Sex-associated snp molecular marker of ayu based on genome-wide association analysis and application thereof

By screening sex-related SNP molecular markers in sweetfish through genome-wide association analysis, the problem of difficult sex identification in sweetfish farming has been solved, enabling early sex determination and efficient breeding, thereby improving breeding efficiency and industrial application potential.

CN120924649BActive Publication Date: 2026-04-21CHINESE ACAD OF FISHERY SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511246015.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-02
Publication Date
2026-04-21
Estimated Expiration
2045-09-02

AI Technical Summary

Technical Problem

In the current technology, it is difficult to identify the sex of individuals in the ayu farming process, which affects the formulation of breeding strategies and the improvement of farming efficiency. There is a lack of research on genome-wide association analysis, which results in the insufficient discovery of growth trait-related genes or significant SNP sites.

Method used

By using genome-wide association analysis and GCTA and GEMMA software, we screened out SNP molecular markers related to the sex of sweetfish, designed SNP chips for sex selection of sweetfish, and detected the genotype of SNP loci by PCR or sequencing technology. We then developed a kit for sex-related SNP molecular markers of sweetfish to achieve the screening of sex characteristics.

Benefits of technology

It improves the accuracy and efficiency of molecular-assisted breeding, enabling accurate sex determination in the early stages of fish fry development, achieving large-scale breeding of single-sex populations, overcoming growth difference bottlenecks, and improving breeding efficiency and industrial application scalability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120924649B_ABST
    Figure CN120924649B_ABST
Patent Text Reader

Abstract

The application provides a genetic sexing strain of the ayu based on whole genome association analysis and an application thereof. A GWAS analysis is performed on 426 ayu groups by using a GCTA and GEMMA double algorithm, and a core SNP marker verified by statistics is screened out. The marker can be used for precise selection of seeds at the fry stage, shortens the breeding and screening period, and promotes the industrialization of high-efficiency molecular design breeding of the ayu.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker screening technology, and in particular to sex-related SNP molecular markers in sweetfish based on genome-wide association analysis and their applications. Background Technology

[0002] The sweetfish (Plecoglossus altivelis), belonging to the order Osmeriformes, family Plecoglossidae, and genus Plecoglossus, is a small, flavorful, and economically valuable freshwater fish. Japan is the birthplace of sweetfish aquaculture, boasting a long history of cultivation, mature breeding techniques, and a well-developed industry. Although sweetfish farming in my country started later, thanks to farming methods adapted to local geography and climate, my country has initially formed a unique sweetfish farming industry. Currently, the domestic and international sweetfish farming industry faces multiple challenges, including water pollution, disease control, market competition, and technological bottlenecks. There is an urgent need to delve deeper into the genetic mechanisms of growth and development to pave new paths for industry upgrading.

[0003] Research on molecular markers in ayu (sweetfish) conducted by Chinese researchers includes the following aspects: Mitochondrial DNA sequence analysis of ayu by Qian Kaicheng, Chen Quanmei, Le Xiaoliang, and others indicates that the Chinese ayu may belong to the nominate subspecies of ayu (P. altivelis). Fan Huihui et al. used AFLP technology to analyze the genetic diversity of farmed ayu populations and attempted to screen for sex-specific molecular markers. The results showed that the genetic diversity of the ayu population was moderate to high, but the male-specific AFLP bands screened could not be successfully converted into SCAR markers, and DNA methylation analysis did not reveal any sex-related differences, suggesting that the sex determination mechanism of ayu may be complex and requires further research. Yan Songsong et al. used amplified fragment length polymorphism (AFLP) technology to analyze the genetic diversity of farmed ayu populations and successfully screened a male-specific molecular marker. Li Senyuan used... The technology was used to screen out male-specific DNA tags in sweetfish and determine that sweetfish use an XX / XY sex determination system.

