Application of cassava common mosaic virus TGBp1 in inhibiting RNA silencing

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to application of a cassava common mosaic virus TGBp1 in inhibiting RNA silencing. Research finds that TGBp1 has a silent inhibition function and can inhibit mRNA (messenger ribonucleic acid) of GFP (green fluorescent protein) from being degraded, so that the expression quantity of GFP protein is increased; the TGBp1 is also found to possibly inhibit the target gene MeGRXC3 from being silenced so as to improve the expression function of the target gene MeGRXC3; in addition, it is found that TGBp1 can increase the number of particles of an arabidopsis thaliana mRNA degradation pathway processing body (a compound formed by interaction of Dcp1 protein and Dcp2 protein), and research results not only lay a foundation for clarification of TGBp1 functions, but also provide a new target gene for cassava breeding for disease resistance.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of cassava mosaic virus TGBp1 in inhibiting RNA silencing. Background Technology

[0002] Viruses are obligate parasites and must evade or tolerate various antiviral defense mechanisms of host cells to successfully infect. How viruses evade or tolerate host post-transcriptional gene silencing (PTGS) and other immune defense mechanisms to enhance pathogenicity has been a research hotspot in recent years, and significant progress has been made. PTGS is a conserved gene expression regulatory mechanism in eukaryotes, playing a crucial role not only in developmental regulation, metabolism, maintaining genome stability, and responding to biotic and abiotic stresses, but also as an important antiviral immune mechanism. During plant evolution, multiple antiviral PTGS signaling pathways have been developed, involving different proteins with different functions but some overlap. Since viruses are obligate parasites, they must evade or tolerate host cell degradation to successfully infect. Most plant viruses have co-evolved with plants to produce one or more viral suppressors of RNA silencing (VSRs) to counteract the antiviral immune function of host PTGS. VSRs from different viruses are not homologous in sequence and have no structural similarity, so their modes of action and mechanisms of action are also different.

[0003] Cassava (Manihot esculenta) is a perennial crop belonging to the Euphorbiaceae family, mainly cultivated in tropical and subtropical countries and regions. It is the world's sixth largest food crop and is grown in many provinces (regions) in southern and central my country. Related industries occupy an important position in the agricultural economy. Cassava mosaic virus disease is devastating to the cassava industry, causing a loss of 25 million tons of cassava yield globally each year. Cassava common mosaic virus (CsCMV) belongs to the Potexvirus genus of the Alphaflexiviridae family. CsCMV was first reported in southern Brazil and is widespread in Latin America. CsCMV exhibits typical molecular characteristics of Potexviruses, being a monoid, positive-sense ssRNA (+) curved virus with a particle size of approximately 15 nm × 495 nm. The genome is approximately 6.4 kb in size, with a cap structure at the 5′ end and a poly(A) tail at the 3′ end, producing three subgenomic RNAs (sgRNAs) and containing five open reading frames (ORFs): ORF1 at the 5′ end encodes a 165 kD RNA-dependent RNA polymerase (RdRp), essential for viral replication; the three middle ORFs, ORF2, ORF3, and ORF4, encode three overlapping triple gene block proteins (TGBs): TGBp1 (25 kD), TGBp2 (12 kD), and TGBp3 (10 kD); and ORF5 at the 3′ end encodes a 24 kD coat protein (CP). ORF1 is directly synthesized from viral genomic RNA, while the other ORFs are translated from sgRNAs. Studies have shown that RdRp is the only viral protein absolutely required for viral replication, while TGBp1-3 and CP are essential for viral intercellular or long-distance movement. It remains unclear whether TGBp1 has a silencing or inhibitory function. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide the application of cassava mosaic virus TGBp1 in inhibiting RNA silencing.

[0005] The first aspect of the present invention is to provide the use of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector or host bacterium containing the coding region of the TGBp1 gene in plants for inhibiting GFP silencing and / or increasing GFP expression, wherein the nucleotide sequence of the TGBp1 gene is as shown in SEQ ID NO:1.

[0006] Furthermore, the plant in question is a 16C transgenic Nicotiana sapiens.

