InDel molecular marker for identifying gender of bitter gourd and application of InDel molecular marker

Abstract

The invention belongs to the technical field of plant molecular genetics, and particularly discloses an InDel molecular marker for identifying bitter gourd sex and application thereof.The specific InDel molecular marker is screened out by constructing sequencing data of a strong female parent mixed pool P1 (23C37), a strong male parent mixed pool P2 (23C38), F1 and F2 BAS mixed pools and combining bioinformatics analysis, and the molecular marker is used for identifying bitter gourd sex. The excavated InDel molecular marker sites are different from annotation genes of homologous pistil genes reported in cucurbitaceae species in the past, when the InDel molecular marker is used for identifying the strong female characters of the bitter gourds in the seedling stage, detection is easy and convenient, the requirements for instruments, equipment and the technology are low, the detection can be conducted on an electrophoresis technology platform, and the method is suitable for large-scale popularization and application. Sex typing can be completed in the seedling stage (3-4 true leaf stage), and an efficient tool is provided for sex identification of bitter gourds and other cucurbitaceae crops.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular genetics technology, and relates to the discovery of specific InDel molecular markers, particularly to an InDel molecular marker for identifying the sex of bitter gourd and its application. Background Technology

[0002] In cucurbitaceous crop breeding, the utilization of female lines (pistil plants) is a key technology for hybrid seed production because it avoids the tedious process of artificial emasculation, reduces the risk of pollen contamination, and significantly improves hybridization efficiency. Previous studies have identified acetylene zinc finger transcription factors CsWIP1, CmWIP1, and ClWIP1 as key genes in pistil formation in crops such as cucumber, melon, and watermelon (Hu, et al. 2017; Martin, et al. 2009; Zhang, et al. 2020). However, the discovery of these genes is concentrated in a few species, and the functional conservation of homologous genes in other cucurbitaceous crops remains unclear. Moreover, to date, no other genes involved in pistil formation have been found in cucurbitaceous crops.

[0003] Bitter melon (Momordica charantia), an important economic crop of the Cucurbitaceae family, has attracted much attention for its medicinal value and nutritional characteristics (Wang et al. 2017). Researchers have discovered a complex sex differentiation mechanism during breeding, and the selection of strong female lines has significant guiding implications for the actual production of bitter melon. For example, by hybridizing early-maturing, high-yielding strong female lines of bitter melon with other varieties possessing excellent traits, F1 generation bitter melon with multiple desirable traits such as good quality, high yield, strong resistance, and early maturity can further promote the development of the bitter melon industry. Traditional sex identification relies on morphological observation (such as detecting the ratio of male to female flowers after flowering), which has drawbacks such as a long cycle (requiring late growth period) and low accuracy (susceptible to environmental interference).

[0004] Currently, the molecular markers related to female identification in bitter gourd are mainly SNP-based methods such as KASP (kompetitive allele-specific PCR), dCAPS (Derived Cleaved Amplified Polymorphic Sequences), and CAPS (Cleaved Amplified Polymorphic Sequences) (Huang Yuhui, et al. 2023; Zhou Lijuan). However, SNP markers require specialized typing instruments and complex operating procedures, making them difficult to promote in grassroots breeding units.

[0005] Given that traditional sex determination relies on morphological observation (such as detecting the ratio of male to female flowers after flowering), which has drawbacks such as long cycle (requires late growth period), low accuracy (susceptible to environmental factors), and complex detection, it is necessary to develop a simple, convenient, and easily promoted detection method at the grassroots level. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the present invention aims to provide an InDel molecular marker for identifying the sex of bitter gourd. This invention constructs BAS pooled sequencing data from strong female, strong male, strong female, and strong male parents, and combines this data with bioinformatics analysis to screen for specific InDel molecular markers. The InDel molecular marker sites discovered in this invention differ from the annotation genes of homologous pistil genes previously reported in Cucurbitaceae species. Using the InDel molecular markers of this invention, the strong female trait of bitter gourd can be identified at the seedling stage. The detection is simple and convenient, requiring minimal equipment and technical expertise, and can be performed on an electrophoresis platform, providing an efficient tool for sex identification of bitter gourd and other Cucurbitaceae crops.

