Method for identifying recombinant tubercle bacillus strain vaccine and wild strain infection and application

By knocking out the virulence-related genes EAST-6 and CFP-10 of tuberculosis strains, an attenuated live vaccine was prepared and recombinant proteins were used as TBST detection antigens. This solved the problems of excessively high vaccine virulence and false positives in TBST, achieving a lower adverse reaction rate and higher detection accuracy.

CN120960463APending Publication Date: 2025-11-18BEIJING YUANMAO BIOTECHNOLOGY PARTNERSHIP (LLP)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511009331.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-22
Publication Date
2025-11-18

AI Technical Summary

Technical Problem

Existing tuberculosis vaccines have adverse reactions due to excessive virulence and false positives for TBST, affecting the effectiveness of tuberculosis screening and prevention.

Method used

By using genetic engineering to knock out the virulence-related genes EAST-6 and CFP-10 in tuberculosis strains, an attenuated live vaccine was prepared. The recombinantly expressed EAST-6 and CFP-10 proteins were then used as TBST detection antigens to differentiate between vaccine-infected and wild-type strain infections.

Benefits of technology

It significantly reduced the adverse reaction rate of vaccines, accurately distinguished between vaccine-inoculated and wild-type strain infections, avoided false positives in TBST, and improved the accuracy of tuberculosis screening.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120960463A_ABST
    Figure CN120960463A_ABST
Patent Text Reader

Abstract

The invention provides a method for identifying a recombinant tubercle bacillus strain vaccine and wild strain infection and application, the method adopts a genetic engineering method to knock out virulence-related genes of an original strain to obtain tubercle bacillus, the recombinant strain is prepared into an attenuated live vaccine, and the knocked-out virulence-related protein is obtained through recombinant expression to serve as a detection antigen. The attenuated live vaccine vaccination or wild tubercle bacillus strain infection can be identified by combining a TBST test (based on a mycobacterium tuberculosis antigen skin test), and the method is simple, rapid and universal and has important application in vaccine design and tuberculosis infection identification.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of tuberculosis vaccine technology, and in particular to a method for identifying recombinant Mycobacterium strain vaccine and wild strain infection and application. BACKGROUND

[0002] Tuberculosis (TB) caused by Mycobacterium tuberculosis (Mtb) infection is one of the most serious infectious diseases in the world. Mtb is a very successful pathogen, and about 1 / 3 of the world's population (1.86 billion) carries Mtb, with about 9 million new cases and 1.5-2 million deaths from TB each year. Despite decades of efforts by scientists to develop therapeutic drugs and preventive vaccines for TB, the disease still poses a significant threat to public safety. With the emergence of multiple drug-resistant strains and the threat of HIV / TB co-infection, the development of new drugs and vaccines is becoming increasingly urgent. Therefore, it is increasingly important to elucidate the pathogenic mechanism of Mtb and to develop drug targets based on this.

[0003] BCG is an attenuated live vaccine obtained by serial passage of Mycobacterium bovis (M. bovis). Mycobacterium bovis During attenuation, multiple regions of the genome were deleted, resulting in the loss of key virulence factors, thereby ensuring its safety in immunocompetent hosts. Although the specific genes deleted are not detailed in the existing literature, studies have shown that these deletion regions directly affect the pathogenicity of the bacteria, making them unable to cause active tuberculosis, but still retaining immunogenicity. For example, BCG lacks a gene cluster associated with Mtb virulence (such as the RD1 region), which may be one of the core mechanisms for its attenuation.

[0004] The Mycobacterium tuberculosis H37Ra strain (H37Ra) is an attenuated strain of Mycobacterium tuberculosis, which is extremely weak in virulence and relatively safe for the host, and has the conditions of a live vaccine. Compared with BCG, the H37Ra strain has more complete immunogenicity and contains some antigenic components that are missing in BCG. At the same time, the H37Ra strain can fully activate macrophages and stimulate the body to produce specific immune responses, playing an important role in the prevention and control of tuberculosis. However, compared with BCG, the live vaccine prepared from the H37Ra strain still causes stronger independent adverse reactions.

[0005] Based on current research, the virulence-related adverse reactions of attenuated live tuberculosis vaccines are mainly abnormal reactions at the inoculation site, including abscesses and ulcers, and systemic adverse reactions, including disseminated BCG disease and immune reconstitution inflammatory syndrome (IRIS), which have a significant impact on the prevention and control of tuberculosis.