[0007] A second aspect of the present invention is to provide the use of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector or host bacterium containing the coding region of the TGBp1 gene in inhibiting GFP degradation, increasing its expression, and / or increasing the accumulation of GFP protein levels; wherein the nucleotide sequence of the TGBp1 gene is as shown in SEQ ID NO:1.

[0008] A third aspect of the present invention is to provide the TGBp1 gene, or the protein encoded by the TGBp1 gene, or the TGBp1 gene coding region thereof, to enhance the expression of the target gene MeGRXC3 when it is silenced, the nucleotide sequence of MeGRXC3 being shown in SEQ ID NO:2.

[0009] A fourth aspect of the present invention is to provide the use of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector or host bacterium containing the coding region of the TGBp1 gene in increasing the number of processed products, wherein the nucleotide sequence of the TGBp1 gene is as shown in SEQ ID NO:1, the processed product is a complex formed by the interaction of Dcp1 protein and Dcp2 protein, the nucleotide sequence of the gene encoding the Dcp1 protein is as shown in SEQ ID NO:3, and the nucleotide sequence of the gene encoding the Dcp2 protein is as shown in SEQ ID NO:4.

[0010] This invention reveals that TGBp1 possesses a silencing and repressive function, inhibiting the degradation of GFP mRNA and thereby increasing GFP protein expression. It also demonstrates that TGBp1 may inhibit the silencing of the target gene MeGRXC3, thus enhancing its expression. Furthermore, TGBp1 increases the number of Arabidopsis mRNA degradation pathway processing organism (a complex formed by the interaction of Dcp1 and Dcp2 proteins) particles. These findings not only lay the foundation for elucidating the function of TGBp1 but also provide a new target gene for cassava disease resistance breeding. Attached Figure Description

[0011] Figure 1Fluorescence expression of transgenic 16C *Nicotiana benthamiana* co-infiltrated by *Agrobacterium* with single-chain green fluorescent protein (pG1300) and TGBp1 expression vector. pG1300: plant expression vector pG1300 expressing GFP; CP-StHA: plant expression vector pCP-StHA expressing CP-StHA; TGBp1-StHA: plant expression vector pTGBp1-StHA expressing TGBp1-StHA; StHA: plant expression vector p1300-StHA expressing Ster and HA tags; 16C: transgenic *Nicotiana benthamiana* overexpressing GFP; 5 dpa: day 5 after *Agrobacterium* injection.

[0012] Figure 2 Western blot was used to detect the GFP protein accumulation level in *Nicotiana benthamiana* leaves after 5 dpa of pG1300 inoculated with CP-StHA, empty vector StHA, and TGBp1-StHA, respectively. pG1300: plant expression vector expressing GFP; CP-StHA: plant expression vector pCP-StHA expressing CP-StHA; TGBp1-StHA: plant expression vector pTGBp1-StHA expressing TGBp1-StHA; StHA: plant expression vector p1300-StHA with only Ster and HA tags; 16C: transgenic *Nicotiana benthamiana* overexpressing GFP; 5 dpa: 5 days after Agrobacterium injection; α-GFP: GFP antibody; CBB: Coomassie brilliant blue staining.

[0013] Figure 3 The effect of TGBp1 on GFP mRNA expression was detected by RT-qPCR. GFP: GFP mRNA; CP-StHA: plant expression vector pCP-StHA expressing CP-StHA; TGBp1-StHA: plant expression vector pTGBp1-StHA expressing TGBp1-StHA; StHA: plant expression vector p1300-StHA with only Ster and HA tags.

[0014] Figure 4 Western blot was used to detect the GFP protein accumulation level in *Nicotiana benthamiana* leaves after 3 days of infiltration with YNs-MeGRXC3, empty vector, and TGBp1-Flag, respectively. YNs-MeGRXC3: plant expression vector expressing YNs-MeGRXC3; EV: plant expression vector p1300-Flag expressing only the Flag tag; TGBp1-Flag: plant expression vector pTGBp1-Flag expressing TGBp1-Flag; 3 days: 3 days after *Agrobacterium* injection; α-GFP: GFP antibody; CBB: Coomassie brilliant blue staining.

