Application of tomato SlCPK3 gene in improvement of low-temperature resistance of tomato and method for improving low-temperature resistance of tomato
By knocking out the SlCPK3 gene in tomatoes, cold-resistant plants were constructed using CRISPR/Cas9 technology, solving the problem of slow growth in tomatoes at low temperatures and achieving significant improvement in low-temperature resistance and enhanced expression of cold-resistant genes.
Patent Information
- Application Number
- CN202511484129.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-17
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2045-10-17
AI Technical Summary
Tomatoes suffer from slowed growth, reduced yield, and deteriorated quality under low-temperature stress. Current technologies have failed to effectively elucidate the physiological and molecular mechanisms by which tomatoes respond to low-temperature stress, especially the role of the SlCPK3 gene in low-temperature stress, which has not been studied.
By knocking out the SlCPK3 gene in tomatoes using gene knockout technology, constructing sgRNA using a CRISPR/Cas9 vector and introducing it into host cells, screening and propagating gene-edited plants resistant to low temperatures, the low-temperature resistance of tomatoes can be improved.
It significantly improved the low-temperature resistance of tomatoes, manifested by a decrease in relative electrical conductivity, an increase in maximum photochemical quantum yield of PSII, and an improvement in survival rate. It also promoted the expression of key cold-resistance genes SlCBF1/SlCBF2/SlCBF3, thereby enhancing the plant's ability to adapt to low temperatures.
Smart Images

Figure CN120944957A_ABST
Abstract
Description
Technical Field
[0001] This application relates to the technical fields of genetic engineering, molecular biology and plant physiology, and in particular to a tomato SlCPK3 Application of genes in improving the low-temperature resistance of tomatoes and methods to improve the low-temperature resistance of tomatoes. Background Technology
[0002] tomato( Solanumlycopersicum Tomato (L.) is an important vegetable crop in my country's greenhouse agriculture. As a warm-loving plant, its optimal growth temperature range is 20-28℃, and low-temperature injury severely inhibits its growth and development. Greenhouse tomato cultivation in my country is mainly concentrated in winter and spring. However, frequent extreme weather events globally, coupled with the generally low level of equipment and weak environmental temperature control capabilities in domestic greenhouse production, lead to frequent low-temperature injury during greenhouse tomato production, resulting in slow plant growth, reduced yield, and deteriorated quality. Therefore, in-depth analysis of the physiological and molecular mechanisms of tomato response to low-temperature stress is of great significance. By revealing the mechanisms of plant low-temperature tolerance and identifying key regulatory genes, it is hoped that the low-temperature resistance of tomatoes can be improved, thereby effectively reducing the economic losses caused by low-temperature injury.
[0003] Calcium-dependent protein kinases (CPKs, CDPKs) belong to the serine / threonine protein kinase family and consist of a protein kinase domain, a self-inhibition domain, and a CaM-like domain. Numerous studies have shown that CPKs play a crucial role in plant perception and response to stress. In Arabidopsis, AtCPK4 and AtCPK11 play important roles in the ABA signaling response (Zhu SY et al., Two calcium-dependent protein kinases, AtCPK4 and CPK11, regulate abscisic acid signal transduction in Arabidopsis. Plant Cell. 2007, 19, 3019-36), while AtCPK32 affects the Arabidopsis response to temperature (Li Xidong, Research on the mechanism by which calcium-dependent protein kinase CPK32 regulates flowering time in Arabidopsis). AtCPK3 is rapidly activated by low-temperature stress, thereby triggering the CaM-like reaction. 