[0006] In addition, as a routine screening method for tuberculosis, the tuberculosis antigen detection test (TBST) method is easy to test subjects injected with a tuberculosis vaccine as false positive, thereby misleading the tuberculosis screening work. SUMMARY

[0007] The present application provides a method for identifying recombinant Mycobacterium tuberculosis strain vaccine and wild strain infection and application, to solve the problem of TBST false positive and vaccine strain virulence in the prior art, by knocking out virulence genes, and using the protein encoded by the knocked out virulence gene as the TBST detection protein, the method can significantly reduce the adverse reactions of vaccine and exclude the TBST false positive caused by vaccine injection.

[0008] In the first aspect, the present application provides a method for identifying recombinant Mycobacterium tuberculosis strain vaccine and wild strain infection, specifically, knocking out virulence related genes in wild strains and preparing into vaccines, recombinantly expressing the knocked out genes as antigens, and detecting vaccine inoculation or wild strain infection by TBST method with the antigens; The TBST method detection result is negative for vaccine inoculation or non-infection, and the result is positive for wild strain infection; The method is not for the purpose of disease diagnosis.

[0009] Preferably, in the above method, the recombinant Mycobacterium tuberculosis strain is a Mycobacterium tuberculosis strain in which virulence related genes are knocked out or replaced by genetic engineering means.

[0010] Preferably, in the above method, the vaccine is a live attenuated vaccine, and the preparation method is (1) Strain recovery and culture: take 1 strain, place in 37℃ water bath for rapid thawing, inoculate into Suton potato slant medium, and culture at 37℃ for 3-4 weeks; (2) Harvest: after the bacterial growth matures, collect bacterial film or bacterial mass from the surface or inside of the culture medium; (3) Physical treatment: disperse the bacterial mass by grinding or dilution method to form uniform bacterial suspension; (4) Dilution and sub-packaging: dilute and sub-packaging into 0.5mg / ml bacterial suspension, which is a live attenuated vaccine.

[0011] Preferably, in the above method, the live bacteria concentration in the live attenuated vaccine after dilution and sub-packaging in step (4) should be not less than 0.5× 10 7 CFU / mL.

[0012] Preferably, in the above method, the antigen preparation method of TBST is: The related gene is inserted into pET-28a vector to obtain a recombinant plasmid, the recombinant plasmid is transformed into competent cell BL21 (DE3) to obtain an expression engineering bacteria, fermentation culture is carried out at 37 DEG C, 0.2 mM IPT is used for inducing expression to harvest the bacteria, the bacteria are broken by high-pressure homogenization, centrifugal clarification is carried out, the related protein is soluble expression, centrifugal supernatant is obtained, the protein stock solution is obtained by salting-out, anion exchange chromatography and desalting liquid exchange, and the TBST antigen is obtained by diluting the protein stock solution.

[0013] Preferably, the protein stock solution concentration is 1 mg / mL, and the TBST antigen concentration is 5 μg / mL.

[0014] Preferably, the method comprises the following steps: (1) knocking out the virulence related genes EAST-6 and CFP-10 of a tuberculosis strain and producing as a vaccine and inoculation; (2) producing the proteins corresponding to the EAST-6 and CFP-10 genes by using recombinant expression technology as a TBST reagent; (3) detecting suspected infected persons by using the TBST reagent, and the persons with subcutaneous allergic reaction are infected by the wild strain, and the persons without subcutaneous allergic reaction are inoculated with the vaccine or not infected.

[0015] Preferably, in the method, the inoculation mode of the vaccine is subcutaneous injection or oral administration.

[0016] In the second aspect, the application provides the use of the above method in distinguishing between vaccine inoculation and wild strain infection.

[0017] The beneficial effects of the application include: The application obtains an attenuated strain by knocking out the virulence related protein coding genes EAST-6 and CFP-10 in Mycobacterium tuberculosis H37Ra, and produces the attenuated strain as a vaccine, and then recombines and expresses EAST-6 and CFP-10 as a TBST detection reagent, and uses the reagent for tuberculosis detection, which can successfully distinguish between the vaccine and the wild strain, and reduces the virulence of the vaccine and the adverse reaction after inoculation. BRIEF DESCRIPTION OF DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the application or prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description are some embodiments of the application, and other drawings can also be obtained by those skilled in the art without any creative effort.

[0019] Figure 1 It is a schematic diagram of the design of the recombinant tuberculosis attenuated strain gene knockout and verification primers in Example 1 of the application.