[0015] Figure 5To enhance the formation of TGBp1 processing bodies in the Arabidopsis mRNA degradation pathway. A. Confocal microscopy observation; B. Processor count. YN-Dcp1: Fluorescent bimolecular plant expression vector pYN-Dcp1 expressing Arabidopsis Dcp1; Dcp2-YC: Fluorescent bimolecular plant expression vector Dcp2-YC1 expressing Arabidopsis Dcp2; TGBp1: Plant expression vector pTGBp1-StHA expressing TGBp1; EV: Empty vector p1300-StHA. Detailed Implementation

[0016] The present invention will be further described below with reference to the accompanying drawings and specific embodiments to better understand the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0017] 1 plant material

[0018] 16C transgenic N. benthamiana (Qu, F., Ren, T., & Morris, TJ(2003). The coat protein of turnip crinkle virus suppressesposttranscriptional gene silencing at an early initiation step. Journal of virology, 77(1), 511–522.).

[0019] 2 Experimental Methods and Results

[0020] 2.1 Construction of plant expression vectors

[0021] (1) The construction method of the empty vector p1300-StHA is as follows:

[0022] The target fragment StHA-XbaI & SacI (specific sequences are shown in Table 1) was synthesized and double-digested with XbaI and SacI, and then ligated with the double-digested pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166). The positive clone was identified by sequencing and named p1300-StHA.

[0023] (2) The construction method of the plant expression vector pCP-StHA is as follows:

[0024] Using AD-CP (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166) as a template, the known silencing suppressor TCV CP (Qu, F., Ren, T., & Morris, TJ (2003). The coat protein of turnip crinkle virus suppresses posttranscriptional gene silencing at an early initiation step. Journal of virology, 77(1), 511–522.) was amplified using primers CP-1F Xba and CP-1053RBamHI (specific sequences are shown in Table 2). The reaction system is as follows:

[0025]

[0026] The reaction procedure is as follows:

[0027]

[0028] The amplified product was double-digested with XbaI and BamHI and ligated with the p1300-StHA fragment that had been double-digested with the same enzymes. The positive clone was identified by sequencing and named pCP-StHA.

[0029] (3) The construction method of the plant expression vector pTGBp1-StHA is as follows:

[0030] The target fragment TGBp1-XbaI & BamHI (specific sequences are shown in Table 1) was artificially synthesized by Shanghai Sangon Biotech Co., Ltd., with restriction endonucleases XbaI and BamHI added to both ends respectively. After double digestion with XbaI and BamHI, the target fragment was ligated to the p1300-StHA fragment, which had been digested with the same enzymes. The positive clone was identified by sequencing and named pTGBp1-StHA.

[0031] (4) The method for constructing the empty vector p1300-Flag is as follows:

[0032] The target fragment Flag-XbaI & SacI (specific sequences are shown in Table 1) was artificially synthesized by Shanghai Sangon Biotech Co., Ltd., and double-digested with XbaI and SacI and ligated with a large fragment of pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnipcrinkle virus-encoded suppressor of RNA silencing interacts with ArabidopsisSGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166). The positive clone was identified by sequencing and named p1300-Flag.

[0033] (5) The construction method of the plant expression vector p1300-TGBp1-Flag is as follows:

[0034] Using the successfully constructed pTGBp1-StHA as a template, TGBp1 was amplified using primers TGBp1-1F SpeI and TGBp1-780RKpnI (specific sequences are shown in Table 2). The reaction system is as follows:

[0035]

[0036] The reaction procedure is as follows:

[0037]

[0038] The amplified product was double-digested with SpeI and KpnI and ligated with the p1300-Flag fragment that had been double-digested with the same enzymes. The positive clone was identified by sequencing and named p1300-TGBp1-Flag.

[0039] (6) The construction method of the plant expression vector YNs-MeGRXC3 is as follows:

[0040] The target fragment MeGRXC3-MluI & SacI (specific sequences are shown in Table 1) was artificially synthesized by Shanghai Sangon Biotech Co., Ltd., and double-digested with Mlu and SacI and ligated with a large fragment of p1300-YN1 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166). The positive clone was identified by sequencing and named YNs-MeGRXC3.

