SNP (Single Nucleotide Polymorphism) molecular marker related to salt tolerance character of broad beans and application of SNP molecular marker
By using transcriptome sequencing technology to discover intronless differentially expressed genes in broad bean salt stress response and developing SNP molecular markers, the problems of long identification cycle and high cost in traditional broad bean salt tolerance identification have been solved. This enables early, efficient and accurate screening of broad bean salt tolerance, significantly accelerating the breeding process.
Patent Information
- Application Number
- CN202511465052.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-14
- Publication Date
- 2025-11-14
AI Technical Summary
Traditional methods for identifying salt tolerance phenotypes in broad beans are time-consuming, highly susceptible to environmental influences, involve destructive sampling, and have limited research. Existing technologies have failed to effectively utilize large-scale population resequencing of the genome and lack rapid, accurate, and low-cost molecular markers for early screening of salt tolerance in broad beans.
Using transcriptome sequencing technology, we explored intronless differentially expressed genes related to salt stress response in broad beans, developed SNP molecular markers located on chromosome 4 (chr4-919763028) of the broad bean genome, designed KASP molecular marker primers, and detected broad bean genotypes by fluorescent PCR to screen for salt-tolerant varieties.
It enables early, efficient, and accurate identification of salt tolerance in broad beans, assists in selection, significantly accelerates the broad bean breeding process, allows for high-throughput detection of multiple samples, and shows significant genotyping effects, making it suitable for field screening of salt-tolerant broad bean breeding materials.
Smart Images

Figure CN120945119A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular genetic breeding technology, specifically to an SNP molecular marker related to salt tolerance in broad beans and its application. Background Technology
[0002] Broad bean (Vicia faba L.), also known as fava bean, is one of China's important edible legume crops. Under salt stress, various physiological indicators of broad beans are significantly affected, leading to reduced chlorophyll content, increased malondialdehyde and proline content, and altered antioxidant enzyme activity, ultimately impacting growth and development. Traditional methods for identifying salt tolerance phenotypes in broad beans are difficult due to long cycles, susceptibility to environmental influences, and destructive sampling. Furthermore, research on the salt stress response mechanism of broad beans is relatively limited. Therefore, there is an urgent need to develop molecular marker technologies that are closely related to salt tolerance, highly accurate, rapid and simple to detect, low in cost, and suitable for early screening.
[0003] In recent years, photosynthetic physiological indicators based on chlorophyll fluorescence (such as maximum photochemical quantum yield, QYmax) have been introduced into salt tolerance evaluation. QYmax reflects the PSII light energy conversion efficiency, and its decrease under salt stress is significantly correlated with the degree of damage to the photosynthetic system. Compared with subjective morphological scoring, QYmax has the advantages of non-destructive detection, precise quantification, and early response. However, this technology has not yet been applied on a large scale in broad bean salt tolerance breeding. This invention is the first to use QYmax as the core phenotypic indicator for validating the KASP marker for broad bean salt tolerance, providing a scientific benchmark for verifying marker accuracy.
[0004] Large-scale population resequencing of the genome is costly, and there are currently no relevant reports both domestically and internationally. Therefore, how to develop efficient molecular markers using existing methods has become a key focus of broad bean genetic research. This invention utilizes transcriptome sequencing technology as a foundation, providing an efficient means to discover salt tolerance-related genes in broad beans through data analysis, key gene mining, and validation. By comparing the differences in gene expression between two different broad bean varieties after salt treatment, key genes related to salt stress can be identified. Notably, intronless genes, due to their simple structure and the fact that they do not require RNA splicing, can be rapidly induced to respond to abiotic stress, making them ideal targets for developing molecular markers. Therefore, this invention uses transcriptome data from broad beans after salt treatment as a foundation to mine differentially expressed intronless genes related to salt stress response, and develops the KASP molecular marker among these differentially expressed genes for the identification of salt tolerance in broad beans.
[0005] Therefore, mining intronless genes related to salt stress in broad beans based on transcriptome data and developing markers associated with salt tolerance traits is of great significance for screening salt-tolerant broad bean varieties. Summary of the Invention
[0006] To address the shortcomings of the existing technologies, this invention aims to provide an SNP molecular marker related to salt tolerance in broad beans and its application, enabling early, efficient, and accurate identification and assisted selection of salt tolerance in broad beans, thereby accelerating the breeding process of salt-tolerant crops.
