Glutaminase mutants and uses thereof

By mutating and expressing specific amino acid sites in Bacillus amyloliquefaciens glutaminase, the problem of low enzyme activity was solved, achieving efficient glutaminase production and reducing costs.

CN120966803BActive Publication Date: 2026-05-08ANGEL YEAST CO LTD +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511495845.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-20
Publication Date
2026-05-08
Estimated Expiration
2045-10-20

AI Technical Summary

Technical Problem

In existing technologies, the glutaminase activity derived from Bacillus amyloliquefaciens is relatively low, resulting in higher production costs.

Method used

By rationally designing proteins from Bacillus amyloliquefaciens glutaminase and selecting specific amino acid sites for mutation, a glutaminase mutant with high specific enzyme activity was developed and expressed using the Bacillus expression vector pHY300PLK.

Benefits of technology

It improves the catalytic efficiency of glutaminase, reduces production costs, and enhances market competitiveness.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120966803B_ABST
    Figure CN120966803B_ABST
Patent Text Reader

Abstract

The application provides a glutaminase mutant and application thereof. The glutaminase mutant comprises: (a) a protein which is subjected to amino acid mutation at at least one of the following positions: S467, Y334, K400, N521, R337, E402 or D447 of the amino acid sequence shown in SEQ ID NO: 2 and has a glutaminase activity function; and (b) a protein which has more than 80% homology with the amino acid sequence defined in (a) and has a glutaminase function. The glutaminase mutant with the amino acid sequence of the application has high specific enzyme activity when performing enzyme catalysis, is low in cost when used for commercial food processing, and is strong in market competitiveness.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of fermentation technology, and more specifically, to a glutaminase mutant and its applications. Background Technology

[0002] Glutaminase is an enzyme that catalyzes the hydrolysis of L-glutamine to produce L-glutamate and ammonia. Glutamate plays an important role in the food industry, enhancing the umami flavor and nutritional value of food. In recent years, research on the application of glutaminase in food has developed rapidly. For example, in the production of soy sauce, it hydrolyzes glutamine in soy sauce to glutamate, and simultaneously forms more flavor peptides through transpeptidation, thus enhancing the flavor of soy sauce and reducing the formation of pyroglutamic acid from glutamine in soy sauce. Currently, commercial glutaminase has achieved large-scale production and application, but its production cost remains high. Existing technologies are also researching the rational design and site-directed mutagenesis of glutaminase from different bacterial strains to improve its stability or salt tolerance, but research on the rational design of specific enzyme activities for glutaminase from Bacillus amyloliquefaciens has not yet been reported.

[0003] Given the excellent application effects of glutaminase derived from Bacillus amyloliquefaciens, it is of great significance to develop a glutaminase with high specific activity and low production cost. Summary of the Invention

[0004] The main objective of this invention is to provide a glutaminase mutant and its application to solve the problem of low glutaminase activity in the prior art.

[0005] To achieve the above objectives, according to a first aspect of the present invention, a glutaminase mutant is provided, comprising: (a) a protein having glutaminase activity by amino acid mutation at at least one of the following sites in the amino acid sequence shown in SEQ ID NO: 2: S467, Y334, K400, N521, R337, E402, or D447; and (b) a protein having more than 80% homology with the amino acid sequence defined in (a) and having glutaminase activity.

[0006] Furthermore, the amino acid mutations in (a) are each independently selected from the following: S467H; Y334A; K400A; N521A; R337A; E402A; D447F or D447A; wherein the letter before the number represents the original amino acid and the letter after the number represents the mutated amino acid.

[0007] Further, in (c), the protein has 85% or more, preferably 90% or more, more preferably 95% or more, and even more preferably 99% or more homology with the amino acid sequence defined in (a) or (b) and has glutaminase function.

[0008] Furthermore, the mutations of the glutaminase mutant include any of the following amino acid mutations: S467H; S467H+Y334A; S467H+R337A; S467H+K400A; S467H+E402A; S467H+D447A; S467H+N521A; D447F.