[0041] Table 1 Target Fragment Sequence

[0042] Segment Name Sequence (5′–3′) StHA-XbaI & SacI <![CDATA[ TCTAGA TGGAGCCACCCGCAGTTCGAAAAAGGTGGAGGTTCTGGCGGTGGATCGGGAGGTTCAGCGTGGAGCCACCCGCAGTTCGAGAAAGGTGCTTCTGGTGAAGGTTACCCATACGATGTTCCTGACTATTAA G AGCTC ]]> Flag-BamHI & SacI GGATCCACGCGTATGgactacaaggacgacgatgacaaggattacaaagatgacgacgataaggactataaggacgatgatgataaatagTAAGAGCTC TGBp1-XbaI & BamHI <![CDATA[ TCTAGA ATGAGAAGAGGTGCCTATACCCCCCGTTCTACTCCATTCTCTCGTGACCGGAGATCGTATAATGCCGGTAAGGGTAGATCATTTCGTTCTTACCGTCGTCGTGGACCTGTTCGTCCATTAGTTCGTCGGAACCTGTTTGGTGATGACCATGCACGTGCATTTACGTATAAGACCGTATCGGAGGATCAATTTGGACCGGATTTTACCATACATAATAATAATTATAAGTCATCGTATATATCTATGCCTGCCAAAACACGTGCCCTTAGCGATAACAGGGTAGGTGATTATATCAAACTTGTAAATATATCATTTACAGGTACAGTGTGTATTAAAAACAGCCAGATGGAATCTGACGGAAGCCCAATGTTGGGCCTGCATGGGCTGTTTACTTGTGTATTGGTCCGGGATAAGACCCCTCGTATATATTCTGCCACTGAGCCTTTGATACCTTTCCCACAGTTGTTTGGGTCCATAAACGCGAGCTATGCGGATTTGTCTATACAAGACCCATATAAGGATCGGTTCACAGTTATCCGTCAGGTGTCTTACCCAGTTAATACGGAGAAGGGTGATCATATGTGTCGTTTCAAAGGCACTCGACGTTTTGTTGGTAGATACCCTATCTGGACTAGTTTTAAAGATGATGGTGGCATTGGAGATTCATCGGGATTATATAGTAATACGTATAAAAATGCCATACTTGTATATTATGTATGGCTCAGCGACGTATCGTCACAATTGGAAATGTATTGTAAATATGTAACTCGATATATTGGT GGATCC ]]> MeGRXC3-MluI & SacI <![CDATA[ ACGCGT GACGCAGTGACAAGAATGGTTGCAGAGAGACCACTGGTGATCTTCAGCAGGAGCACCTGTGACATGTGCCACTCCATTAAGACACTGATACTTGGATTTGGAGCAAATCCTACAATCTATGAGCTTGATCAAATTCCGAACGGCCAGCAAATTGAAAGAGCATTGCAGCAGCTAGGGTGCCAGAACTTACCAGCAGTATTCATAGGGGGCGAGTGTGTGGGTGGTGACAGGCAAGTCATGAGCTTACTGCTGAAGAACCAGTTAGGCCCATTGCTAAAGAGGGCTGGTGCCATATGGGTCTGGAATGATGGTACCGGATCCTGGAGCCACCCGCAGTTCGAAAAAGGTGGAGGTTCTGGCGGTGGATCGGGAGGTTCAGCGTGGAGCCACCCGCAGTTCGAGAAATAA GAGCTC ]]>

[0043] Table 2 Primers used

[0044] Primer name sequence CP-1F XbaI <![CDATA[ TCTAGA ATGGAAAATGATCCTAGAGTC]]> CP-1053RBamHI <![CDATA[ GGATCC CCCGGGAATTCTGAGTGCTTGCCATTTAC]]> TGBp1-1F SpeI <![CDATA[ ACTAGT ATGAGAAAGGTGCCTATAC]]> TGBp1-780R KpnI <![CDATA[ GGTACC ACCAATATATCGAGTTACATA]]> qNbActin-128F AAAGACCAGCTCATCCGTGG qNbActin-256R CCAGCAGCTTCCATTCCGAT qsGFP-306F GGACGACGGCAACTACAAGA qsGFP-519R TTCGATGTTGTGGCGGATCT

[0045] 2.2 Observation of TGBp1 silencing and inhibitory function

[0046] The single-stranded green fluorescent protein expression vector pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 toenhance virus infection. Molecular plant pathology, 24(2), 154–166) was preserved in our laboratory.