[0007] This invention is achieved through the following technical solution:

[0008] An InDel molecular marker for identifying the sex of bitter gourd, wherein the molecular marker is located at loci 19683132 or 19683664 on chromosome 1 (chr01) of bitter gourd, and is denoted as molecular marker F077 or F862 respectively.

[0009] The nucleotide sequence of the molecular marker F077 is shown in SEQ ID NO:1. Ten bases are inserted after the 439th base A from the 5' end of the sequence shown in SEQ ID NO:1. The inserted base sequence is GTCAAAAGAC (SEQInDel-F077).

[0010] The nucleotide sequence of the molecular marker F862 is shown in SEQ ID NO:2. The sequence shown in SEQ ID NO:2 has 15 bases inserted after the 252nd base C from the 5' end. The inserted base sequence is CACGACGTTGGAGGC(SEQInDel-F862).

[0011] Furthermore, this invention protects the application of the above-mentioned InDel molecular marker in the sex identification of bitter gourd seedlings.

[0012] Furthermore, the present invention also provides primers containing the above-mentioned InDel molecular marker sites, specifically:

[0013] Primers containing F077 are:

[0014] F077-F:TTCCTCTCCAGCCAAATACACT(SEQ ID NO:3),

[0015] F077-R:CGATCAGGCATCCTATGTTGG (SEQ ID NO:4);

[0016] Primers containing F862 are:

[0017] F862-F:TCCATAATCGTAGCACCACAGT(SEQ ID NO:5),

[0018] F862-R:GCCTAATGCCTAGACGTTGC (SEQ ID NO: 6).

[0019] Furthermore, this invention protects the application of the above primers in the sex identification of bitter gourd seedlings. The specific application method includes the following steps: using genomic DNA as a template, primer F077-F / R is used to scan F2 generation single plants; when the amplified band is 120bp, the plant is strongly female; when the amplified band is 110bp, the plant is strongly male.

[0020] Alternatively, using genomic DNA as a template, primers F862-F / R were used to scan F2 generation single plants; when the amplified band was 136 bp, the plant was strongly female, and when the amplified band was 121 bp, the plant was strongly male.

[0021] Furthermore, the present invention also provides another primer containing the above-mentioned InDel molecular marker site, specifically:

[0022] Primers containing F077 are:

[0023] F077-DF:GGACTTCTGCAAAGGGTCTC (SEQ ID NO:7);

[0024] F077-DR:TCTCAAGACTGGAGCGAACC (SEQ ID NO:8);

[0025] Primers containing F862 are:

[0026] F862-DF:GACTACCTAGGATTACACAGTTG (SEQ ID NO:9);

[0027] F862-DR:ACTGAATTACCCACATCTGAGTG (SEQ ID NO: 10).

[0028] Furthermore, this invention protects the application of the above primers in the sex identification of bitter gourd seedlings, specifically including the following steps:

[0029] The genomic DNA of the bitter gourd samples to be tested was amplified by PCR using primers F077-DF / DR. The PCR amplification products were sequenced. If the SEQInDel-F077 sequence was detected after the 19683132nd base A from the 5' end of chr01, the sample was a strongly female plant. If the SEQInDel-F077 sequence was not detected, the sample was a strongly male plant.

[0030] And / or, PCR amplification of the genomic DNA of the bitter gourd sample to be tested is performed using primer F862-DF / DR, and the PCR amplification product is sequenced. If the base sequence SEQInDel-F862 is detected after the 19,683,664th base C from the 5' end of chr01, the sample is a strongly female plant; if the base sequence SEQInDel-F862 is not inserted, the sample is a strongly male plant.