2+Influx (Ming Y et al., Coordinated control of calcium signaling by CPK3 and CaM2 via CNGCs in response to cold stress in Arabidopsis. Dev Cell. 2025, S1534-5807(25)00375-2). AtCPK28 positively regulates antifreeze (Ding Y et al., CPK28-NLP7 module integrates cold-induced Ca 2+ Signal and transcriptional reprogramming in Arabidopsis. Sci Adv. 2022, 8, eabn7901). Previous studies have shown that cold stress induces... OsCPK7 and OsCPK24 The expression of (Saijo Y et al., Over-expression of a single Ca 2+ Calcium-dependent protein kinase confers both cold and salt / drought tolerance on rice plants. Plant J. 2000, 23, 319-27; Liu Y et al., The calcium-dependent kinase OsCPK24 functions in cold stress responses in rice. J Integr Plant Biol. 2018, 60, 173-188. In maize, knocking out ZmCPK17 significantly enhances plant cold resistance (Zeng R et al., A natural variant of COOL1 gene enhances cold tolerance for high-latitude adaptation in maize. Cell. 2025, 188, 1315-1329). Low temperature significantly induces... ZmCPK1 The expression of [something], overexpression in Arabidopsis thaliana. ZmCPK1Significantly reduces plant cold resistance (Weckwerth P et al., ZmCPK1, a calcium-independent kinase member of the Zea mays CDPK gene family, functions as a negative regulator in cold stress signalling. Plant Cell Environ. 2015, 38, 544-58). In tomatoes, SlCPK27 positively regulates cold resistance and participates in cold acclimation (Lin R et al., CPK27 enhances cold tolerance by promoting flavonoid biosynthesis through phosphorylating HY5 in tomato. New Phytol. 2025, 246, 2174-2191; Lv X et al., The role of calcium-dependent protein kinase in hydrogen peroxide, nitric oxide and ABA-dependent cold acclimation. J Exp Bot. 2018, 69, 4127-4139). Numerous studies have shown that the CBF pathway plays an important role in tomato's resistance to cold stress. SlCBF1 / 2 / 3 These are key genes for cold resistance in tomatoes (Wang F et al., Phytochrome A and B Function Antagonistically to Regulate Cold Tolerance via Abscisic Acid-Dependent Jasmonate Signaling. Plant Physiol. 2016, 170, 459-71; Song J et al., SlMPK1- and SlMPK2-mediated SlBBX17 phosphorylation positively regulates CBF-dependent cold tolerance in tomato. New Phytol. 2023, 239, 1887-1902). However, tomatoes... SlCPK3 Genes and their Arabidopsis homologs ( AtCPK26 / 5 / 6 The role of [certain substances] in low-temperature stress has not yet been reported in studies. SlCPK3 The function of genes in tomatoes' resistance to low-temperature stress is of great significance for breeding low-temperature tolerant tomato varieties. Summary of the Invention
[0004] Therefore, the purpose of this application is to provide a tomato SlCPK3 Application of genes in improving the low-temperature resistance of tomatoes and methods to improve the low-temperature resistance of tomatoes.
[0005] According to a first aspect of the embodiments of this application, a tomato is provided. SlCPK3 The application of genes in improving the low-temperature resistance of tomatoes involves using gene knockout technology to eliminate genes in tomatoes that have been shown to be low-temperature resistant. SlCPK3 The gene enhances the tomato's resistance to low temperatures. SlCPK3 The coding sequence of the gene is shown in SEQ ID NO.1. SlCPK3 The gene is identified as Solyc01g112250 in the tomato genome database at http: / / solgenomics.net / .
[0006] According to a second aspect of the embodiments of this application, a method for improving the low-temperature resistance of tomatoes is provided, the method comprising: Using gene knockout technology to eliminate the gene knockout mechanism in tomatoes SlCPK3 The gene enhances the tomato's resistance to low temperatures. SlCPK3 The coding sequence of the gene is shown in SEQ ID NO.1.
[0007] The specific ways in which the method described in this invention improves the low-temperature resistance of tomatoes include a decrease in relative conductivity and an increase in the maximum photochemical quantum yield of PSII (PSII). Fv / Fm Improved survival rate and key cold-resistance genes SlCBF1 / SlCBF2 / SlCBF3 An increase in the amount of expression.
[0008] Optionally, the SlCPK3 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2.