[0009] To achieve the above objectives, according to a second aspect of the present invention, a DNA molecule is provided that encodes the above-described glutaminase mutant.

[0010] Furthermore, the DNA molecule is selected from: 1) a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 1; 2) a polynucleotide having 80% or more, more preferably 90% or more, and even more preferably 95% or more homology with the nucleotide sequence shown in SEQ ID NO: 1.

[0011] To achieve the above objectives, according to a third aspect of the present invention, a recombinant plasmid is provided, wherein the recombinant plasmid is linked with the aforementioned DNA molecule.

[0012] Furthermore, the recombinant plasmid includes the Bacillus expression vector pHY300PLK.

[0013] To achieve the above objectives, according to a fourth aspect of the present invention, a host cell is provided, wherein the host cell is transformed with the above-described recombinant plasmid.

[0014] To achieve the above objectives, according to a fifth aspect of the present invention, the application of the above-described glutaminase mutant in food processing is provided.

[0015] The glutaminase mutant with the amino acid sequence of this application has a high specific enzyme activity when performing enzyme-catalyzed reactions, and is low-cost and highly competitive in commercial food processing. Attached Figure Description

[0016] The accompanying drawings, which form part of this application, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings:

[0017] Figure 1 A schematic diagram of the structure of the Bacillus expression vector pHY300PLK in the experimental materials of the embodiments described in this application is shown. Detailed Implementation

[0018] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. The present invention will now be described in detail with reference to the embodiments.

[0019] As mentioned in the background section, wild-type glutaminase has low catalytic efficiency, resulting in high costs for commercial application. Therefore, in this application, the inventors attempted to predict the catalytic activity of glutaminase mutants through rational protein design, and further verified the practical application effect of the mutants through experiments, thereby obtaining glutaminase mutants with higher enzyme activity.

[0020] In a first typical embodiment of this application, a glutaminase mutant is provided, comprising: (a) a protein having glutaminase activity by amino acid mutation at at least one of the following sites in the amino acid sequence shown in SEQ ID NO: 2: S467, Y334, K400, N521, R337, E402, or D447; and (b) a protein having more than 80% homology with the amino acid sequence defined in (a) and having glutaminase activity.

[0021] Rational protein design refers to the rational structural modification of proteins based on their structure and function information to achieve desired functional designs. This application uses glutaminase (amino acid sequence shown in SEQ ID NO: 2) from *Bacillus amyloliquefaciens* as a basis for homology modeling, using the crystal structure of *Bacillus licheniformis* γ-glutamyl transpeptidase (PDB ID: 4y23) with a sequence similarity of 71.16% to the glutaminase of this application. Detailed and comprehensive analysis and simulation of its spatial conformation, substrate binding site, and key catalytic residues were conducted using Discovery Studio software. Virtual saturation mutagenesis and alanine scanning mutagenesis strategies were employed for design modification. Mutants were obtained through site-specific mutagenesis simulation using software, specifically mutants with the aforementioned amino acid site mutations. The glutaminase mutants with these site mutations exhibit higher specific enzyme activity, and using these glutaminase mutants in food processing can reduce production costs.

[0022] Furthermore, since the glutaminase produced in this application is mainly used in the food processing industry, it belongs to the category of food processing enzymes. According to the requirements of GB 2760-2014 "National Food Safety Standard for the Use of Food Additives," the source bacteria for food-grade glutaminase preparations must be Bacillus amyloliquefaciens. Therefore, Bacillus amyloliquefaciens must be selected for expression. If other strains are selected for expression, even if the expressed enzyme activity is good, it cannot be used for the industrial production and application of glutaminase. Therefore, this application does not select other strains for glutaminase expression.