[0031] The sequence of SEQInDel-F077 is GTCAAAAGAC; the sequence of SEQInDel-F862 is CACGACGTTGGAGGC.

[0032] Furthermore, the present invention also protects a kit comprising the primers of SEQ ID NO:3-10 described above.

[0033] Furthermore, this invention also protects the application of the reagent kit in the sex identification of bitter gourd seedlings.

[0034] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0035] This invention utilizes BAS pooled sequencing data from strong female, strong male, strong female, and strong male parents, combined with bioinformatics analysis, to screen for specific InDel molecular markers, providing an efficient tool for sex identification in bitter gourd and other cucurbitaceous crops. The InDel molecular marker sites identified in this invention differ from previously reported annotation genes for homologous pistil genes in cucurbitaceous species.

[0036] Compared to the complex SNP markers used in genotyping systems, using InDel of this invention for bitter gourd sex identification requires only routine PCR amplification and agarose electrophoresis (no need for quantitative real-time PCR or enzyme digestion), reducing detection costs by 60% (single sample reagent consumables ≤ 0.5 yuan vs. KASP marker ≥ 1.2 yuan). Furthermore, it can be widely implemented in grassroots laboratories, is simple and convenient to perform, has low requirements for instruments and equipment and technology, and can be carried out on an electrophoresis technology platform.

[0037] Using the InDel of this invention for bitter gourd sex identification has early identification timeliness, and sex type can be completed at the seedling stage (3-4 true leaves stage), which shortens the breeding cycle by 4-6 months compared with the traditional flowering observation method. Attached Figure Description

[0038] Figure 1 This is a graph showing the polymorphism detection results of the molecular markers F077 and F866 of this invention;

[0039] Among them, A represents the polymorphism detection of the F077 locus between the parents and the F1 generation; B represents the polymorphism detection of the F862 locus between the parents and the F1 generation.

[0040] Figure 2 The image shows the sequencing results of the InDel site in the parent and F2 generations.

[0041] Wherein, A represents the sequence detection of the F077 locus in the parent and F2; B represents the sequence detection of the F862 locus in the parent and F2.

[0042] Figure 3 This is a screenshot showing the results of scanning some individual plants using InDel molecular markers.

[0043] In this study, A represents 29 individual plants in F2 scanned using the F077 marker; B represents 36 individual plants in F2 scanned using the F862 marker. Detailed Implementation

[0044] The present invention will now be described in detail with reference to specific embodiments.

[0045] Test materials:

[0046] In a specific embodiment of the present invention, the strong female bitter gourd inbred line '23C37' and the strong male bitter gourd inbred line '23C38' were selected as parental materials to construct four genetic populations containing three generations: P1 (23C37), P2 (23C38), F1, and F2. The genetic loci controlling the female trait of bitter gourd were detected using BSA mapping combined with linkage mapping, and molecular markers closely linked to them were developed.

[0047] Example 1: Screening of InDel sites

[0048] 1. Single-plant DNA extraction

[0049] Individual samples were taken from the parental lines, F1 generation, and F2 generation populations. The samples were then frozen in liquid nitrogen and stored at -70°C for DNA extraction. A modified CTAB method was used for DNA extraction, and the specific steps are as follows:

[0050] (1) Preheat the 2% CTAB extract solution prepared in advance in a 65℃ water bath. While preheating, put the sample into a mortar and add liquid nitrogen to grind it into powder. Transfer the powder to a pre-cooled 2mL centrifuge tube.

[0051] (2) Add 700 μL of CTAB extraction solution to the centrifuge tube, shake well, and incubate in a water bath at 65°C for 40 min, inverting and shaking several times every 10 min.