[0007] To solve the above problems, the present invention adopts the following technical solution: In a first aspect, the present invention provides an SNP molecular marker associated with salt tolerance in broad beans, wherein the SNP molecular marker is located on chromosome 4 chr4-919763028 of the broad bean genome, and the base polymorphism site is G / T.
[0008] Furthermore, the SNP molecular marker is located in an intronless gene. VfERF1A superior.
[0009] Furthermore, broad bean individuals with the GG genotype showed greater salt tolerance than those with the TT genotype.
[0010] In a second aspect, the present invention provides a primer for detecting the SNP molecular marker of claim 1, comprising a forward primer as shown in SEQ ID NO.1 and SEQ ID NO.2 and a reverse primer as shown in SEQ ID NO.3.
[0011] Thirdly, the present invention provides a kit for detecting the SNP molecular markers, characterized in that it includes the primers.
[0012] Fourthly, the present invention provides a method for identifying salt tolerance traits in broad beans. Genomic DNA of the broad beans to be tested is extracted, and fluorescent PCR is performed on SNP molecular markers using the primers described above to determine their genotypes. Broad bean individuals with the genotype GG have stronger salt tolerance than broad bean individuals with the genotype TT.
[0013] Furthermore, the procedure for the fluorescent PCR detection includes: pre-denaturation at 4℃ for 15 min, 1 cycle; denaturation at 94℃ for 20 s, annealing at 57℃ for 60 s, 10 cycles, wherein the annealing temperature is decreased by 0.8℃ for each cycle; denaturation at 94℃ for 20 s, annealing at 55℃ for 60 s, 26 cycles; and extension at 30℃ for 60 s.
[0014] Furthermore, if the fluorescence signal detected by the fluorescent PCR is blue, the genotype is GG; if the fluorescence signal is red, the genotype is TT.
[0015] Fifthly, the present invention provides a method for screening salt-tolerant broad bean varieties, which involves extracting genomic DNA from broad beans to be tested, using the primers to detect the genotype of SNP molecular markers, and selecting broad bean individuals with the genotype GG for breeding.
[0016] Sixthly, the present invention provides the application of the aforementioned SNP molecular marker in identifying salt tolerance traits in broad beans or screening salt-tolerant broad bean varieties.
[0017] In a seventh aspect, the present invention provides the application of the primers or the kits described herein in the preparation of reagents for identifying salt tolerance traits in broad beans or screening salt-tolerant broad bean strains.
[0018] The beneficial effects of this invention are as follows: Using 104 natural broad bean populations as experimental subjects, and combining transcriptome analysis technology, this invention identified a SNP locus chr4-919763028 located on a gene without introns in broad beans, which is significantly associated with the salt tolerance trait of broad beans. Based on the target SNP locus, primer sets were designed to develop KASP molecular markers associated with the salt tolerance trait of broad beans. These markers can be applied to the breeding of salt-tolerant varieties to identify or assist in the identification of salt-tolerant broad bean varieties. The KASP molecular markers of this invention can detect multiple samples with high throughput, and the sample genotyping effect is obvious, which is beneficial for field screening of salt-tolerant broad bean breeding materials and accelerates the broad bean breeding process. Attached Figure Description
[0019] Figure 1 Phenotypic diagrams of salt-treated and control groups of two broad bean varieties are shown below. A shows the plant height comparison between the salt-treated and control groups of Sucan 4 (left: treatment group, right: control group); B shows the plant height comparison between the salt-treated and control groups of Yundou 1183 (left: treatment group, right: control group); C shows the root comparison between the salt-treated and control groups of Sucan 4 (left: treatment group, right: control group); D shows the root comparison between the salt-treated and control groups of Yundou 1183 (left: treatment group, right: control group).
[0020] Figure 2 Analysis of intron-free differentially expressed genes in the root and leaf transcriptomes of two broad bean varieties.
[0021] Figure 3 The analysis included differentially expressed genes without introns in two broad bean varieties; where A represents KEGG enrichment analysis of differentially expressed genes without introns; B represents GO enrichment analysis of differentially expressed genes without introns; and C represents Venn diagram of differentially expressed genes without introns.