[0004] To date, there have been few studies on genome-wide association studies (GWAS) of ayu (sweetfish). Therefore, we hope to discover genes or significant SNP loci associated with growth traits through GWAS, thereby revealing the genetic mechanisms of ayu growth and development. GWAS, as a powerful tool connecting genomic information with phenotypic variation, has been widely used in various economically important animals and crops. With the popularization of high-throughput sequencing technology, obtaining large-scale genomic data has become more efficient and economical. This study aims to combine bioinformatics and statistical genetics methods, using GCTA and GEMMA software, to conduct GWAS on seven major economic traits of ayu (such as body length, weight, and sex), screening for candidate genes and SNP variation loci significantly associated with growth traits, thereby revealing the genetic basis of ayu growth and development, and providing theoretical basis and technical support for precision breeding and sustainable aquaculture.

[0005] Given the difficulty in identifying the sex of individual ayu fish during aquaculture, which hinders the formulation of breeding strategies and the improvement of aquaculture efficiency, it is necessary to develop a sex-assisted breeding SNP molecular marker for ayu fish, which has significant practical implications. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and to provide a sex-related SNP molecular marker for sweetfish based on genome-wide association analysis and its application, which can be used for molecular marker-assisted breeding of sweetfish.

[0007] To achieve the objectives of this invention, the following technical solution is adopted:

[0008] In a first aspect of the present invention, an SNP chip for sex selection of sweetfish is provided, the SNP chip containing SNP sites, the nucleotide sequences of the SNP sites being shown in SEQ ID NO.1.

[0009] In a second aspect of the invention, a sex-related SNP molecular marker for sweetfish is provided, comprising: a sex-related molecular marker: a nucleotide sequence as shown in SEQ ID NO.1.

[0010] In a third aspect of the invention, the application of the SNP chip or the SNP molecular marker is provided in the assisted breeding of sweetfish.

[0011] Furthermore, by detecting the genotype of the SNP locus, individuals of sweetfish with sex characteristics are screened.

[0012] Further, detecting the genotype of the SNP locus includes:

[0013] Analysis was performed by designing specific primers to combine PCR product length polymorphism, allele-specific amplification, and high-resolution melting curves.

[0014] Alternatively, the base information of the target site can be read directly through sequencing technology.

[0015] In a fourth aspect of the invention, a kit is provided for detecting sex-related SNP molecular markers in sweetfish, the kit comprising a primer set for the SNP sites.

[0016] The beneficial effects of this invention are:

[0017] 1. Breakthrough in both the precision and reliability of molecular markers

[0018] Excellent statistical power: Independently validated by both GCTA and GEMMA algorithms. The selected SNP site (BNHK01000134:42996bp) has genomic significance, thus avoiding false positive interference.

[0019] The genetic mechanism is clear: the marker is directly associated with the sex determination pathway, providing a target for revealing the molecular mechanism of ayu growth and development.

[0020] 2. Early screening of 426 ayu fish: The molecular markers of this invention can improve the efficiency of molecular-assisted breeding: genotype can be directly determined (>95%) during the fry stage (≤3 months).

[0021] 3. Industrial application scalability

[0022] Sex-directed breeding: Using sex markers (BNHK01000134:42996bp) to achieve large-scale breeding of single-sex populations (e.g., all-female populations improve oviposition efficiency, all-male populations accelerate growth), breaking through the bottleneck of growth differences caused by mixed-sex breeding.

[0023] Molecular module breeding: Markers can be used as genetic elements and assembled with other economic trait loci (such as disease resistance and cold resistance) to form "optimal gene chips" to drive the targeted design breeding of sweetfish varieties. Attached Figure Description

[0024] Figure 1 This is a Manhattan plot of genome-wide association analysis of sex in sweetfish.

[0025] Figure 2 This is a distribution map of the original and mutant types of SNP markers for sex in sweetfish. Detailed Implementation

[0026] The present invention will be described in detail below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.

[0027] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.

[0028] To solve the technical problem of this invention, the overall concept of this invention is as follows:

[0029] This application first used the GCTA software algorithm to perform genome-wide association analysis, locating the SNP molecular markers for sex in sweetfish (Table 1), including: sex-associated locus: BNHK01000134 (scaffold): 42996bp (T / TA). Then, based on the original genotype and phenotypic data, we independently located this locus again using the GEMMA software algorithm, thus validating the above locus using dual algorithms.