[0052] (3) Add 700 μL of 24:1 (chloroform:isoamyl alcohol volume ratio), mix thoroughly, place in a 4℃ refrigerator and let stand for 10 min, then centrifuge at 10000 r / min for 10 min;

[0053] (4) Take 500 μL of the supernatant into a new centrifuge tube, add 500 μL of 2% CTAB extraction solution, mix well, and incubate in a water bath at 65°C for 30 min, shaking and inverting several times every 10 min.

[0054] (5) Add 500 μL of 25:24:1 (volume ratio of water-saturated phenol: chloroform: isoamyl alcohol), mix thoroughly, let stand in a 4℃ refrigerator for 10 min, and then centrifuge at 10000 r / min for 10 min.

[0055] (6) Take 400 μL of supernatant, add an equal volume (400 μL) of 24:1 (chloroform:isoamyl alcohol volume ratio), mix thoroughly, let stand in a 4℃ refrigerator for 10 min, and then centrifuge at 10000 r / min for 10 min.

[0056] (7) Take 300 μL of supernatant, add an equal volume (300 μL) of pre-cooled isopropanol, gently invert and mix, let stand at -20℃ for 20 min, and then centrifuge at 10000 r / min for 10 min.

[0057] (8) Discard the supernatant, add 1 mL of 70% ethanol to the centrifuge tube to wash the DNA. Generally, wash 2-3 times, centrifuge and discard the ethanol. You can use a pipette tip to remove the residual ethanol in the centrifuge tube to make it dry faster until it becomes transparent.

[0058] (9) Add 50 μL of 0.1% RNase water to the air-dried DNA and incubate in a water bath at 37°C for 30 min to fully dissolve the DNA;

[0059] (10) DNA quality testing: Electrophoresis was performed on a 1% agarose gel, and the integrity, concentration, and purity of the DNA were detected using Nanodrop 2000. When OD260 / OD280 < 1.8, it indicates a high protein content; when OD260 / OD280 > 2.0, it indicates a high RNA content; when OD260 / OD280 = 1.8-2.0, it indicates relatively pure DNA.

[0060] (11) Take a portion of the stock solution, dilute it to 50 ng / μL as a template, store it at -4℃ for later use, and store the remaining stock solution in a refrigerator at -20℃.

[0061] 2. Construction of DNA pools based on strong females

[0062] Two parents with extreme values ​​of strong female and strong male traits were selected and mixed with two extreme trait populations that showed trait segregation in the F2 generation to construct a pool, which was then stored in a -70℃ freezer.

[0063] 3. Genomic DNA pooled sequencing and InDel site determination

[0064] After the genomic DNA from the two pools passed the initial testing, the pooled DNA sequences were fragmented into random fragments using ultrasound. The fragmented DNA underwent sequential end repair, 3′ A-addition, and sequencing adapter ligation. Magnetic beads were then used to adsorb and enrich fragments of approximately 400 bp in length, which were then amplified by PCR to form sequencing libraries. The constructed libraries underwent quality control. Libraries that passed quality control were sequenced using the Illumina HiSeq™ platform, with a total read length of 300 bp. After the Illumina HiSeq™ sequencing data (Raw Data) was processed, quality control was performed to filter out low-quality data, obtaining high-quality data (Clean Data). BWA software was used to align the Clean Data to the reference genome sequence to determine the sequence positions. Then, GATK software was used to detect InDel sites between the pools. Based on the characteristics of the mutant pool data, the InDel-index value was calculated to screen InDel sites, selecting InDel sites with a ΔIndex value greater than 0.4 and a sequencing depth greater than 15. Sequencing analysis results showed that one InDel was selected from each of the chr01-19683132 (F077) and chr01-19683664 (F862) loci in bitter melon.

[0065] Example 2: InDel site verification

[0066] (1) Polymorphism detection

[0067] Download the nucleotide sequences approximately 200-500 bp upstream and downstream of sites F077 and F862, as shown in SEQ ID NO:1 and SEQ ID NO:2, respectively.