[0023] Specific enzyme activity refers to the ratio of enzyme activity to its protein content. It is usually used to measure enzyme activity per unit mass (the amount of glutaminase required to catalyze the production of 1 µg of glutamate from glutamine per minute is defined as 1 enzyme activity unit). The higher the specific enzyme activity, the higher the catalytic efficiency of the enzyme.

[0024] SEQ ID NO: 2:

[0025] .

[0026] In a preferred embodiment, the amino acid mutations in (a) are each independently selected from the following: Y334A; K400A; N521A; R337A; E402A; D447F or D447A; S467H; wherein the letter before the number represents the original amino acid and the letter after the number represents the mutated amino acid; preferably, in (c), the protein has 85% or more, more preferably 90% or more, more preferably 95% or more, and even more preferably 99% or more homology with the amino acid sequence defined in (a) or (b) and has glutaminase function.

[0027] As used herein, the amino acid residue abbreviations are as follows: alanine (Ala; A), asparagine (Asn; N), aspartic acid (Asp; D), arginine (Arg; R), cysteine ​​(Cys; C), glutamic acid (Glu; E), glutamine (Gln; Q), glycine (Gly; G), histidine (His; H), isoleucine (Ile; I), leucine (Leu; L), lysine (Lys; K), methionine (Met; M), phenylalanine (Phe; F), proline (Pro; P), serine (Ser; S), threonine (Thr; T), tryptophan (Trp; W), tyrosine (Tyr; Y), and valine (Val; V).

[0028] Substitution and replacement rules generally apply to amino acids with similar properties; the effects of substitution are similar. For example, conserved amino acid substitutions can occur in the aforementioned homologous proteins. "Conserved amino acid substitutions" include, but are not limited to:

[0029] Hydrophobic amino acids (Ala, Cys, Gly, Pro, Met, Val, Ile, Leu) are replaced by other hydrophobic amino acids;

[0030] Hydrophobic amino acids with large side chains (Phe, Tyr, Trp) are replaced by other hydrophobic amino acids with large side chains;

[0031] Amino acids with positively charged side chains (Arg, His, Lys) are replaced by other amino acids with positively charged side chains;

[0032] Amino acids with polar, uncharged side chains (Ser, Thr, Asn, Gln) are replaced by other amino acids with polar, uncharged side chains.

[0033] Those skilled in the art can also perform conservative substitutions of amino acids based on amino acid substitution rules well known to them, such as the "blosum62 score matrix" in the prior art.

[0034] In this application, the applicant further investigated the aforementioned active site and discovered that mutations in the active site to different amino acids resulted in varying protein activities, with specific mutations enhancing glutaminase activity. Experimental investigations revealed that specific mutations in the active site could yield proteins with enhanced activity. For the amino acid mutation sites in glutaminase proteins, flexible selection and combinations of the aforementioned mutations are possible.

[0035] In a preferred embodiment, the mutation of the glutaminase mutant includes any one of the following amino acid mutations: S467H; S467H+Y334A; S467H+R337A; S467H+K400A; S467H+E402A; S467H+D447A; S467H+N521A; D447F.

[0036] All of the above-mentioned amino acid mutations were experimentally investigated in the embodiments of this application, and all of them have glutaminase activity. Compared with the parent protein with the amino acid sequence shown in SEQ ID NO: 2, enzymes with higher specific enzyme activity can be obtained, which can reduce the production cost of glutaminase.

[0037] In a second typical embodiment of this application, a DNA molecule is provided that encodes the above-described glutaminase mutant.

[0038] In a preferred embodiment, the DNA molecule is selected from: 1) a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 1; 2) a polynucleotide having 80% or more, more preferably 90% or more, and even more preferably 95% or more homology with the polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 1.

[0039] SEQ ID NO: 1:

[0040]

[0041] In a third typical embodiment of this application, a recombinant plasmid is provided, which is linked to the aforementioned DNA molecule.