[0020] Figure 2 is the electrophoresis result map of the recombinant attenuated Mycobacterium tuberculosis strain constructed in Embodiment 1 verified by two-step PCR, wherein: Lane 1-4: PCR verification of the knockout effect (MUT strain) of the Mycobacterium tuberculosis H37Ra ΔRa3913-14 gene knockout strain Ag1, wherein lane 4 is a wild-type strain control; Lane 5-7: PCR verification of the knockout effect (MUT strain) of the Mycobacterium tuberculosis H37Ra ΔRa3913-14 gene knockout strain Ag2, wherein lane 5 is a wild-type strain control; M: DNA Marker. DETAILED DESCRIPTION

[0021] In order to make the objects, technical solutions and advantages of the present application clearer, the technical solutions in the present application will be described clearly and completely below in combination with the drawings in the present application. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor fall within the scope of protection of the present application.

[0022] Construction of genetically modified attenuated Mycobacterium tuberculosis strain in Embodiment 1 Phage-mediated homologous recombination was used for gene knockout: as shown in Figure 1 , first, a homologous exchange site (containing sacB and hyg genes) was constructed, and then it was integrated into the Mycobacterium tuberculosis phage genome to obtain a phasmid; the phasmid was introduced into Mycobacterium smegmatis to obtain a recombinant phage integrated with the homologous exchange site, and a high-titer recombinant phage was obtained by in vitro amplification, and the Mycobacterium tuberculosis was transfected; the transfected Mycobacterium tuberculosis was plated on solid medium containing hygromycin resistance, cultured at 37°C for 4-5 weeks, and single colonies were picked.

[0023] Knockout effect verification: primers were designed with the sequences between the upstream and downstream of Ag1 and Ag2 and the sequences on both sides of the homologous exchange site as the target sequences, and the knockout effect was verified by PCR and nucleic acid electrophoresis, and the verification results are shown in Figure 2 .

[0024] Knockout sequence: Ag1: MAB_3913 + MAB_3914 ATGGCAGAGATGAAGACCGATGCCGCTACCCTCGCGCAGGAGGCAGGTAATTTCGAGCGGATCTCCGGCGACCTGAAAACCCAGATCGACCAGGTGGAGTCGACGGCAGGTTCGTTGCAGGGCCAGTGGCGCGGCGCGGCGGGGACGGCCGCCCAGGCCGCGGTGGTGCGCTTCCAAGAAGCAGCCAATAAGCAGAAGCAGGAACTCGACGAGATCTCGACGAATATTCGTCAGGCCGGCGTCCAATACTCGAGGGCCGACGAGGAGCAGCAGCAGGCGCTGTCCTCGCAAATGGGCTTCTGAATGACAGAGCAGCAGTGGAATTTCGCGGGTATCGAGGCCGCGGCAAGCGCAATCCAGGGAAATGTCACGTCCATTCATTCCCTCCTTGACGAGGGGAAGCAGTCCCTGACCAAGCTCGCAGCGGCCTGGGGCGGTAGCGGTTCGGAGGCGTACCAGGGTGTCCAGCAAAAATGGGACGCCACGGCTACCGAGCTGAACAACGCGCTGCAGAACCTGGCGCGGACGATCAGCGAAGCCGGTCAGGCAATGGCTTCGACCGAAGGCAACGTCACTGGGATGTTCGCATAG (SEQ ID NO. 1) Ag2: MPT64 gtgcgcatcaagatcttcatgctggtcacggctgtcgttttgctctgttgttcgggtgtggccacggccgcgcccaagacctactgcgaggagttgaaaggcaccgataccggccaggcgtgccagattcaaatgtccgacccggcctacaacatcaacatcagcctgcccagttactaccccgaccagaagtcgctggaaaattacatcgcccagacgcgcgacaagttcctcagcgcggccacatcgtccactccacgcgaagccccctacgaattgaatatcacctcggccacataccagtccgcgataccgccgcgtggtacgcaggccgtggtgctcaaggtctaccagaacgccggcggcacgcacccaacgaccacgtacaaggccttcgattgggaccaggcctatcgcaagccaatcacctatgacacgctgtggcaggctgacaccgatccgctgccagtcgtcttccccattgtgcaaggtgaactgagcaagcagaccggacaacaggtatcgatagcgccgaatgccggcttggacccggtgaattatcagaacttcgcagtcacgaacgacggggtgattttcttcttcaacccgggggagttgctgcccgaagcagccggcccaacccaggtattggtcccacgttccgcgatcgactcgatgctggcctag (SEQ ID NO. 2) As shown in Figure 2 The primers were designed according to the sequence between the upstream and downstream of the knockout gene and the sequence flanking the homologous exchange site, and the knockout effect was verified by PCR. The expected results were 1265 bp for the upstream PCR and 1493 bp for the downstream PCR, which were consistent with the expectations.

