUC-A08-HUH-TE-SpACL-ScYHM; Construction of an engineered S4 strain of Yersinia lipophila for EPA production The plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE was transformed into the uracil-auxotrophic *Yersinia lipolytica* strain Po1f (Po1f-ΔURA) to obtain recombinant *Yersinia lipolytica* strain 1, Po1f-B1. Po1f-B1 was inoculated onto YPD-5-FOA solid medium. After single-cell growth, it was streaked again on YPD solid medium for activation, yielding *Yersinia lipolytica* Po1f-B1-ΔURA. The plasmid pUC-SCP2-HUH-TE... -NoΔ5DE-PaΔ17DE was transferred into the recombinant strain Po1f-B1-ΔURA of Yersinia lipolytica to obtain recombinant strain 2 of Yersinia lipolytica, namely Po1f-B2, which is the Yersinia lipolytica engineered strain for producing EPA; Po1f-B2 was inoculated into YPD-5-FOA solid medium, and after single cells grew, it was streaked again in YPD solid medium to activate it, thus obtaining Yersinia lipolytica Po1f-B2-ΔURA; Construction of S5: A Lipid-Relieving Yersinia sacchariculture strain, Po1f-B10, for efficient eicosapentaenoic acid production based on citric acid metabolism regulation. The plasmid pUC-A08-HUH-TE-SpACL-ScYHM was transformed into the recombinant Yersinia lipolytica strain Po1f-B2-ΔURA to obtain recombinant Yersinia lipolytica strain 10, namely Po1f-B10, which is the Yersinia lipolytica engineered strain Po1f-B10 based on the efficient production of eicosapentaenoic acid by citric acid metabolism regulation.
4. The construction method according to claim 3, characterized in that: During strain construction, the promoters of each extended desaturase gene expression cassette were P. TEF promoter, P EXP promoter, P FBA promoter or P YAT One type of promoter, and terminator T CYC1t Termination, T xpr2t Termination, T lip2t One type of terminator.
5. A method for producing EPA and oils by fermentation using the engineered strain of *Yarrowia lipolyticis* as described in claim 1, characterized in that: Includes the following steps: In the process of fermenting the engineered strain of Yersinia lipophila to produce EPA and lipids, a shaker culture was used, with a fermentation time of 96-120 h, a temperature of 28-30℃, and a shaker speed of 180-220 rpm.
6. The method according to claim 5, characterized in that: The steps are as follows: Activation of S1 Yersinia lipophila engineered strain The engineered strain of *Yersinia lipolytica* was streaked onto YPD solid medium and cultured in an incubator at 30°C for 72 h. Single colonies of *Yersinia lipolytica* were picked and inoculated into YPD liquid medium and cultured in a shaker at 28°C and 280 r / min for 24 h to obtain the fermentation seed liquid. Fermentation by S2 lipophilic yeast strain The seed culture was inoculated into the fermentation medium at an inoculation rate of 1%, and cultured in a shaker at 30℃ and 220 r / min for 120 h to obtain the fermentation broth.
7. The method according to claim 6, characterized in that: The YPD liquid culture medium has a pH of 6.5 and consists of 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, and water as the solvent. It is sterilized at 115°C for 30 minutes. The YPD solid medium is YPD liquid medium with 2% agar added to the base. The fermentation medium has a pH of 6.5 and consists of 1.7 g / L of amino acid-free and ammonium sulfate-free YNB, 2.5 g / L of yeast extract, 60 g / L of glucose, and is sterilized at 115°C for 30 minutes using pure water as the solvent.
8. The method according to any one of claims 5 to 7, characterized in that: The method further includes the following steps: S3 fermentation product analysis The analysis of fermentation broth products after fermentation mainly includes two parts: one is the determination of cell dry weight, and the other is the determination of lipid content and fatty acid profile. The determination of cell dry weight mainly involves taking 30 mL of fermentation broth and placing it in a pre-weighed centrifuge tube. After centrifuging to remove the supernatant, the centrifuge tube is placed in a freeze dryer for freeze drying. After freeze drying, the sample is placed in an oven until constant weight is achieved. The weight of the centrifuge tube is weighed, and the weight of the empty tube is subtracted to obtain the cell dry weight of 30 mL of fermentation broth. The oil content and fatty acid profile were determined using gas chromatography: 200 μL of fermentation broth was centrifuged and lyophilized. 500 μL of NaOH-methanol solution was added to the lyophilized sample, and the mixture was shaken for 6 h. Then, 40 μL of concentrated sulfuric acid was added to terminate the reaction. Subsequently, 2 g / L methyl undecanoate solution was added as an internal standard and n-hexane for extraction, with 500 μL of n-hexane and 100 μL of internal standard added. After shaking for 2 h, the upper organic phase was collected for gas chromatography analysis.
Citation Information
Patent Citations
A method to increase the oil yield of Yersinia lipolytica
CN112391401B
Method for producing lipids using yarrowia lipolytica
CN118613592A
Yarrowia lipolytica engineering strain for efficiently producing eicosapentaenoic acid through cofactor strategy, construction method and application
CN119432633A
Exogenous cofactor enhanced yarrowia lipolytica strain, method and application in efficient synthesis of EPA (eicosapentaenoic acid) and lipid
CN120924416A