[0022] Figure 4 VfERF1A Protein network interaction diagram with vernalization genes CBFs; where A is a heatmap of expression of 58 intronless differentially expressed genes; B is... VfERF1A Differential expression RT-PCR analysis; C is VfERF1A Participated in protein network analysis; D is VfERF1A Interaction with EIN2 was verified by LUC experiments.
[0023] Figure 5 Figure A shows the detection results of KASP molecular markers on alleles related to salt tolerance in different genotypes of materials; Figure B shows the changes in QYmax index after salt treatment in different genotypes of materials; Figure C shows the detection results of KASP molecular markers on alleles related to salt tolerance in different genotypes of materials; Figure C shows the difference analysis between different genotypes of KASP molecular markers and the salt tolerance trait QYmax. Detailed Implementation
[0024] The present invention will be further described in detail below with reference to specific embodiments.
[0025] It should be noted that these embodiments are only used to illustrate the present invention and are not intended to limit the present invention. Simple improvements to the method under the premise of the present invention are all within the scope of protection claimed by the present invention.
[0026] Example 1 Transcriptome analysis was used to identify intronless differentially expressed genes significantly associated with salt stress response in broad beans. Experimental materials: Two broad bean varieties, Yun Dou 1183 and Su Can No. 4, provided by the Institute of Economic Crops, Jiangsu Academy of Agricultural Sciences, were used as experimental materials. The experiment was conducted in the greenhouse of the Institute of Economic Crops, Jiangsu Academy of Agricultural Sciences. After the seedlings had fully developed their third true leaf, uniformly growing broad bean seedlings were selected for treatment. The seedlings were treated with 0 mmol / L and 150 mmol / L sodium chloride solutions, respectively, with 1 L of water applied every two days. There were two treatments (including the control), and each treatment was replicated three times. After 10 days of cultivation, roots and leaves of the broad bean seedlings in both the control and treatment groups were sampled (see...). Figure 1 Immediately place it in liquid nitrogen to freeze, and store it in a -80 ℃ freezer for later use.
[0027] Experimental results: Transcriptome analysis revealed that genes with pvalue < 0.05 and |log2 FC| > 1 were intron-free differentially expressed genes. Figure 2 The two varieties share a total of 15 intronless differential genes. Figure 3 This study analyzed the biological processes involved by these genes. KEGG enrichment analysis revealed that these genes are mainly involved in secondary metabolic synthesis, plant hormone signal transduction, and the MAPK signaling pathway. Figure 3 (A). GO enrichment analysis showed that these genes are mainly involved in biological processes related to secondary metabolism regulation, redox balance, and cell remodeling. Figure 3 (B)
[0028] Example 2 VfERF1A Protein networks involved in salt stress Experimental materials: BLAST plugin in Tbtools, fava bean proteome data, Arabidopsis thaliana proteome data (TAIR11). LUC experimental analysis was performed, and nLUC, cLUC, and nLUC- were analyzed. ERF1A The carrier and cLUC-CBF are transferred into tobacco leaves. For predicted... ERF1A The protein network that responds to salt in EIN2 was validated.
[0029] Experimental results: Fifteen intronless differentially expressed genes were compared with the Arabidopsis protein database (TAIR11) using BLAST. The expression fold change of Vfaba.Tiffany.R1.4g106080 |log2 FC| > 5. VfERF1A The changes in FPKM values of the other 14 intronless differentially expressed genes before and after vernalization treatment in transcriptome analysis are as follows: Figure 4 As shown in Figure A. The results were verified by RT-PCR experiments. VfERF1A Significant changes in expression in broad bean roots after salt treatment, such as Figure 4 B, VfERF1A Mean expression change > 8 。 Simultaneously analyzed VfERF1A Participating protein networks, such as Figure 4 As shown in C VfERF1A and Ten salt-responsive genes interacted significantly. This was verified by LUC experiments. VfERF1A and The interaction relationship of EIN2, such as Figure 4 D.
[0030] Example 3 Development of KASP molecular markers associated with salt tolerance in broad beans Experimental materials: Based on the SNP variant site information from the above transcriptome analysis, In VfERF1A A variant site exists on the exon. Primers for the SNP variant site were designed using PrimerBlast from NCBI, including forward primer F1, forward primer F2, and reverse primer R. F1 and F2 contain FAM and HEX fluorescent linker sequences (bolded portions in the sequences), respectively. The specific sequences are as follows: Experimental results: Labeled forward primer F1, SEQ ID NO.1: 5'- GAAGGTGACCAAGTTCATGCTGTCCTCCACGTGTCAACTGG - 3'; Label the forward primer F2, SEQ ID NO.2: 5'- GAAGGTCGGAGTCAACGGATTTGTCCTCCACGTGTCAACTGT - 3'; The reverse primer R is labeled, SEQ ID NO.3: 5'- GCGAAGAAGAAGAAGGTAATGG-3'.