[0047] (1) Recombinant plasmid was transformed into Agrobacterium (GV3101) competent cells

[0048] Following the instructions for use of GV3101 Chemically Competent Cell, plant expression vectors pG1300, p1300-StHA, pCP-StHA, and pTGBp1-StHA were transformed into Agrobacterium GV3101 competent cells. After transformation, the resuspended bacterial blocks were evenly spread onto LB agar plates containing Kan and Rif, and incubated upside down at 28°C for 72-90 h. After 2-3 days, when Agrobacterium colonies reached 2-3 mm in size, single colonies were selected for PCR identification.

[0049] (2) Infiltration of transgenic 16C tobacco

[0050] The Agrobacterium resuspension of the recombinant vector was mixed and injected into the transgenic 16C tobacco leaves. The operation steps are as follows:

[0051] (a) Use a pipette tip to pick up a single colony that has been identified as positive by colony PCR and put it into 5 ml of LB liquid medium containing the corresponding antibiotic. Incubate overnight at 28°C with shaking on a constant temperature shaker at 200 r / min.

[0052] (b) Centrifuge the bacterial culture at 7000 rmp / min for 15 min and discard the supernatant.

[0053] (c) Prepare injection buffer: Take 2 mL of 1 mol / L MgCl2, 2 mL of 1 mol / L MES and 200 μL of 100 mg / mL AS respectively, and finally make up to 200 mL with ultrapure water.

[0054] (d) Resuspend the bacterial precipitate in 5 mL of injection buffer, vortex thoroughly until homogeneous, and measure the OD600 value of the bacterial solution. Dilute the bacterial solution to adjust the OD600 to 0.5.

[0055] (e) After the diluted bacterial solution is left at room temperature for 2-3 hours, it is mixed with the solution at a 1:1 volume ratio according to the required mixing system (see Table 3 for specific combinations).

[0056] (f) Take vigorous, 5-7 leaf stage transgenic 16C Nicotiana benthamiana and inject it into the best-growing leaves using a 1 mL syringe, injecting about 2 cm of the leaf. 2 Within the specified range, all combinations were injected onto the same leaf, 10 leaves were injected, and the injected Nicotiana Bunsenata was treated in the dark overnight, and then cultured under normal conditions.

[0057] (g) On day 5 post-injection, using a handheld fluorescent protein observation lamp (LUYOR-3415RG) and wearing LUV-30A yellow glasses, the expression of GFP fluorescence in each combination was observed under blue excitation light (495 nm), and photographs were taken. After taking the photos, the tobacco infection area was circled with a marker.

[0058] Table 3. Combinations of Agrobacterium with different plasmids injected with 16C-Nicotiana Bunseni.

[0059] Group Recombinant plasmid Combination 1 p1300-StHA + pG1300 Combination 2 pCP-StHA + pG1300 Combination 3 pTGBp1-StHA + pG1300

[0060] The results are as follows Figure 1 As shown, leaves co-infiltrated with pG1300 and pCP-StHA or pTGBp1-StHA exhibited strong GFP fluorescence, while tobacco leaves co-injected with p1300-StHA showed only weak fluorescence. It is preliminarily determined that TGBp1 has a silencing and inhibitory function, similar to the known silencing repressor CP (SEQ ID NO:5), and can enhance GFP expression.

[0061] 2.3 Detection of TGBp1 silencing and suppression function

[0062] 2.3.1 On day 5, total protein and RNA were extracted from tobacco leaves of the different injection combinations mentioned above, and Western blotting (WB) and RT-qPCR were performed to verify the fluorescence observation results. The specific methods are as follows:

[0063] (1) Plant total protein extraction and Western Blot reference (Liu Linyu's master's thesis "Cassava mosaic virus silencing repressor AC4 hijacks UPF1 to promote virus infection").