[0042] The aforementioned DNA encodes the glutaminase mutant and can be ligated to a recombinant plasmid to form a circular DNA. Both the DNA and the recombinant plasmid can be transcribed and translated by RNA polymerase, ribosomes, tRNA, etc., to obtain the glutaminase mutant. To achieve efficient glutaminase production, the mutant DNA is introduced into an expression vector of its source strain. In a preferred embodiment, the recombinant plasmid includes the Bacillus expression vector pHY300PLK.

[0043] In a fourth typical embodiment of this application, a host cell is provided, wherein the recombinant plasmid described above is transformed within the host cell. The host cell is a non-plant-derived host cell and can be a prokaryotic cell or a eukaryotic cell. Specifically, the prokaryotic cell can be *Escherichia coli*, and the eukaryotic cell can be yeast.

[0044] In a fifth typical embodiment of this application, the application of the above-mentioned glutaminase mutant in food processing is provided, including the production of flavor substances such as glutamic acid. As a flavor enhancer, the glutaminase mutant of this application can replace traditional chemical hydrolysis processes, improve the umami flavor of food, increase the content of free amino acids, and enhance the nutritional value of food.

[0045] The present application will be further described in detail below with reference to specific embodiments, which should not be construed as limiting the scope of protection claimed in the present application.

[0046] Experimental materials and culture media

[0047] 1. Experimental Materials

[0048] (1) Strains and vectors: Escherichia coli Top10 was purchased from Sangon Biotech (Shanghai) Co., Ltd.; recombinant plasmid pUC-glu3 was synthesized by Wuhan Aoke Dingsheng Biotechnology Co., Ltd., and any commercial Bacillus expression vector pHY300PLK is applicable to this application. Among them, the Bacillus expression vector pHY300PLK in the embodiments of this application (e.g., Figure 1 As shown, Figure 1In this text, "p15A ori" refers to the replication initiation site of the plasmid; "PHpaⅡ" refers to the promoter responsible for transcription of the target gene; "PamyQ" refers to the promoter responsible for transcription of the target gene; "SPamyQ" refers to the signal peptide responsible for secretion by the target gene; "TcR" refers to the tetracycline resistance selection marker gene, whose core function is to encode a tetracycline efflux pump, making the Bacillus host strain resistant to tetracycline antibiotics; "repB" refers to a plasmid replication initiation protein gene, which is mainly responsible for initiating the plasmid DNA replication process in Bacillus; "AmpR promoter" refers to the promoter that drives the transcription of the AmpR gene; "AmpR" refers to the ampicillin resistance selection marker gene, whose core function is to encode a β-lactamase that degrades ampicillin, making the host strain resistant to ampicillin. It is based on the expression vector pHY300PLK with two promoters linked to it. HpaⅡ (as shown in SEQ ID NO:31) and P amyQ (as shown in SEQ ID NO:32) and a signal peptide sequence SP amyQ (As shown in SEQ ID NO:33).

[0049] SEQ ID NO:31:

[0050]

[0051] SEQ ID NO:32:

[0052] GGCGGCGTTCTGTTTCTGCTTCGGTATGTGATTGTGAAGCTGGCTTCAGAAGAGCGGTAAAAGAAGAAATAAAAAAGAAATCATCTTTTTTGTTTTGGAAAGCGAGGGAAGCGTTTCACAGTTTCGGGCAGCTTTTTTTATAGGAACATTGATTTGTATTCACTC TGCCAAGTTGTTTTGATAGAGTGATTGTGATAATTTTAAATGTAAGCGTTTAACAAAATTCTCCAGTCTTCACATCGGTTTGAAAGGAGGAAGCGGAAGAATGAAGTAAGAGGGATTTTTGACTCCGAAGTAAGTCTTCAAAAAATCAAATAAGGAGTGTCAAGA.

