High-activity acetaldehyde dehydrogenase mutant, preparation method and application thereof

By mutating the thermophilic bacterium acetaldehyde dehydrogenase to N159Y, its substrate binding channel and cofactor binding site were optimized, solving the problems of insufficient acetaldehyde dehydrogenase activity and poor stability, thus achieving efficient alcohol metabolism, which is suitable for alcohol metabolism-related products.

CN122256277APending Publication Date: 2026-06-23BEIJING UNIV OF CHEM TECH
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
BEIJING UNIV OF CHEM TECH
Filing Date
2026-04-03
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

In existing technologies, acetaldehyde dehydrogenase activity is insufficient, and human-derived enzymes have poor stability in prokaryotic expression systems such as Escherichia coli, making them difficult to express efficiently and engineer. This leads to an imbalance in alcohol metabolism, causing alcoholic liver disease and various cancers.

Method used

By mutating the amino acid sequence of thermophilic thermophilic bacteria acetaldehyde dehydrogenase (ALDHTt), especially by mutating the 159th amino acid from asparagine (Asn) to tyrosine (Tyr), a mutant N159Y was formed. This optimized the substrate binding channel and cofactor binding site, thereby improving catalytic activity and stability.

Benefits of technology

The mutant N159Y exhibits 2.08-fold increased catalytic activity and 5.3-fold improved catalytic efficiency, making it suitable for alcohol metabolism-related products. It overcomes the difficulties in expressing and the poor stability of human ALDH2 in prokaryotic systems, and is applicable to multi-enzyme cascade systems for alcohol metabolism and oral enzyme preparations.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122256277A_ABST
    Figure CN122256277A_ABST
Patent Text Reader

Abstract

The application discloses a high-activity acetaldehyde dehydrogenase mutant, a preparation method and application thereof. The mutant is obtained by rational design on acetaldehyde dehydrogenase ALDHTt from thermophilic thermus, and is specifically that an asparagine at the 159th position is mutated into tyrosine, and is recorded as N159Y. Enzymatic property characterization shows that the specific enzyme activity of the mutant N159Y is 2.08 times of that of the wild type, the catalytic efficiency is 5.3 times of that of the wild type, and is 2.96 times of that of human ALDH2. Molecular dynamics simulation reveals that the flexibility of the mutant is moderately enhanced in the vicinity of the substrate binding channel and the cofactor binding site, which is beneficial to reduce the substrate entry energy barrier and promote the cofactor binding and release, and meanwhile, the overall structural stability is not adversely affected. The mutant overcomes the defects of human ALDH2, such as difficult expression and poor stability, and can be used as a core enzyme element for constructing an alcohol metabolism multi-enzyme cascade system or an oral enzyme preparation, and has a wide application prospect in preparation of products for alcohol metabolism or acetaldehyde clearance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of biotechnology and enzyme engineering, specifically relating to a method obtained through rational design from *Thermophilic bacterium* (…). Thermus thermophilus The study describes the acetaldehyde dehydrogenase mutant, its encoding gene, expression vector, host cell, preparation method, and the application of multi-enzyme cascade systems and oral delivery systems containing this mutant in alcohol metabolism-related products. Technical Background Imbalanced alcohol metabolism is a major contributing factor to alcoholic liver disease, cardiovascular disease, and various cancers. The core issue lies in insufficient aldehyde dehydrogenase (ALDH) activity, leading to the accumulation of the toxic intermediate acetaldehyde and a disruption in the NADH / NAD ratio. + Imbalance in proportions and damage from reactive oxygen species (ROS). Human ALDH2 is a key enzyme for scavenging acetaldehyde, but about 40% of East Asian populations carry ALDH2 gene functional defect mutations. Furthermore, this enzyme has poor stability in prokaryotic expression systems such as E. coli, easily forms inclusion bodies, and is difficult to express efficiently and engineer.

[0002] Acetaldehyde dehydrogenase (ALDHTt) from *Thermophilus* possesses a catalytic center highly homologous to human ALDH2 and exhibits good thermal stability and ease of expression, making it an ideal chassis for modification. However, its native catalytic activity is insufficient to meet the demands of efficient alcohol metabolism. Therefore, developing an acetaldehyde dehydrogenase mutant with significantly enhanced activity and good stability, and applying it to alcohol metabolism-related fields, has significant application value and market potential. Summary of the Invention: The purpose of this invention is to provide an acetaldehyde dehydrogenase mutant with significantly enhanced activity, in order to solve the problems of insufficient acetaldehyde dehydrogenase activity and difficulty in human enzyme expression in the prior art.