[0064] The results are as follows Figure 2As shown, after co-infiltration with pG1300 and pTGBp1-StHA (TGBp1-StHA) or pCP-StHA (CP-StHA), the GFP expression level increased by 1.54 and 2.65 times, respectively, compared with the sample co-infiltrated with the empty vector p1300-StHA (StHA). Rubiso Coomassie Brilliant Blue (CBB) staining showed that the sample loading amount was basically the same. Western blotting results further confirmed the fluorescence observation results, indicating that TGBp1, like the known viral silencing repressor CP, has a silencing and inhibitory function, which can enhance GFP expression.

[0065] (2) Extraction of total RNA from plant leaves and detection of relative GFP expression by real-time quantitative PCR (RT-qPCR)

[0066] Total RNA was extracted from tobacco according to the instructions of TRNzol Universal Total RNA Extraction Reagent from Tiangen Biotech. Then, following the instructions of the reverse transcription kit, a two-step reverse transcription method was used to reverse transcribe the RNA sample. Using the obtained cDNA sample as a template, qNbActin-128F and qNbActin-256R were used as internal control primers, and qsGFP-306F and qsGFP-519R were used as GFP detection primers for real-time quantitative PCR. Results are as follows: Figure 3 As shown, the expression levels of GFP mRNA co-expressed with TGBp1 or the known silencing repressor CP were significantly increased, indicating that the increased GFP protein expression levels co-expressed with TGBp1 or the known silencing repressor CP were induced by the increased GFP mRNA expression levels. This result demonstrates that TGBp1, like the known silencing repressor CP, possesses a silencing and repressive function.

[0067] 2.3.2 To further verify the silencing effect of TGBp1, the plant expression vector with streptomycin tag was used in 2.2(2) to co-infiltrate wild-type Nicotiana Bunsenata leaves with the empty vector p1300-Flag (EV) or p1300-TGBp1-Flag (TGBp1-Flag). Proteins were extracted on the 3rd day after injection and Western blot analysis was performed using Strep and Flag antibodies. The results are as follows: Figure 4 Strep antibody assay results showed that, compared with samples co-infiltrated with the empty vector, the expression level of YNs-MeGRXC3 increased by 4.95 times after co-infiltration with p1300-TGBp1-Flag. Figure 4 The results of the Flag antibody assay showed that TGBp1 was expressed, and Coomassie Brilliant Blue staining indicated that the loading amount was basically consistent. These results further demonstrate that MeGRXC3 expression was significantly increased on day 3 post-injection.

[0068] 2.4 TGBp1 enhances the formation of Arabidopsis mRNA degradation pathway processing units

[0069] 2.4.1 Plant expression vectors YN-Dcp2 and Dcp1-YC (Wu, K., Xie, Q., Liu, X., Fu, Y., Li, S., Yu, X., Li, W., Zhao, P., Ren, Y., Ruan, M., & Zhang, X. (2025). Capsid protein of turnip crinkle virus suppresses antiviral RNA decay by degrading Arabidopsis Dcp1 via ubiquitination pathway. The Plant journal :for cell and molecular biology, 121(5), e70075.) were preserved in our laboratory.

[0070] 2.4.2 To further verify the silencing effect of TGBp1, we used a fluorescence bimolecular complementarity experiment and observed the fluorescent particles formed by the interaction between Dcp1 and Dcp2 using a confocal microscope to study whether TGBp1 has an inhibitory silencing effect on Dcp1 and Dcp2. The specific method is as follows: First, the expression vector Agrobacterium was transformed using the method in 2.2.1(1); second, the recombinant plasmids of the two combinations in Table 4 were injected into wild-type Nicotiana Bunsenata for expression, referring to the method in 2.2.1(2); then, on the third day after injection, approximately 1-2 cm of each sample was taken. 2 The fluorescence of tobacco cells was observed using a laser confocal microscope (Olympus FV3000) with GFP excitation light at 488 nm, and protein extraction and Western blot analysis were performed.