[0053] SEQ ID NO:33:

[0054] ATGTTTGCAAAACGATTCAAAACCTCTTTACTGCCGTTATTCGCTGGATTTTTATTGCTGTTTCATTGGTTCTGGCAGGACCGGCGGCTGCGAGTGCTGAA.

[0055] Bacillus amyloliquefaciens LX-12 was deposited at the China Center for Type Culture Collection (CCTCC) on April 15, 2015, at No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, China, with accession number CCTCC NO: M2015234.

[0056] (2) Enzymes and kits: PrimeSTAR Max DNA Polymerase was purchased from TaKaRa; Gibson two-fragment assembly kit was purchased from Novizan Biotechnology Co., Ltd.; Cycle-Pure PCR purification kit was purchased from OMEGA; high-purity plasmid DNA mini-extraction kit was purchased from Beijing Qingke Xinyue Biotechnology Co., Ltd.; BCA protein concentration assay kit was purchased from Beijing Solarbio Technology Co., Ltd.

[0057] (3) Reagents: DL8000 DNA Marker, 50×TAE Buffe, and 6×TriDye DNA / RNA Loading Buffe were purchased from Beijing Bomei Gene Technology Co., Ltd.; ampicillin, tetracycline, L-glutamine, etc. were purchased from Beijing Solarbio Technology Co., Ltd.; the remaining reagents were domestic or imported analytical grade.

[0058] 2. Culture medium

[0059] LB medium (g / L): peptone 10.0, yeast extract 5.0, NaCl 10.0, solid medium with additional agar powder 18.0, pH 7.0.

[0060] Growth medium (g / L): peptone 10.0, yeast extract 5.0, NaCl 10.0, sorbitol 90.0, pH 7.0.

[0061] Washing medium (g / L): sorbitol 90.0, mannitol 92.5, glycerol 100.0.

[0062] Resuscitation medium (g / L): sorbitol 90.0, mannitol 70.0, peptone 10.0, yeast extract 5.0, NaCl 10.0.

[0063] Fermentation optimized TB medium (g / L): peptone 12.0, yeast extract 24.0, potassium dihydrogen phosphate 2.3, dipotassium hydrogen phosphate 21.5, glycerol 10.0, pH 7.5.

[0064] Example 1: Construction of wild-type glutaminase expression plasmid

[0065] Following codon optimization for Bacillus, the wild-type Bacillus amyloliquefaciens glutaminase gene (encoding amino acid sequence SEQ ID NO:2) was obtained using whole-genome synthesis technology (Wuhan Aoke Dingsheng Biotechnology Co., Ltd.), as shown in SEQ ID NO:1, resulting in the recombinant plasmid pUC-glu3. (Wuhan Aoke Dingsheng Biotechnology Co., Ltd.)

[0066] Using recombinant plasmid pUC-glu3 as a template and primers P1 / P2, the glu3 gene fragment was amplified by PCR. Using plasmid pHY300PLK as a template and primers P3 / P4, the pHY300PLK vector backbone was amplified by PCR. The recombinant vector was constructed using a Gibson two-fragment assembly kit. The ligation product was transformed into *E. coli* Top10 competent cells, and the transformed bacterial culture was plated on LB agar plates (containing 100 μg / mL ampicillin). After overnight culture, transformants were picked for colony PCR verification. Plasmids from positive transformants were extracted and sequenced to obtain the recombinant expression plasmid pHY300PLK-glu3.

[0067] Example 2: Site-directed mutation of genes

[0068] Homology modeling and molecular docking were performed on wild-type Bacillus amyloliquefaciens glutaminase (amino acid sequence shown in SEQ ID NO:2) to identify key amino acid sites that interact with the substrate. Virtual saturation mutagenesis was then performed on the protein using Discovery Studio software to increase the affinity of key amino acids for the substrate. Furthermore, alanine scanning mutagenesis was used to investigate the effect of key amino acid residues on glutaminase activity. Based on simulation calculations, the following mutations were selected at amino acids 402, 405, 447, 467, 334, 337, 400, and 521 of the glutaminase:

[0069] Bit 402: E402W; Bit 405: T405K; Bit 447: D447Y, D447W, D447F; Bit 467: S467H; Bit 467 / Bit 334: S467H / Y334A; Bit 467 / Bit 337: S467H / R337A; Bit 467 / Bit 400: S467H / K400A; Bit 467 / Bit 402: S467H / E402A; Bit 467 / Bit 447: S467H / D447A; Bit 467 / Bit 521: S467H / N521A.