[0009] Optionally, the gene knockout technology is specifically as follows: In tomatoes SlCPK3 The protein-coding region of the gene was selected from the target fragment containing the PAM motif adjacent to the pre-intermediate region sequence. Based on the first 20 bases of the target fragment, corresponding primers were designed to construct a CRISPR / Cas9 vector. The CRISPR / Cas9 vector was introduced into the host cell, and then used to infect the cotyledons of the target tomato. Positive gene-edited plants were screened, and the plants were propagated to homozygosity to obtain low-temperature resistant gene-edited plants.
[0010] Optionally, the nucleotide sequence of the first 20 bases is as shown in SEQ ID NO.3.
[0011] Optionally, the host cell is an Agrobacterium cell.
[0012] Optionally, the host cell is a GV3101 Agrobacterium cell.
[0013] The technical solutions provided by the embodiments of this application may include the following beneficial effects: As can be seen from the above embodiments, this application achieves its goal by modifying tomatoes... SlCPK3 Gene knockout plants were subjected to low-temperature treatment, and the results showed that at low temperatures... SlCPK3 Gene knockout plants exhibited a significantly cold-tolerant phenotype. This invention provides genetic resources for breeding new cold-tolerant tomato varieties, has high potential application value, and lays the foundation for studying the mechanisms by which tomato plants resist low-temperature stress. This invention is the first to utilize tomato... SlCPK3 Gene knockout plants were subjected to low-temperature treatment and it was found that... SlCPK3 This gene plays a negative regulatory role in the low-temperature stress tolerance of tomatoes; knocking out this gene significantly increases the low-temperature resistance of tomato plants. Verifying the biological function of this gene is of great significance for research on the molecular mechanisms of improving low-temperature resistance in tomatoes and for molecular design breeding.
[0014] It should be understood that the above general description and the following detailed description are exemplary and explanatory only, and do not limit this application. Attached Figure Description
[0015] The accompanying drawings, which are incorporated in and form part of this specification, illustrate embodiments consistent with this application and, together with the description, serve to explain the principles of this application.
[0016] Picture 1 For tomatoes SlCPK3 The nucleic acid sequences of the T2 generation (homozygous, without exogenous Cas9 fragments) of the gene knockout strain are used to identify the location and sequence of the sgRNA on the genome, and the PAM site is outlined with a box.
[0017] Picture 2 The tomato in Example 3 of this invention SlCPK3 Phenotype of gene knockout lines after low-temperature treatment.
[0018] Picture 3 The tomato in Example 3 of this invention SlCPK3 Relative electrical conductivity of gene knockout lines after low-temperature treatment.
[0019] Picture 4 The tomato in Example 3 of this invention SlCPK3 Maximum photochemical quantum yield of PSII in gene knockout lines after low-temperature treatment ( Fv / Fm ).
[0020] Picture 5 The tomato in Example 3 of this invention SlCPK3 Survival rate of gene knockout lines after low-temperature treatment.
[0021] Picture 6 Wild type and SlCPK3 Changes in the expression levels of key cold-resistance genes in gene knockout lines after 6 hours of low-temperature treatment, where A represents tomato. SlCBF1 The expression level of gene (Solyc03g026280), B represents tomato. SlCBF2 Expression level of gene (Solyc03g124110), C represents tomato SlCBF3 Expression level of gene (Solyc03g026270). Detailed Implementation
[0022] The present invention will be further described below with reference to specific embodiments, but the present invention is not limited to the following embodiments. The present invention is intended to cover other modifications and variations within the scope and spirit of the present invention.
[0023] Unless otherwise stated, the present invention will be practiced using conventional botanical techniques, tissue culture, molecular biology, biological physiology and biochemistry, DNA recombination, and bioinformatics techniques that are readily apparent to those skilled in the art. These techniques are fully explained in the literature.
[0024] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available. The experimental material used was the tomato cultivar Ailsa Craig. Solanumlycopersicum L.cv).