[0068] SEQ ID NO:1

[0069] GGACTTCTGCAAAGGGTCTCATATTTGAAATTACGGAGATTCCAAGAAATTTATGCTTATTAAGTAGTTTATTTTGTTTTAGCAAATAATGAAATTTTGGAGTATATATGGGGAGGTGATTTGTGTTTACTTAGTTAAATTAAGATTGAGTAGTATGAAATTTCGAGGTATTTGTTTTCATGAATGGATTTAGTTTTCTTTTTTTTTTTTTCCTTTCTAGGGTTCCAATCCAAAAAACAACCGTACAAGAGGACGTCTACTAAAGAAAAGAACTCTATTCTAAGAAAAATAACACCAAACTGATAATTACAAACGACCTTAGAGATTGATCTCCACAAAGAAGTATTAAATCTAATAAGATCTCAAACAAACTCTACGAATCTCTCCATCTTTAAAAAAATTTTATTGTTCCTCTCCAGCCAAATAC ACTCACAAAGTAAAGTATGCCACAAAAAGCAATCCTTATGTCGAAACGTAGGGGCCAATAACACCTCCTCCAACATAGGAATGCCTGATCGATGGAGCATTCTAGAATATATGAAGGTTTTCATATCTTTTATGTTACCTAAGCACATATTAAATCCATTGCAAAGACGATTTTTAGTCAAGTTAAGAAGTATTTATGCTAATTTGACAAGATGTGCAAGAGGAACTATTTGTTAATTGGACGTTGGTGAAGTAGTGAAGTGATGGGATAAAAAATAGATTAATTGGTAAGTTTTTCAAACAATAACTATTTGATTTTTCCCTTCTACAAGTTAAAAACAAATAAGTAAGCAACAATAAGGAATAAGAAACAATGATAGAAAAACTTAACACTAGAAGGATTATATTGGTTCGCTCCAGTCTTGAGA

[0070] SEQ ID NO:2

[0071] GACTACCTAGGATTACACAGTTGAAAACACCCTCAATAAATCTACGAATATAGACTTTTTTCATACACTGCCCATAAACACTGAAGTCTCTTTTCTTTGAATTATATACAACTAAATACAAGCTCCAAATCACTCATTTACTGGGTGGATCCATAATCGTAGCACCACAGTGCTGCGGGACAGTGGCCAACACCTGAGCTCTGCCTTCTTGGCAGCTTGCCTACTACAGCCGCTCTTTTGGGTTCATAGCGCAACGTCTAGGCATTAGGCCTTGCAGCTTCGACTCTCCTATTTTAACTCCATTGATCCAACATGAAGTTCCTACTAATAAGTTAAAGCTGACTCTCTTATATTAATTCCATTGGGAAATCAATGATCTTGAATAATTTCCCCTCCTACAAGAATATCCAAACACACACCACAATATGCAAATAAGGAAGAAACGAAACTATAAAACACAAGAAACGACACAATAAAATTATATTAGTTCACCAATTAAGGGCTACGTCCAATCTTTCACTCAGATGTGGGTAATTCAGT

[0072] The molecular marker primer pairs F077-F / R (SEQ ID NO: 3 and SEQ ID NO: 4) and F862-F / R (SEQ ID NO: 5 and SEQ ID NO: 6) containing InDel sites were designed using Primer Premier 5.0.

[0073] F077-F: TTCCTCTCCAGCCAAATACACT (SEQ ID NO: 3)

[0074] F077-R: CGATCAGGCATTCCTATGTTGG (SEQ ID NO: 4)

[0075] F862-F: TCCATAATCGTAGCACCACAGT (SEQ ID NO: 5)

[0076] F862-R: GCCTAATGCCTAGACGTTGC (SEQ ID NO: 6)

[0077] The polymorphism of the InDel marker was detected by PCR amplification using the primer pairs described above. The PCR reaction system is shown in Table 1, and the PCR reaction procedure is shown in Table 2. Polymorphism of the developed InDel marker was detected using parents P1, P2, and F2 (mixed samples). It was found that markers F077 and F866 exhibited stable polymorphism between the parents (results are shown in Table 2). Figure 1 ).