[0031] Example 4 Application of KASP molecular markers in the identification of alleles related to salt tolerance traits in broad beans Experimental Materials: 104 representative broad bean germplasm resources were planted in the greenhouse of the Institute of Economic Crops, Jiangsu Academy of Agricultural Sciences in 2024. After treatment with 150 mM / L NaCl for 5 days at the three-leaf stage of seedlings, the QYmax value of the third fully expanded leaf at the apex was measured. The effectiveness of the KASP molecular marker was verified for each of the 104 materials. Genomic DNA was extracted from leaf tissues of the 104 broad bean materials using the CTAB method. PCR amplification was performed using the extracted DNA as a template, followed by fluorescence signal collection and genotyping.
[0032] The amplification system consisted of a 10.0 μL reaction volume: 2 μL DNA template (20 ng / μL), 5 μL 2× KASP Master Mix (Wuhan Jingzhong Biotechnology), 1 μL primer working solution (F1:F2:R = 1:1:3), and 2.0 µL ddH2O. The specific procedure is as follows: Step 1: Pre-denaturation at 4 ℃ for 15 min, 1 cycle; Step 2: 10-cycle program: denaturation at 94 ℃ for 20 s, annealing at 57 ℃ for 60 s, with the annealing temperature decreasing by 0.8 ℃ for each cycle; Step 3: denaturation at 94 ℃ for 20 s, annealing at 55 ℃ for 60 s, 26 cycles; Step 4: extension at 30 ℃ for 60 s. Fluorescence signal reading and genotyping of the products were performed using a QuantStudio 5 quantitative fluorescence instrument.
[0033] Experimental Results: 104 broad bean materials were amplified and genotyped (Table 1). Fluorescence signal collection results showed that 51 broad bean materials clustered in blue, with genotype GG; 53 broad bean materials clustered in red, with genotype TT. The KASP molecular marker achieved an accuracy of 86.54% in distinguishing early-flowering phenotypic varieties. Figure 5 .
[0034] Simultaneously, the salt tolerance traits of 104 broad bean genotypes were analyzed. Individuals with the GG genotype showed stronger salt tolerance than those with the TT genotype (P<0.01). Figure 5 This indicates that the KASP marker meets the requirements for identifying different salt-tolerant genotypes of broad beans and can be used for salt tolerance identification of broad beans.
[0035] Table 1. Genotypes and phenotypes of broad bean materials used for KSAP marker typing serial number genotype Variety Name QYmax-1 QYmax-2 QYmax-3 QYmax average value 5 G:G Yu Can No. 5 0.77 0.76 0.77 0.767 8 G:G Yi Dou No. 4 0.77 0.75 0.68 0.733 12 G:G Yi Dou No. 9 0.67 0.73 0.73 0.710 26 G:G Silkworm selection No. 3 0.7 0.76 0.66 0.707 28 G:G Qingcan No. 14 0.78 0.76 0.7 0.747 31 G:G Chu Zao No. 1 0.71 0.76 0.73 0.733 35 G:G P16-06-3 0.79 0.78 0.76 0.777 36 G:G Lican No. 3 0.77 0.77 0.78 0.773 38 G:G Zhejiang Silkworm No. 1 0.68 0.65 0.71 0.680 40 G:G Cican No. 1 0.73 0.68 0.71 0.707 45 G:G Jingdou 111 0.77 0.76 0.76 0.763 46 G:G Lincan No. 6 0.74 0.53 0.64 0.637 47 G:G Lincan No. 8 0.72 0.67 0.72 0.703 48 G:G Lincan No. 9 0.65 0.65 0.68 0.660 53 G:G Lincan No. 15 0.71 0.67 0.7 