[0071] The results are as follows Figure 5 As shown in Figure A, the number of fluorescent particles in the processed form co-expressed with p1300-TGBp1-Flag was significantly higher than that in tobacco leaves co-injected with the empty vector p1300-Flag. Figure 5 Statistical data on the B-processor showed that the number of processing units in tobacco leaves co-injected with the empty vector p1300-StHA was significantly reduced compared to those co-expressed with pTGBp1-StHA. This result further demonstrates that TGBp1 has a silencing and inhibitory function.

[0072] Table 4 Combinations of Agrobacterium plasmids injected with wild-type Nicotiana Bunsenium

[0073] Group Recombinant plasmid Combination 1 pYN-Dcp2 + pDcp1-YC + p1300-Flag Combination 2 pYN-Dcp2 + pDcp1-YC + p1300-TGBp1-Flag

[0074] RNA silencing, a phenomenon found in eukaryotes, refers to the suppression of target gene expression in a sequence-specific manner mediated by small RNAs (21-30 nt). In plants, besides regulating growth and development, RNA silencing also plays a crucial role in resisting viral invasion. Because viruses are obligate parasites, they have co-evolved with plants over a long period, developing viral silencing repressors to interfere with and disrupt different stages of the RNA silencing pathway. When breeding transgenic virus-resistant crops, a key gene sequence of a viral silencing repressor can be transferred into the plant, allowing the plant to continuously produce siRNA targeting the virus. This enables the plant to proactively activate the RNAi mechanism to eliminate the virus once it invades. Furthermore, gene editing or transgenic technology can be used to modify host proteins in plants that interact with viral silencing repressors, enhancing the affinity between host proteins and viral silencing repressors. This allows host proteins to more efficiently "capture" a wider variety of viral silencing repressors; therefore, even if the virus mutates, its repressors are easily recognized, thus broadly activating the disease resistance response. Alternatively, the function of host proteins can be altered by optimizing the combination of the parts of the host protein responsible for "disease resistance signal transduction" with the parts responsible for "binding repressors," creating new disease resistance genes. Once the viral repressor enters the cell, it acts like an "alarm switch," immediately triggering a strong defensive response. This invention discovered that TGBp1 has a silencing and repressive function, inhibiting the degradation of GFP mRNA and thus increasing GFP protein expression; it also found that TGBp1 may inhibit the silencing of the target gene MeGRXC3, thereby increasing its expression; furthermore, it was found that TGBp1 can increase the number of Arabidopsis mRNA degradation pathway processing organisms (complexes formed by the interaction of Dcp1 and Dcp2 proteins). Therefore, this invention not only lays the foundation for elucidating the function of TGBp1 but also provides a new target gene for cassava disease resistance breeding.

[0075] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to this invention are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. The application of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector, host bacterium, or expression cassette containing the coding region of the TGBp1 gene, in inhibiting GFP silencing and / or increasing GFP expression in plants, wherein, The nucleotide sequence of the TGBp1 gene is shown in SEQ ID NO:

1.

2. The application as described in claim 1, characterized in that, The plant in question is a 16C transgenic Nicotiana sapiens.

3. The application of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector, host bacterium, or expression cassette containing the coding region of the TGBp1 gene, in inhibiting GFP degradation, increasing its expression, and / or increasing the accumulation of GFP protein levels, wherein, The nucleotide sequence of the TGBp1 gene is shown in SEQ ID NO:

1.

4. The function of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector, host bacterium, or expression cassette containing the coding region of the TGBp1 gene in enhancing the expression of the target gene MeGRXC3 by suppressing its silencing, wherein, The nucleotide sequence of the TGBp1 gene is shown in SEQ ID NO:1, and the nucleotide sequence of the MeGRXC3 gene is shown in SEQ ID NO:

2.

5. The use of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector or host bacterium containing the coding region of the TGBp1 gene, in increasing the amount of processed organisms, wherein, The nucleotide sequence of the TGBp1 gene is shown in SEQ ID NO:

1. The processed form is a complex formed by the interaction of Dcp1 and Dcp2 proteins. The nucleotide sequence of the gene encoding Dcp1 protein is shown in SEQ ID NO:3, and the nucleotide sequence of the gene encoding Dcp2 protein is shown in SEQ ID NO:4.

Images