[0078] Table 1 PCR reaction system

[0079]

[0080]

[0081] Table 2 PCR reaction procedures

[0082]

[0083] (2) Authenticity Detection

[0084] Using strong female parent P1 and strong male parent P2 of bitter gourd as materials, PCR amplification primers F077-DF / DR (SEQ ID NO:7 and SEQ ID NO:8) and F862-DF / DR (SEQ ID NO:9 and SEQ ID NO:10) containing the InDel site and with a product length greater than 250 bp were designed using Primer Premier 5.0.

[0085] F077-DF:GGACTTCTGCAAAGGGTCTC(SEQ ID NO:7)

[0086] F077-DR:TCTCAAGACTGGAGCGAACC(SEQ ID NO:8)

[0087] F862-DF:GACTACCTAGGATTACACAGTTG(SEQ ID NO:9)

[0088] F862-DR:ACTGAATTACCCACATCTGAGTG(SEQ ID NO:10)

[0089] PCR amplification was performed using the primer pairs described above. The PCR reaction system is shown in Table 3, and the PCR reaction procedure is shown in Table 4. The authenticity of InDel was verified using PCR sequencing (results are shown in Table 4). Figure 2 ).

[0090] Table 3 PCR reaction system

[0091]

[0092] Table 4 PCR reaction procedures

[0093]

[0094] like Figure 2 As shown in Figure A, F077 involves the insertion of 10 bases after the 19,683,132nd base A from the 5' end of chromosome 1 (chr01), with the inserted sequence being GTCAAAAGAC (SEQInDel-F077). When the InDel-F077 insertion is detected after the 19,683,132nd base A from the 5' end of chr01, the F2 generation sample F2-1 is identical to P1, both being strongly female plants. When the SEQInDel-F077 insertion is absent, the F2 generation sample F2-1 is identical to P2, both being strongly male plants.

[0095] like Figure 2 As shown in B, F862 is an insertion of 15 bases after the 19,683,664th base C from the 5' end of chr01, with the inserted base sequence being CACGACGTTGGAGGC (SEQInDel-F862). When the insertion of SEQInDel-F862 is detected after the 19,683,664th base C from the 5' end of chr01, the F2 generation sample F2-1 is the same as P1, both being strongly female plants. When the insertion of SEQInDel-F862 is not detected, the F2 generation sample F2-2 is the same as P2, both being strongly male plants.

[0096] The above results are consistent with the plant phenotype, indicating that the molecular markers of the present invention can be used to identify the sex of bitter gourd plants.

[0097] Example 3: Application of InDel molecular markers

[0098] Genomic DNA was extracted from 29 F2 generation seedlings. Using the genomic DNA as a template, primers F077-F / R were used to scan the 29 F2 generation seedlings, and the amplified products were subjected to electrophoresis. When the amplified band was 120 bp, the plant was strongly female; when the amplified band was 110 bp, the plant was strongly male. Figure 3 As shown in A, among the 29 F2 generation populations, 1-17 were strongly female plants, 18-23 and 25-28 were strongly male plants, and 24 and 29 were heterozygous plants.

[0099] In addition, genomic DNA was extracted from 36 F2 generation seedlings. Using the genomic DNA as a template, primers F862-F / R were used to scan the 36 F2 generation seedlings, and the amplified products were subjected to electrophoresis. When the amplified band was 136 bp, the plant was strongly female; when the amplified band was 121 bp, the plant was strongly male. Figure 3As shown in B, among the 36 F2 generation populations, 1-6, 8-10, 11 and 31 were strongly female plants, 16-18, 21-30, 32-34 and 36 were strongly male plants, and 7, 11, 12, 14, 15, 19, 20 and 35 were heterozygous plants.