[0070] Based on the mutation sites identified above, the recombinant plasmid pHY300PLK-glu3 was used as a PCR amplification template. Each glutaminase mutant was obtained by introducing point mutations through PCR. The primers used are shown in Table 2. Taking the construction of the pHY300PLK-glu3(E402W) plasmid as an example, the PCR system is shown in Table 1 below:

[0071] Table 1 PCR reaction system

[0072]

[0073] PCR amplification conditions: 98℃ for 30 s; 98℃ for 10 s, 55℃ for 15 s, 72℃ for 1 min / 2 kb, 35 cycles; 72℃ for 5 min. After recovery, the PCR product was digested with Dpn I at 37℃ for 2 h to remove template DNA, then dissolved in 50 μL of sterile dd H2O and transformed into TOP10. Single colonies were picked for sequencing, and plasmids with correct sequencing results were extracted for later use. The remaining recombinant mutant plasmids were constructed using the same method, and the obtained plasmids were named: pHY300PLK-glu3(E402W), pHY300PLK-glu3(T405K), pHY300PLK-glu3(D447Y), pHY300PLK-glu3(D447W), pHY300PLK-glu3(D447F), pHY300PLK-glu3(S467H), pHY3 00PLK-glu3 (S467H / Y334A), pHY300PLK-glu3 (S467H / R337A), pHY300PLK-glu3 (S467H / K400A), pH Y300PLK-glu3 (S467H / E402A), pHY300PLK-glu3 (S467H / D447A), pHY300PLK-glu3 (S467H / N521A).

[0074] Table 2 Primer sequences used

[0075]

[0076] Example 3: Construction of recombinant amylolytic spore strains containing wild-type and mutant glutaminase

[0077] (1) Preparation of Bacillus amyloliquefaciens LX-12 competent cells

[0078] A single colony of *Bacillus amyloliquefaciens* LX-12 was inoculated into 3 mL of LB medium and cultured overnight at 37°C and 170 rpm. 1 mL of the overnight culture was then transferred to 15 mL of growth medium and cultured at 37°C and 170 rpm until OD (Organic Growth Rate) was reached. 600 =0.8 or higher. Incubate the bacterial culture in an ice-water bath for 10 min, then transfer 1.5 mL of bacterial culture to 2 mL centrifuge tubes. Centrifuge at 4000 rpm and 4°C for 5 min to collect the bacterial cells. Resuspend the bacterial cells in pre-cooled washing medium, combining two tubes into one tube. Centrifuge at 4000 rpm and 4°C for 5 min, discarding the supernatant. Repeat the washing process four times. Resuspend the washed bacterial cells in 60 μL of electroporation medium, mix well, and slightly adjust the volume to approximately 95 μL per EP tube to obtain competent Bacillus amyloliquefaciens cells. After preparing the competent cells, store them on ice until needed.

[0079] (2) Transformation

[0080] The obtained recombinant plasmids were transformed into Bacillus amyloliquefaciens LX-12 competent cells by electroporation, as follows:

[0081] Add 5 μL of transformation plasmid to 95 μL of competent cells, incubate on ice for 5 min, then transfer to a pre-chilled electroporation cuvette (2 mm) and electroporate once. Electroporation parameters were set as follows: 2.5 kV, time constant = 4.5~5.0 ms. After electroporation, remove the cuvette and immediately add 1 mL of recovery medium. Incubate at 37℃ and 100 rpm for 1.0 h, then adjust to 170 rpm for 2.0 h. Centrifuge to remove 700 μL of supernatant, plate onto a plate containing 10 μg / mL tetracycline, and incubate overnight at 37℃. Colony PCR verification and screening yielded the wild-type glutaminase-inactivated Bacillus amyloliquefaciens recombinant strain LX-12 / pHY300PLK-glu3 and other glutaminase mutant Bacillus amyloliquefaciens recombinant strains.