[0025] Preparation of live attenuated vaccine This example provides a method for preparing a live attenuated vaccine.

[0026] 1) Strain recovery and culture: Take one strain, thaw quickly in a 37°C water bath, inoculate into a Suton potato slant culture medium, and incubate at 37°C for 3-4 weeks.

[0027] 2) Harvest: After the bacteria grow to maturity, collect the bacterial film or bacterial mass from the surface or inside of the culture medium.

[0028] 3) Physical treatment: Disperse the bacterial mass by grinding or dilution method to form a uniform bacterial suspension Dilution and sub-packaging: Dilute and sub-packaging into 0.5 mg / ml bacterial suspension.

[0029] 4) Liquid sub-packaging of bacterial suspension or freeze-drying ((freeze-drying protective solution: sucrose: 10% glutamate sodium: 1.5% potassium dihydrogen phosphate: 0.05M gelatin: 1% lactose: 2% pH 7.0-7.2)).

[0030] Example 3 Preparation of TBST reagent This example provides a method for preparing a recombinant TBST reagent (Ag1).

[0031] The Ag1 sequence in Example 1 was inserted into the pET-28a vector, respectively, to obtain a recombinant plasmid, which was transformed into competent cells BL21 (DE3) to obtain expression engineering bacteria, which were fermented at 37°C. The bacterial mass was induced for expression by 0.2 mM IPTG, and then harvested. The bacterial mass was broken by high-pressure homogenization, and then clarified by centrifugation. The relevant protein was expressed in a soluble form, and then the supernatant was obtained by centrifugation. The protein stock solution was obtained by salt precipitation, anion exchange chromatography, and desalting.

[0032] The stock solution was diluted to 5 μg / ml to obtain TBST-Ag1 test solution.

[0033] The Ag2 sequence in Example 2 was inserted into the pET-28a vector, respectively, to obtain a recombinant plasmid, which was transformed into competent cells BL21 (DE3) to obtain expression engineering bacteria, which were fermented at 37°C. The bacterial mass was induced for expression by 0.2 mM IPTG, and then harvested. The bacterial mass was broken by high-pressure homogenization, and then clarified by centrifugation. The relevant protein was expressed in a soluble form, and then the supernatant was obtained by centrifugation. The protein stock solution was obtained by salt precipitation, anion exchange chromatography, and desalting.

[0034] The stock solution was diluted to 5 μg / ml to obtain TBST-Ag2 test solution.

[0035] Example 3 Attenuated live vaccine and TBST differential action verification This example evaluates the differential action of attenuated live vaccine 1 and attenuated live vaccine 2 prepared in Example 2 by TB-PPD (tuberculin purified protein derivative) and Ag1, Ag2 (recombinant Mycobacterium tuberculosis fusion protein).

[0036] SPF level Hartley healthy and not done any test female guinea pigs, body weight greater than 300 g, divided into 5 groups, 6 animals in each group, 2 in each cage, a total of 24 guinea pigs, divided into a. BCG (BCG) group; b. H37Ra-WT (original strain) group; c. H37Ra-△Ag1 (knockout group 1) group; d. H37Ra-△Ag2; e. PBS group.

[0037] Guinea pig screening: according to the following steps to screen guinea pigs: (1) Partially depilate the left dorsal side of the guinea pig, and disinfect the injection site skin with alcohol cotton.

[0038] (2) Take 50 IU / mL TB-PPD with a 1 mL syringe, and inject 0.2 mL intradermally.

[0039] (3) Observe the longitudinal and transverse diameters of the local redness or induration at 24 h and 48 h after injection, and determine according to the 24 h reaction results. The average redness or induration reaction diameter (longitudinal diameter plus transverse diameter divided by 2) is not less than 5 mm, which is judged as positive, and less than 5 mm, which is judged as negative. Guinea pigs with negative skin test are used for subsequent experiments.

[0040] 1. After 4 weeks of immunization injection, the skin test (PPD / EC) evaluates the differential effect of attenuated live vaccine through the size of redness and induration.