[0025] Example 1: Construction of SlCPK3 CRISPR / Cas9 gene knockout vector; Tomato SlCPK3 The full-length DNA sequence of the gene (Solyc01g112250) was analyzed (http: / / solgenomics.net / ). Using the CRISPR-P2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), the U6 promoter was selected for screening. SlCPK3 The specific sequence of the gene's sgRNA (single guide RNA) is shown in SEQ ID NO.3. SlCPK3 The CRISPR / Cas9 vector uses sgRNA from the exon of the gene itself. The sgRNA has one forward primer and one reverse primer for PCR to obtain fragments containing sgRNA. The forward primer of the sgRNA used in the vector is a universal forward primer. The PCR primer sequences are shown in Table 1. Picture 1 Indicating gRNA in tomatoes SlCPK3Genomic location and sequence. The specific construction process was as follows: using an tRNA vector as a template, target PCR was performed using KOD high-fidelity enzyme, and the PCR product was purified to a fragment size of approximately 200 bp. Fragment recombination was completed using the Golden Gate Assembly Kit (BsaIHFv2) (NEB, E1601). The recombination system included Golden Gate Assembly Mix, PHEE401 vector, target PCR purified product, and T4 DNA ligase buffer, with ddH2O added to a final volume of 20 μL. The PCR program settings followed the kit instructions. The recombinant product was heat-shocked into trans5α *E. coli* competent cells (TransGen, CD201). As described in the instructions, activation was performed at 37°C and 200 rpm for 1 h. After centrifugation and discarding the supernatant, the remaining 100–150 μL of liquid was resuspended and evenly spread onto solid LB medium containing 50 mg / L kanamycin, and incubated overnight at 37°C. Single-clone samples were selected and shaken. Positive clones were identified by colony PCR using universal M13-F and M13-R primers, followed by sequencing. Positive plasmids with correctly aligned sequences were named PHEE401-. SlCPK3 .
[0026] Table 1. PCR primer sequences for constructing CRISPR / Cas9 vectors:
[0027] Example 2: Tomato SlCPK3 Construction and Detection of Gene Editing Materials Gene-editing vectors were transformed into Agrobacterium GV3101 and infected with tomato cotyledons. Callus induction, hygromycin resistance induction differentiation, and rooting culture were then performed to obtain tissue culture seedlings. Positive results were verified using PCR and next-generation sequencing. slcpk3 Genetically edited plants were propagated for two generations until they were homozygous, and no Cas9 residues were found. slcpk3 #21 is missing one base. slcpk3 #22 is missing 2 bases.
[0028] Example 3: SlCPK3 Low-temperature resistance testing of gene-editing materials Wild-type tomato seedlings with five leaves and one heart and the SlCPK3 gene-edited line obtained in Example 2 were treated at 25℃ and 4℃ in an artificial climate incubator. After 7 days of low-temperature treatment, the low-temperature stress treatment group (4℃ treatment) was compared with the control group (25℃) under the same conditions without low-temperature treatment. The phenotype, electrical conductivity, and maximum photochemical quantum yield of PSII of the wild-type and gene-edited tomato plants were observed. Fv / FmThe changes in the PSII (photochemical quantum yield) were observed, and the survival rate was statistically analyzed after 3 days of recovery at 25℃ following 9 days of low-temperature treatment. Necrosis of the apical growing point was considered death. The method for determining the maximum photochemical quantum yield of PSII was as follows: tomato plants were dark-adapted for at least 30 minutes, and leaves from the same functional part were placed on a detection tray. The maximum photochemical quantum yield of PSII in tomatoes after 7 days of low-temperature treatment was measured using a chlorophyll fluorescence imaging spectrometer (IMAG-PAM, Germany). The relative conductivity was determined as follows: 0.2g of tomato leaves from the same functional part, avoiding the veins, was placed in a graduated centrifuge tube containing 20mL ddH2O and extracted in a shaker at 28℃ and 200rpm for 2 hours. The conductivity R1 of the extract was measured using a conductivity meter. The extract was then heated in a 95℃ hot water bath for 15 minutes, and the conductivity R2 was measured after cooling to room temperature. Relative conductivity = R1 / R2 × 100%.