[0082] Example 4: Shake-flask fermentation of recombinant strains

[0083] (1) Seed culture: Select a single colony of the recombinant bacteria constructed in Example 3 and inoculate it into a 250 mL shake flask (25 mL LB, tetracycline final concentration of 10 μg / mL), and culture overnight at 37℃ and 180 rpm.

[0084] (2) Shake-flask fermentation: 500 μL of seed culture was transferred to 250 mL shake flasks (25 mL of optimized TB medium, with a final tetracycline concentration of 10 μg / mL), and fermented at 37℃ and 180 rpm. At different time points, the fermentation broth was collected, centrifuged at 4℃ and 7000 rpm for 5 min, the bacterial cells were removed, and the supernatant was collected for the determination of enzyme activity and protein content.

[0085] Example 5: Enzyme activity detection

[0086] Enzyme activity is defined as the amount of glutaminase required to catalyze the production of 1 µg of glutamate from glutamine per minute under specific conditions. It is defined as 1 unit of enzyme activity, expressed as U / mL.

[0087] The main reagents used in the test are:

[0088] (1) 0.75 mol / L perchloric acid solution: Dissolve 83 mL of 60% perchloric acid in 900 mL of distilled water, bring the volume up to 1000 mL, and store in a brown reagent bottle at 4℃.

[0089] (2) 0.75 mol / L sodium hydroxide solution: Dissolve 30 g of sodium hydroxide solid in 800 mL of distilled water and bring the volume up to 1000 mL.

[0090] (3) 1.0 mol / L acetic acid solution: Dissolve 60.05 g of acetic acid in 900 mL of distilled water and bring the volume up to 1000 mL.

[0091] (4) 1.0 mol / L sodium acetate solution: Dissolve 136.08 g of sodium acetate trihydrate in 900 mL of distilled water and bring the volume up to 1000 mL.

[0092] (5) 1.0 mol / L pH 6.0 acetate buffer: Adjust 1.0 mol / L sodium acetate solution to pH 6.0 with 1.0 mol / L acetic acid solution.

[0093] (6) 10% Triton X-100 solution: Dissolve 10 g Triton X-100 in 70 mL of distilled water and bring the volume up to 100 mL.

[0094] (7) Enzyme dilution solution: Mix 10 mL of 1.0 mol / L pH6.0 acetate buffer with 0.5 mL of 10% Triton X-100 solution, and dilute with distilled water to 1000 mL.

[0095] (8) 2.0% pH 6.0 L-glutamine substrate solution: Dissolve 2.00 g L-glutamine in 70 mL of distilled water, add 10 mL of 1.0 mol / L acetate buffer, and bring the volume up to 100 mL with distilled water.

[0096] The steps for enzyme activity detection are as follows:

[0097] Sample group: Pipette 1.0 mL of enzyme solution into a test tube and incubate at 37℃ for 5 min; then add 1.0 mL of 2.0% pH 6.0 L-glutamine substrate solution, and immediately start the reaction at 37℃; after reacting for 10 min, add 1.0 mL of 0.75 mol / L perchloric acid solution, mix well, and incubate on ice for 1 min; then add 1.0 mL of 0.75 mol / L sodium hydroxide solution, mix well, and obtain the mixture; (The addition of perchloric acid solution is to stop the enzyme activity reaction, and the addition of sodium hydroxide solution is to neutralize the perchloric acid, so that the pH of the sample to be detected by the biosensor is between 6 and 8, to avoid damage to the instrument and inaccurate detection results. The addition of these two reagents has no effect on the glutamic acid content in the product.)