[0041] 2. Discrimination experiment: The test group and control group guinea pigs were subcutaneously infected with 5.0×10³ CFU Mtb, and PPD-TST and TBST skin tests were performed two weeks after infection. The method is as follows: 5µg / ml EC and 50IU / ml TB-PPD were injected into the left and right back of the guinea pig respectively, each 0.1ml, a total of 2 points. Observe and record the local redness or induration reaction size at 24 and 48 hours after injection.

[0042] The PPD-TST and TBST skin test determination basis is as follows: at 24 h and 48 h after skin test injection, observe the longitudinal and transverse diameters of the local redness or induration, and the average redness or induration reaction (longitudinal diameter plus transverse diameter divided by 2) is not less than 5 mm, which is judged as positive, and less than 5 mm, which is judged as negative. The average redness or induration reaction diameter of each dilution is calculated by the 24 h results, and the skin test results are shown in Table 2.

[0043] Result analysis: As can be seen from Table 2, the Mycobacterium tuberculosis obtained by knocking off the virulence related genes of the original strain by genetic engineering method has lower adverse reaction rate as the attenuated live vaccine, and the attenuated live vaccine prepared by using the strain can replace BCG or be used as a booster vaccine. The virulence related protein knocked off by recombinant expression and purification can be used as TBST reagent to successfully identify vaccine inoculation and wild Mycobacterium tuberculosis infection.

Claims

1. A method for identifying recombinant tuberculosis vaccine versus wild-type strain infection, characterized in that, The virulence-related genes in the wild strain were knocked out and the vaccine was prepared. The knocked-out gene was recombinantly expressed as an antigen, and the antigen was used to detect vaccination or wild strain infection by the TBST method. A negative result from the TBST method indicates vaccination or no infection, while a positive result indicates infection with wild-type strains. The method described is not intended for disease diagnosis.

2. The method according to claim 1, characterized in that, The recombinant tuberculosis strain is a tuberculosis strain in which virulence-related genes have been knocked out or replaced by genetic engineering techniques.

3. The method according to any one of claims 1 or 2, characterized in that, The vaccine is a live attenuated vaccine, and its preparation method is as follows: (1) Resuscitation and culture of strains: Take one strain, thaw it quickly in a 37°C water bath, inoculate it onto Sutong potato slant medium, and incubate it at 37°C for 3-4 weeks; (2) Harvesting: After the bacteria have matured, collect the bacterial film or bacterial blocks from the surface or inside of the culture medium; (3) Physical treatment: Disperse the bacterial blocks by grinding or dilution to form a uniform bacterial suspension; (4) Dilution and packaging: Dilution and packaging into a 0.5mg / ml bacterial suspension is the live attenuated vaccine.

4. The method according to claim 3, characterized in that, The live bacteria concentration in the diluted and dispensed live attenuated vaccine described in step (4) should not be less than 0.5 × 10⁻⁶. 7 CFU / mL.

5. The method according to any one of claims 1 or 2, characterized in that, The antigen preparation method of the TBST is as follows: The relevant gene was inserted into the pET-28a vector to obtain a recombinant plasmid. The recombinant plasmid was transformed into competent BL21(DE3) cells to obtain the expression engineered bacteria. The cells were fermented at 37℃, and expression was induced by 0.2mM IPTG. The cells were harvested, homogenized by high pressure, centrifuged and clarified, and the relevant protein was expressed in soluble form. The supernatant was subjected to salt precipitation, anion exchange chromatography, desalting and medium replacement to obtain the protein stock solution. The protein stock solution was diluted to obtain the TBST antigen.

6. The method according to claim 5, characterized in that, The concentration of the protein stock solution is 1 mg / mL, and the concentration of the TBST antigen is 5 μg / mL.

7. The method according to any one of claims 1-6, characterized in that, Includes the following steps: (1) Knock out the virulence-related genes ESAT-6, CFP10, and MPT64 of the tuberculosis strain and produce it as a vaccine for inoculation; (2) The proteins corresponding to the ESAT-6, CFP10, and MPT64 genes were produced using recombinant expression technology as TBST reagents; (3) Suspected infected individuals are tested using the TBST reagent. Those who develop a subcutaneous allergic reaction are wild-type infected individuals, while those who do not develop a subcutaneous allergic reaction are either vaccinated or not infected.

8. The method according to claim 7, characterized in that, The vaccine is administered via subcutaneous injection or orally in the method described.

9. The use of the method according to any one of claims 1-8 in identifying infection by vaccination and wild-type strains.