[0030] The nucleotide sequence corresponding to this site is shown in SEQ ID NO.1, which contains a 100bp base sequence before and after the SNP marker, and there is a base variation at the 100bp position.

[0031] The molecular markers can be applied in sex marker-assisted breeding of sweetfish.

[0032] The sex SNP molecular markers of sweetfish screened by this invention are used for breeding superior varieties. Compared with traditional phenotype-based selection breeding and hybridization breeding methods, it has higher accuracy and detection efficiency. Based on the high-throughput SNP information obtained by whole-genome resequencing and the dual-algorithm verification of GCTA and GEMMA, compared with traditional QTL mapping, it covers SNP site information across the entire genome and has higher genome detection accuracy and reliability.

[0033] The sex SNP molecular markers of sweetfish obtained by screening using this invention can be used for marker-assisted breeding of sweetfish. Individuals can be selected directly at the genomic level in the early stages without relying on phenotypic information, which can significantly improve selection efficiency, accelerate the breeding process, improve breeding efficiency, and reduce breeding costs, and has broad application prospects.

[0034] Unless otherwise specified, all drugs, reagents or instruments used in this invention are commercially available.

[0035] The present application will now be described in detail with reference to embodiments and experimental data.

[0036] Example 1: Screening of sex-related SNP molecular markers in sweetfish using genome-wide association analysis based on GCTA software algorithm.

[0037] (1) Group selection and phenotypic statistics

[0038] All ayu (sweetfish) subjects in this study were from the same strain, collected from a long-established ayu farm in northern my country, where the population exhibits high genetic diversity. A total of 426 ayu whole-genome DNA samples were collected. Strict random sampling was followed during sample collection, with individuals randomly selected from the farm to ensure representativeness. Phenotypic data on sex traits were collected through morphological observation and gonadal dissection of sexually mature individuals.

[0039] (2) DNA extraction and resequencing

[0040] This study employed high-temperature and high-pressure sterilization of experimental equipment and performed DNA extraction and resequencing of sweetfish tail fin tissue under sterile conditions. The extraction process included tissue processing, tissue lysis, phase separation, DNA purification, and quality testing to ensure high-quality DNA samples. Samples that passed quality testing were sent to BGI Genomics in Wuhan for library construction and sequencing using the BGI T7 sequencing platform. Sequencing was performed in PE150 mode at a depth of 10×. These methods provided a solid data foundation for genotyping and SNP screening.

[0041] (3) Genome alignment and quality control

[0042] This application employs various tools and parameters for genomic data alignment and quality control to ensure the accuracy of the analysis results. First, FastP and FastQC were used to filter and perform quality checks on the sequencing raw data, and BWA was used to align the data to the *Amur sweetfish* reference genome. Subsequently, SAMTools was used for quality control and sorting of the results, and GATK was used to detect variant sites. BEAGLE was used to impute missing data, and PLINK was used to filter SNPs based on the --geno 0.1 and --maf 0.05 criteria. Finally, 555,242 high-quality SNPs from 209 individuals were selected for genome-wide association analysis (GWAS).

[0043] (4) Genome-wide association analysis

[0044] Based on genotyping results and phenotypic data, GCTA software was selected for GWAS analysis. GCTA is an important tool for analyzing the genetic architecture of complex traits. Based on the Genomic Relationship Matrix (GRM) and Restricted Maximum Likelihood Method (REML), it achieved, for the first time, an unbiased estimation of heritability at the genome-wide scale. The core algorithm of GCTA integrates genome-wide marker effects through a Linear Mixed Model (LMM), mathematically expressed as follows:

[0045]

[0046] The GRM matrix is ​​calculated from the normalized SNP genotypes (=( ), and Genetic variance and environmental variance are represented separately. Through REML optimization, GCTA can accurately estimate the heritability of SNPs.

[0047] .

[0048] It effectively corrects for the interference of population stratification and sample kinship on the estimated values. With these technical advantages, GCTA is widely used in animal and plant breeding and research on complex human diseases, becoming one of the standard tools for the genetic analysis of complex traits.