[0029] The results showed that SlCPK3 Gene knockout tomato plants showed significantly less leaf wilting and were more upright than wild-type plants, indicating that... SlCPK3 Genes can significantly improve the low-temperature resistance of tomatoes. Picture 2 Secondly, SlCPK3 The relative electrical conductivity of gene knockout tomato plants was significantly lower than that of wild-type (WT) plants. Picture 3 This indicates that knocking out SlCPK3 Genetically modified tomato plants exhibit reduced cell membrane electrolyte permeability and enhanced low-temperature resistance. Furthermore, gene-edited plants... Fv / Fm ( Picture 4 The value was also higher than that of wild-type tomatoes (WT), indicating that the knockout... SlCPK3 After gene administration, the photoinhibition of photosystem II in tomato plants was significantly reduced at low temperatures. SlCPK3 The survival rate of gene knockout plants increased significantly. Picture 5 This indicates that knocking out SlCPK3 The gene significantly improved the low-temperature resistance of tomato plants. After 6 hours of treatment, RNA was extracted from leaves grown at 25℃ and 4℃, and reverse transcription was used for quantitative PCR. The results showed that, compared with the wild type, the key gene for cold resistance significantly improved the resistance of tomato plants. SlCBF1 ( Picture 6 A) SlCBF2 ( Picture 6 (B) SlCBF3 ( Picture 6 The transcriptional level of C) in SlCPK3 The significant increase in the number of genes knocked out in the leaves indicates that the knockout effect under low temperature stress was significant. SlCPK3 Genes can enhance cold resistance in tomato plants. SlCBF1 / 2 / 3 The gene expression level is increased, which in turn promotes SlCBF signal transduction and enhances the low-temperature resistance of tomatoes.
[0030] For RNA extraction, 0.2g of leaf sample was used. RNA was extracted using a total RNA extraction kit (Tiangen, DP419) according to the manufacturer's instructions via Trizol lysis. The RNA was then reverse transcribed into cDNA using a HiScript II QRT SuperMix (Vazyme Biotech, China). qRTPCR experiments were then performed using a 480II Real-Time PCR detection system (Roche, Swiss) and AceQ qPCR SYBR Green Master Mixkits (Vazyme Biotech, China). The qRTPCR reaction conditions were: 95℃ for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 30 s, for 40 cycles. Fluorescence data were collected at the end of the extension phase of each cycle. SlACTIN2 and SlUBI3 As an internal reference gene. Based on tomatoes SlCBF1 / 2 / 3 Gene sequence-specific primers: SlCBF1 Pre-primer: 5'GTCATCGTCGTTTTCTGAAG (SEQ ID NO.4); SlCBF1 Gene post-primer: 5'AACGGCCTCTTAATGCTAAA (SEQ ID NO.5); SlCBF2 Pre-primer: 5'TTCGATCGGAAGAAGTTTCA (SEQ ID NO.6); SlCBF2 Gene post-primer: 5'CAAGTAATCCTGGCATGGAA (SEQ ID NO.7); SlCBF3 Pre-primer: 5'CGCCGAAATCTTCCGACCT (SEQ ID NO.8); SlCBF3 Post-gene primer: 5'CGGCATGCAGAATAACGCTT (SEQ ID NO.9); Each experiment was repeated at least three times, and each biological replicate contained an independent sample consisting of a mixture of leaves from two different plants. All statistical analyses were performed using IBM SPSS Statistics 27 software. Picture 3-Picture 6 The lowercase letters a, b, and c indicate that the differences between different plants are significant at the 5% level. The statistical method used is Turkey's test.
[0031] The above results show that tomatoes SlCPK3 Genes negatively regulate the cold tolerance of plants. Knockout. SlCPK3 Genes can significantly enhance the low-temperature resistance of tomatoes.
[0032] Based on the above embodiments, the nucleotide sequence shown in SEQ ID NO.1 is mutated by gene editing technology by substituting, deleting and / or adding one or more nucleotides without changing the function of the original nucleotide sequence. Then, it is transformed into Agrobacterium, and then the transformed Agrobacterium is used to infect tomato cotyledons and plant tissue culture is carried out. Positive gene-edited plants are screened, and low-temperature resistant gene-edited tomatoes can also be obtained.