[0098] Blank control: Pipette 1.0 mL of enzyme solution into a test tube, add 1.0 mL of 0.75 mol / L perchloric acid solution, and mix well; incubate in a 37℃ water bath for 5 min; add 1.0 mL of substrate solution, then incubate on ice for 1 min; finally add 1.0 mL of 0.75 mol / L sodium hydroxide solution, mix well, and obtain the mixture; (In the blank control, perchloric acid is added first to inactivate the enzyme and ensure that no further enzymatic hydrolysis or glutamate formation occurs. Further analysis will be conducted to determine whether other substances in the system, besides the glutamate formation from enzymatic hydrolysis, affect the glutamate detection results.)

[0099] The concentration of glutamate in the mixed solution of Shanghai Su sample group and blank control was detected using a biosensor method. Enzyme activity was calculated based on the values ​​displayed by the biosensor.

[0100] Enzyme activity E (U / mL) = 400 * x * n / 147

[0101] X: Difference displayed by the biosensor; n: Dilution factor.

[0102] Example 6: Protein content detection

[0103] The protein content in the fermentation broth was detected using a BCA protein concentration assay kit.

[0104] Example 7: Calculation of specific enzyme activity

[0105] The specific enzyme activity of the fermentation broth sample is obtained by dividing the detected enzyme activity value by the protein content value.

[0106] The results are shown in Table 3. Among the constructed mutant strains, there were 8 positive mutations and 4 negative mutations. Compared with the wild type, the glutaminase mutants E402W showed a 48% decrease in enzyme activity, T405K a 25% decrease, D447Y a 12% decrease, D447W a 22% decrease, D447F a 25% increase, S467H a 100% increase, S467H / Y334A a 143% increase, S467H / R337A a 151% increase, S467H / K400A a 112% increase, S467H / E402A a 133% increase, S467H / D447A a 155% increase, and S467H / N521A a 137% increase.

[0107] The mutant strain S467H / D447A showed the greatest increase in enzyme activity. Fermentation production of glutaminase using the S467H / D447A mutant strain is expected to save approximately 50% of production costs.

[0108] Table 3. Results of enzyme activity assay for mutants

[0109]

[0110] As can be seen from the above description, the embodiments of the present invention achieve the following technical effects: Utilizing a protein rational design strategy, glutaminase derived from *Bacillus amyloliquefaciens* is rationally modified based on increased specific enzyme activity, resulting in the aforementioned mutant with higher specific enzyme activity, as verified by experiments. Specifically, the mutant glutaminase glu3 (S467H / D447A) exhibits a 155% increase in specific enzyme activity compared to the wild-type glutaminase glu3. Fermentation production using strains possessing the aforementioned glutaminase mutant helps reduce the production cost of glutaminase and enhances its market competitiveness.

[0111] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A glutaminase mutant, characterized in that, The mutation in the glutaminase mutant is a mutation occurring in the amino acid sequence shown in SEQ ID NO: 2, where the following mutation occurs: S467H+Y334A, S467H+R337A, or S467H+D447A.

2. A DNA molecule, characterized in that, The DNA molecule encodes the glutaminase mutant of claim 1.

3. A recombinant plasmid, characterized in that, The recombinant plasmid is ligated with the DNA molecule as described in claim 2.

4. The recombinant plasmid according to claim 3, characterized in that, The recombinant plasmid includes the Bacillus expression vector pHY300PLK.

5. A host cell, characterized in that, The host cell is transformed with the recombinant plasmid as described in claim 3 or 4.

6. The application of the glutaminase mutant according to claim 1 in food processing.

Citation Information

Patent Citations

  • Bacillus amyloliquefaciens as well as construction method and application thereof

    CN120400012A