[0049] Association analysis was performed between sex phenotype data and SNP molecular markers, and an association value was obtained for each SNP locus. Empirical values ​​for genome-wide significance threshold selection. Using software, SNP loci that reached a significant association were extracted, and two SNP loci associated with the sex of sweetfish were selected. They were associated with the sex of sweetfish (Table 1).

[0050] Table 1. Information on two SNP markers that significantly associated with sex traits in sweetfish identified by GCTA.

[0051]

[0052] Note: Bold text indicates SNP molecular markers that were simultaneously identified by both GCTA and GEMMA software.

[0053] The 42996 bp site (BNHK01000134, scaffold) was re-identified and validated in subsequent independent analysis using the GEMMA algorithm. The GWAS results were visualized using R software, producing Manhattan plots and QQ plots. .

[0054] Example 2: Genome-wide association analysis based on GEMMA software algorithm

[0055] Based on the genotyping and phenotypic data of sweetfish, GEMMA software was used to perform genome-wide association analysis (GWAS) to screen for sex-related SNP molecular markers. GEMMA is a professional software of great significance in the field of genome-wide association studies. It has a built-in efficient mixture model association algorithm that can accurately fit the standard linear mixture model (LMM) and several approximate models. In this study, GEMMA was used to fit the univariate linear mixture model (LMM) to achieve association analysis between markers and single phenotypes, fully considering complex factors such as population stratification and sample structure, thereby accurately assessing the proportion of genotype explained by phenotypic variance. The core algorithm of GEMMA is based on the linear mixture model, and its key mathematical formulas are as follows:

[0056]

[0057] Where y is a vector containing quantitative traits (or binary disease labels) of n individuals; It is an n×c covariate matrix (fixed effects) containing a column of all 1s; It is the coefficient vector corresponding to the covariates, including the intercept term; It is A dimensional marker genotype vector; It is the size of the labeled effect; It is A vector of random effects in dimensionality; It is An error vector of dimension 1; The variance represents the residual error; It is the ratio between the two variance components; K is a known value. Kinship matrix; In is The identity matrix; ,express Dimensional multivariate normal distribution.

[0058] Phenotypic data of growth traits and sex were correlated with SNP molecular markers, and empirical values ​​were selected for genome-wide significance thresholds. SNP loci that achieved significant association were extracted using software, and the SNP loci associated with the sex of sweetfish listed in Table 2 were selected. These SNP loci are associated with the sex of sweetfish and can be used for the breeding of sweetfish. Among them, the BNHK01000134 (scaffold): 42996bp locus was also identified in the genome-wide association analysis based on the GCTA software algorithm.

[0059] Table 2. SNP markers significantly associated with sex traits in sweetfish identified by GEMMA.

[0060]

[0061] Independent genome-wide association analyses of the ayu trait were performed using GCTA and GEMMA, two software programs based on different statistical algorithms, and their results were complementary. The SNP marker BNHK01000134 (scaffold): 42996 bp was validated using both algorithms. The molecular markers screened in both Examples 1 and 2 (Table 3) were selected for ayu breeding.

[0062] Table 3. Significantly Associated SNPs of Sex in Sweetfish Validated by GCTA and GEMMA Algorithms

[0063]

[0064] A total of 200 bp base sequences before and after the site

[0065] BNHK01000134:42996

[0066] GTTAGGGTTAGATTTCCCACTATAACACCATTAAATATGGTGTTTAATTGACTATGTTATAGCACTGCAACATTCAGTTTACTAACAAATCAATAATCTTAAGTCCTGGCTGCAGTTTAATGTCATTCACATTCGTCTAACATAACATGACAACTGGAACAACAGACTCAGACCTAATGTCTTGAAGCTCCCTCTTCCCAGT (SEQ ID NO. 1).

[0067] Application Example 1: Validation and Application of Sex-Related SNP Molecular Markers

[0068] 1. Experimental Materials and Methods

[0069] 1.1 Sample Source

[0070] Ayu population: 208 adult ayu (sexually mature) were randomly selected from the same ayu farm.

[0071] Sex determination: Anatomical observation of gonads (testes / ovaries), males are marked with 1, and females with 0.