0.693 59 G:G Phoenix Bean No. 26 0.75 0.73 0.75 0.743 63 G:G 10123-1-1-1 0.73 0.75 0.76 0.747 66 G:G Ji Zhang Silkworm No. 5 0.78 0.75 0.77 0.767 72 G:G Cheng Hu 24 0.75 0.75 0.75 0.750 78 G:G Tongcan Fresh No. 6 0.74 0.72 0.74 0.733 79 G:G Tongcan Fresh No. 7 0.74 0.77 0.77 0.760 80 G:G Tongcan Fresh No. 8 0.77 0.74 0.74 0.750 81 G:G Tongcan Fresh No. 9 0.72 0.69 0.71 0.707 82 G:G Tongcan Fresh No. 11 0.73 0.74 0.72 0.730 83 G:G Tongcan Fresh No. 12 0.72 0.73 0.74 0.730 84 G:G Tongcan Fresh No. 13 0.71 0.68 0.76 0.717 85 G:G Fresh silkworm 20 0.78 0.77 0.78 0.777 86 G:G Fresh silkworm 21 0.73 0.71 0.75 0.730 91 G:G RF-19 0.76 0.73 0.78 0.757 99 G:G CD19 0.73 0.64 0.74 0.703 100 G:G CD24 0.66 0.7 0.75 0.703 101 G:G CD27 0.64 0.71 0.74 0.697 103 G:G CD40 0.74 0.64 0.69 0.690 104 G:G CD46 0.67 0.62 0.7 0.663 106 G:G CD51 0.66 0.61 0.7 0.657 108 G:G CD90 0.66 0.63 0.66 0.650 109 G:G CD95 0.64 0.61 0.61 0.620 110 G:G CD102 0.62 0.66 0.73 0.670 114 G:G CD114 0.63 0.63 0.7 0.653 119 G:G CD136 0.73 0.68 0.74 0.717 123 G:G CD373 0.69 0.65 0.71 0.683 124 G:G CD375 0.67 0.68 0.76 0.703 125 G:G CD376 0.63 0.66 0.7 0.663 128 G:G CD401 0.69 0.66 0.73 0.693 132 G:G CD464 0.44 0.4 0.51 0.450 134 G:G CD471 0.5 0.56 0.4 0.487 135 G:G CD707 0.72 0.64 0.69 0.683 136 G:G CD708 0.71 0.64 0.7 0.683 140 G:G CD734 0.67 0.63 0.6 0.633 142 G:G CD746 0.68 0.57 0.61 0.620 145 G:G CD772 0.6 0.61 0.74 0.650 107 N / A CD87 0.76 0.73 0.74 0.743 1 T:T Yucan No. 1 0.74 0.73 0.73 0.733 2 T:T Yucan No. 2 0.68 0.73 0.7 0.703 4 T:T Yucan No. 4 0.76 0.71 0.75 0.740 7 T:T Yidou No. 3 0.74 0.76 0.76 0.753 10 T:T Yi Dou No. 6 0.49 0.49 0.57 0.517 13 T:T Yi Dou No. 10 0.66 0.47 0.51 0.547 18 T:T Chu Tou Xin Lv No. 1 0.8 0.79 0.79 0.793 19 T:T Chu 17 Jian 5 0.77 0.77 0.78 0.773 22 T:T E Dou 1103 0.79 0.75 0.73 0.757 24 T:T E Dou 3202 0.71 0.76 0.73 0.733 25 T:T Silkworm selection No. 2 0.76 0.77 0.77 0.767 27 T:T Qinghai No. 13 0.67 0.75 0.76 0.727 34 T:T 15-102 0.79 0.73 0.74 0.753 39 T:T Jingdou No. 2 0.72 0.73 0.72 0.723 41 T:T Jingdou No. 5 0.79 0.77 0.77 0.777 42 T:T Jingdou No. 8 0.77 0.75 0.75 0.757 43 T:T Jingdou No. 9 0.57 0.56 0.61 0.580 44 T:T Jingdou No. 11 0.75 0.74 0.67 0.720 54 T:T Phoenix Bean No. 6 0.68 0.67 0.72 0.690 55 T:T Phoenix Bean No. 11 0.63 0.66 0.72 0.670 56 T:T Phoenix Bean No. 13 0.74 0.76 0.74 0.747 57 T:T Phoenix Bean No. 17 0.74 0.72 0.75 0.737 58 T:T Phoenix Bean No. 18 0.63 0.73 0.75 0.703 60 T:T Phoenix Bean No. 27 0.76 0.74 0.73 0.743 61 T:T Phoenix Bean No. 28 0.75 0.75 0.77 0.757 68 T:T Cheng Hu 15 0.76 0.73 0.75 0.747 69 T:T Cheng Hu 18 0.76 0.75 0.74 0.750 70 T:T Cheng Hu 21 0.73 0.72 0.76 0.737 73 T:T Cheng Hu 23 0.73 0.71 0.75 0.730 77 T:T Cheng Hu Dabai 0.72 0.64 0.48 0.613 88 T:T Wancan No. 2 0.77 0.77 0.81 0.783 89 T:T CD0120 0.78 0.74 0.77 0.763 90 T:T Qinghai No. 12 0.75 0.73 0.77 0.750 93 T:T Qingcan No. 18 0.78 0.77 0.75 0.767 94 T:T Qingcan No. 19 0.72 0.71 0.75 0.727 96 T:T CD2 0.65 0.69 0.75 0.697 97 T:T CD4 0.63 0.6 0.63 0.620 98 T:T CD16 0.68 0.68 0.74 0.700 105 T:T CD47 0.65 0.67 0.69 0.670 111 T:T CD385 0.69 0.71 0.66 0.687 115 T:T CD116 0.72 