[0100] The above embodiments are only for illustrating the technical concept and features of the present invention, and are intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly. They should not be construed as limiting the scope of protection of the present invention. All equivalent transformations or modifications made in accordance with the spirit and essence of the present invention should be covered within the scope of protection of the present invention.

Claims

1. An InDel molecular marker for identifying the sex of bitter melon, characterized in that, The molecular marker is F077 or F862; the nucleotide sequence of F077 is shown in SEQ ID NO:1, and 10 bases are inserted after the 439th base A from the 5' end of the sequence shown in SEQ ID NO:1, and the inserted base sequence is GTCAAAAGAC (SEQInDel-F077). The nucleotide sequence of F862 is shown in SEQ ID NO:

2. The sequence shown in SEQ ID NO:2 has 15 bases inserted after the 252nd base C from the 5' end. The inserted base sequence is CACGACGTTGGAGGC (SEQInDel-F862).

2. The application of the InDel molecular marker as described in claim 1 in the sex identification of bitter gourd seedlings.

3. A primer comprising the InDel molecular marker site as described in claim 1, characterized in that, Primers containing F077 are: F077-F: TTCCTCTCCAGCCAAATACACT (SEQ ID NO:3), F077-R:CGATCAGGCATCCTATGTTGG (SEQ ID NO:4); Primers containing F862 are: F862-F: TCCATAATCGTAGCACCACAGT (SEQ ID NO:5), F862-R: GCCTAATGCCTAGACGTTGC (SEQ ID NO: 6).

4. The application of the primers as described in claim 3 in the sex identification of bitter gourd seedlings, characterized in that, Includes the following steps: Using bitter gourd genomic DNA as a template, primers F077-F / R were used to scan F2 generation single plants. Electrophoresis was performed on the amplified products. When the amplified band was 120 bp, the plant was strongly female; when the amplified band was 110 bp, the plant was strongly male. Alternatively, using bitter gourd genomic DNA as a template, primers F862-F / R were used to scan F2 generation single plants, and the amplified products were subjected to electrophoresis. When the amplified band was 136 bp, the plant was strongly female, and when the amplified band was 121 bp, the plant was strongly male.

5. A primer comprising the InDel molecular marker site as described in claim 1, characterized in that, Primers containing F077 are: F077-DF: GGACTTCTGCAAAGGGTCTC (SEQ ID NO:7); F077-DR: TCTCAAGACTGGAGCGAACC (SEQ ID NO:8); Primers containing F862 are: F862-DF:GACTACCTAGGATTACACAGTTG (SEQ ID NO:9); F862-DR: ACTGAATTACCCACATCTGAGTG (SEQ ID NO: 10).

6. The application of the primers according to claim 5 in the sex identification of bitter gourd seedlings, characterized in that, Includes the following steps: The genomic DNA of the bitter gourd sample to be tested was amplified by PCR using the primer F077-DF / DR as described in claim 5. The PCR amplification product was sequenced. If the base sequence SEQInDel-F077 was detected after the 19683132nd base A from the 5' end of chr01, the sample was a strongly female plant. If the base sequence SEQInDel-F077 was not detected, the sample was a strongly male plant. And / or, using the primer F862-DF / DR as described in claim 5, the genomic DNA of the bitter gourd sample to be tested is amplified by PCR, and the PCR amplification product is sequenced. If the base sequence SEQInDel-F862 is detected after the 19683664th base C from the 5' end of chr01, the sample is a strongly female plant; if the base sequence SEQInDel-F862 is not inserted, the sample is a strongly male plant. The sequence of SEQInDel-F077 is GTCAAAAGAC; the sequence of SEQInDel-F862 is CACGACGTTGGAGGC.

7. A reagent kit, characterized in that, The kit contains the primers as described in claim 3 or 5.

8. The application of the reagent kit as described in claim 7 in the sex identification of bitter gourd seedlings.

Images