[0072] 1.2 SNP genotyping detection

[0073] Target site: BNHK01000134:42996bp (T / TA)

[0074] Classification criteria:

[0075] SNP=0: Original genotype (T / T)

[0076] SNP=1: Insertion mutant (TA / TA or T / TA)

[0077] F: 5'-ACAGTTTCTTCACCTTGTTG-3'

[0078] R: 5'- AGCTGAGAGTATATTTGTGG-3'

[0079] After PCR amplification, the sample was sent for sequencing.

[0080] 2. Experimental Results

[0081] 2.1 Statistics on the association between SNPs and gender

[0082] Table 4

[0083]

[0084] Male population: 83% (90 / 109) carry the mutant (SNP=1);

[0085] Female population: 86% (85 / 99) retained the primordial type (SNP=0);

[0086] 2.2 Statistical Validation

[0087] Chi-square test:

[0088] The results showed that the association between SNP genotype and sex was extremely significant (far exceeding the p<0.001 threshold), with a correlation coefficient of r = 0.683 (strong positive correlation), proving that the mutant type (SNP=1) can serve as a male marker.

[0089] Application Example 2: SNP Molecular Marker Detection and Breeding Applications

[0090] 1. Materials and Methods

[0091] 1.1 Experimental Samples

[0092] Population origin: 90 three-month-old sweetfish fry were randomly selected from a fish farm in northern China.

[0093] Group design: There are experimental groups (genotype screening, n=30) and control groups (traditional phenotypic selection, n=60).

[0094] 1.2 DNA Extraction and Detection

[0095] DNA extraction: Caudal fin tissue was collected and processed according to the TIANamp Genomic DNA Kit instructions.

[0096] Detection method:

[0097] Table 5

[0098]

[0099] 1.3 Genotype Interpretation Criteria

[0100] Table 6

[0101]

[0102] 2. Results Analysis

[0103] 2.1 Detection efficiency

[0104] Table 7

[0105]

[0106] 2.2 Verification of breeding effects

[0107] Genotyping was performed on 30 fish fry in the experimental group: individuals with the TA / TA or TA / T genotypes were selected;

[0108] Key indicators after 6 months of breeding:

[0109] Table 8

[0110]

[0111] 3. The above results prove that:

[0112] (1) Technical feasibility:

[0113] (2) Sanger sequencing can accurately determine the genotype of the target SNP;

[0114] (3) The sex markers TA / TA or TA / T type strongly match the male phenotype, enabling targeted breeding of single-sex populations.

[0115] (4) Sex control: The proportion of males increased from 53.3% to 80%;

[0116] Industry significance: For the first time, the breeding and screening cycle for sweetfish has been reduced from one year to a few months.

[0117] As shown above, the sex-associated site in the nucleotide sequence SEQ ID NO.1: BNHK01000134 (scaffold): 42996bp (T / TA) can be used to identify the sex of fish fry.

[0118] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0119] Although preferred embodiments of the present invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of the present invention.

[0120] Obviously, those skilled in the art can make various modifications and variations to the embodiments of the present invention without departing from the spirit and scope of the embodiments of the present invention. Thus, if these modifications and variations to the embodiments of the present invention fall within the scope of the claims of the embodiments of the present invention and their equivalents, the embodiments of the present invention are also intended to include these modifications and variations.

Claims

1. A molecular marker of a sex-related SNP of Ayu, characterized by, The nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 1, and the 100-101th is TA or T, and the insertion mutation TA is associated with male gender of the ayu.

2. Use of the reagent for detecting the SNP molecular marker according to claim 1 in the sex-assisted breeding of Ayu, characterized in that, The insertion mutation TA of the SNP molecular marker is associated with male gender of the ayu.

3. Use according to claim 2, characterized in that, The female or male ayu individual is screened by detecting the genotype of the SNP molecular marker.

4. Use according to claim 3, characterized in that, The detection of the genotype of the SNP molecular marker comprises: The PCR product length polymorphism, allele-specific amplification, high-resolution melting curve analysis are performed by designing specific primers; Or the base information of the target site is directly read by a sequencing technology.