[0033] Based on the above embodiments, the nucleotide sequence with the same function obtained by hybridization with the sequence shown in SEQ ID NO.1 under strict conditions is mutated in tomatoes using gene editing technology, then transformed into Agrobacterium, and then the transformed Agrobacterium is used to infect tomato cotyledons and plant tissue culture is carried out. Positive gene-edited plants are screened, and low-temperature resistant gene-edited tomatoes can also be obtained.
[0034] Based on the above embodiments, nucleotide sequences that have more than 90% homology with nucleotide sequences of 1), 2), or 3) and encode the same functional protein are mutated in tomatoes using gene editing technology, then transformed into Agrobacterium, and then the transformed Agrobacterium is used to infect tomato cotyledons and plant tissue culture is carried out. Positive gene-edited plants are screened, and low-temperature resistant gene-edited tomatoes can also be obtained.
[0035] Although the present invention has been described in detail above with general descriptions and specific embodiments, the present invention is not limited to the above embodiments, and many modifications or improvements are possible, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention are within the scope of protection claimed by the present invention.
Claims
1. Tomato SlCPK3 The application of genes in improving the low-temperature resistance of tomatoes is characterized by, Using gene knockout technology to eliminate the gene knockout mechanism in tomatoes SlCPK3 The gene enhances the resistance of tomatoes to low temperatures. SlCPK3 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that, The SlCPK3 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.
2.
3. The application according to claim 1, characterized in that, The gene knockout technology is as follows: In tomatoes SlCPK3 The protein-coding region of the gene was selected from the target fragment containing the PAM motif adjacent to the pre-intermediate region sequence. Based on the first 20 bases of the target fragment, corresponding primers were designed to construct a CRISPR / Cas9 vector. The CRISPR / Cas9 vector was introduced into the host cell, and then used to infect the cotyledons of the target tomato. Positive gene-edited plants were screened, and the plants were propagated to homozygosity to obtain low-temperature resistant gene-edited plants.
4. The application according to claim 3, characterized in that, The nucleotide sequence of the first 20 bases is shown in SEQ ID NO.
3.
5. A method for improving the low-temperature resistance of tomatoes, characterized in that, The method is as follows: Using gene knockout technology to eliminate the gene knockout mechanism in tomatoes SlCPK3 The gene enhances the resistance of tomatoes to low temperatures. SlCPK3 The coding sequence of the gene is shown in SEQ ID NO.
1.
6. The method according to claim 5, characterized in that, The SlCPK3 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.
2.
7. The method according to claim 5, characterized in that, The gene knockout technology is as follows: In tomatoes SlCPK3 The protein-coding region of the gene was selected from the target fragment containing the PAM motif adjacent to the pre-intermediate region sequence. Based on the first 20 bases of the target fragment, corresponding primers were designed to construct a CRISPR / Cas9 vector. The CRISPR / Cas9 vector was introduced into host cells, and then used to infect the cotyledons of the target tomato. Positive gene-edited plants were screened to obtain gene-edited plants with relatively high low-temperature resistance.
8. The method according to claim 7, characterized in that, The gene-edited plants with relatively high low-temperature resistance enhance the key genes for cold resistance. SlCBF1 / SlCBF2 / SlCBF3 The level of gene expression can be increased, thereby enhancing the plant's resistance to low temperatures.
9. The method according to claim 7, characterized in that, The nucleotide sequence of the first 20 bases is shown in SEQ ID NO. 3.
Citation Information
Patent Citations
Application of SlCYP707A gene as negative regulatory factor in promotion of tomato mild hypothermia resistance
CN114540407A
Application of tomato gene SlCPK12 or protein coded by tomato gene SlCPK12 in regulation and control of tomato blossom-end rot
CN117210473A
Polynucleotide, protein, biological material and application thereof in improving plant fruit quality
CN118207227A
Rice CDPK20 gene and application thereof in improving abiotic stress resistance of plants
CN118638821A
Protein kinase RAPK1N and Method for preparing the drought stress tolerant plants using the same
KR1020110019978A