0.63 0.7 0.683 116 T:T CD124 0.67 0.64 0.7 0.670 118 T:T CD134 0.69 0.64 0.67 0.667 120 T:T CD140 0.71 0.68 0.73 0.707 121 T:T CD366 0.67 0.67 0.71 0.683 122 T:T CD369 0.65 0.65 0.72 0.673 126 T:T CD397 0.54 0.57 0.34 0.483 130 T:T CD426 0.6 0.52 0.64 0.587 131 T:T CD458 0.58 0.6 0.45 0.543 133 T:T CD468 0.46 0.49 0.43 0.460 138 T:T CD721 0.56 0.45 0.52 0.510 141 T:T CD742 0.61 0.65 0.5 0.587 144 T:T CD770 0.67 0.63 0.61 0.637 Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described with reference to preferred embodiments, those skilled in the art should understand that various changes in form and detail can be made without departing from the spirit and scope of the invention as defined in the appended claims.
Claims
1. A SNP molecular marker associated with salt tolerance in broad beans, characterized in that, The SNP molecular marker is located on chromosome 4 (chr4-919763028) of the broad bean genome, with a base polymorphism site of G / T.
2. The SNP molecular marker according to claim 1, characterized in that, Broad bean individuals with the genotype GG are more tolerant of salt than those with the genotype TT.
3. A primer for detecting the SNP molecular marker of claim 1, characterized in that, This includes the forward primers shown in SEQ ID NO.1 and SEQ ID NO.2 and the reverse primer shown in SEQ ID NO.
3.
4. A kit for detecting the SNP molecular marker of claim 1, characterized in that, Includes the primers described in claim 3.
5. A method for identifying salt tolerance traits in broad beans, characterized in that, Genomic DNA was extracted from broad beans to be tested, and fluorescent PCR was performed on the SNP molecular markers using the primers described in claim 3 to determine their genotypes. Broad bean individuals with the genotype GG showed stronger salt tolerance than those with the genotype TT.
6. The method according to claim 5, characterized in that, The procedure for fluorescence PCR detection includes: pre-denaturation at 4℃ for 15 min, 1 cycle; denaturation at 94℃ for 20 s, annealing at 57℃ for 60 s, 10 cycles, with the annealing temperature decreasing by 0.8℃ for each cycle; denaturation at 94℃ for 20 s, annealing at 55℃ for 60 s, 26 cycles; and extension at 30℃ for 60 s.
7. The method according to claim 5, characterized in that, If the fluorescence signal detected by the fluorescent PCR is blue, the genotype is GG; if the fluorescence signal is red, the genotype is TT.
8. A method for screening salt-tolerant broad bean varieties, characterized in that, Genomic DNA of broad beans was extracted, and the genotype of the SNP molecular marker was detected using the primers described in claim 3. Broad bean individuals with the genotype GG were selected for breeding.
9. The application of the SNP molecular marker as described in claim 1 or 2 in identifying salt tolerance traits in broad beans or screening salt-tolerant broad bean varieties.
10. The use of the primers of claim 3 or the kit of claim 4 in the preparation of reagents for identifying salt tolerance traits in broad beans or screening salt-tolerant broad bean strains.