[0003] To achieve the above objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides an acetaldehyde dehydrogenase mutant.

[0004] The mutant is derived from *Thermophilus* (… Thermus thermophilus The mutant is obtained by mutating the amino acid sequence of wild-type acetaldehyde dehydrogenase (ALDHTt), characterized in that the amino acid at position 159 is mutated from asparagine (Asn) to tyrosine (Tyr), denoted as N159Y.

[0005] Preferably, the amino acid sequence of the wild-type ALDHTt is as shown in the NCBI database accession number (corresponding PDB ID: 6FJX).

[0006] Preferably, the amino acid sequence of the mutant N159Y is shown in SEQ ID NO:4.

[0007] Secondly, the present invention provides a nucleic acid molecule encoding the above-mentioned acetaldehyde dehydrogenase mutant.

[0008] Thirdly, the present invention provides a recombinant expression vector comprising the above-mentioned nucleic acid molecules.

[0009] Preferably, the recombinant expression vector is pET-22b(+) or a derivative thereof.

[0010] Fourthly, the present invention provides a host cell comprising the above-described recombinant expression vector.

[0011] Preferably, the host cell is Escherichia coli BL21(DE3).

[0012] Fifthly, the present invention provides a method for preparing the above-mentioned acetaldehyde dehydrogenase mutant, comprising the following steps: 1. Construct a recombinant expression vector containing the nucleic acid molecule encoding the mutant; 2. Transform the recombinant expression vector into host cells; 3. Induce the host cells to express the acetaldehyde dehydrogenase mutant; 4. The acetaldehyde dehydrogenase mutant obtained by isolation and purification.

[0013] Sixthly, the present invention provides the use of the above-mentioned acetaldehyde dehydrogenase mutant in the preparation of products for alcohol metabolism or acetaldehyde clearance. Compared with the prior art, the present invention has the following beneficial effects: Significantly enhanced activity: The mutant N159Y obtained through rational design in this invention has a specific enzyme activity 2.08 times that of the wild-type ALDHTt, and a catalytic efficiency ( k cat / K m The efficiency of this mutant is 5.3 times that of the wild type and 2.96 times that of the human ALDH2. This mutant has a significant advantage in acetaldehyde scavenging efficiency.

[0014] Mechanism clarified: This invention reveals the molecular mechanism of enhanced activity through molecular dynamics simulations. The mutant N159Y exhibits moderately enhanced flexibility in the regions adjacent to the substrate binding channel and cofactor binding site, which helps to lower the substrate entry energy barrier and promote cofactor binding and release, while the overall structural stability is not adversely affected.

[0015] Good expression performance: The selected ALDHTt chassis itself has good soluble expression and thermal stability. Its mutant N159Y inherits and optimizes these characteristics, overcoming the problems of difficult expression and poor stability of human ALDH2 in prokaryotic systems, which facilitates industrial production and application.

[0016] Broad application prospects: This highly active mutant can be used as a core enzyme element to construct an efficient multi-enzyme cascade system for alcohol metabolism (such as in combination with alcohol dehydrogenase, NADH oxidase, and catalase), or to develop oral enzyme preparations for the prevention and treatment of alcohol poisoning, alcoholic liver damage, and related metabolic diseases. Attached image description: Figure 1 Comparison of catalytic abilities between wild-type and mutant strains Figure 2 SDS-PAGE purification images of wild-type ALDHTt and mutant N159Y in this invention. Figure 3 : Comparison of relative enzyme activities between wild-type ALDHTt and various mutants in this invention. Figure 4 Comparison of kinetic parameter measurement results between wild-type ALDHTt and mutant N159Y in this invention. Figure 5 Molecular dynamics simulation analysis of wild-type ALDHTt and mutant N159Y in this invention. (Where A is the radius of gyration Rg analysis, B is the root mean square deviation RMSD analysis, and C is the root mean square fluctuation RMSF analysis.) Detailed implementation method: The technical solution of the present invention will be described in detail below with reference to specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. Example 1: Rational Design of Mutant N159Y 1. Sequence alignment and structural analysis: The human ALDH2 (UniProt: P05091) and thermophilic bacterium ALDHTt (PDB ID: 6FJX) were sequence aligned, and it was confirmed that the catalytic residues (Glu261 and Cys295 corresponding to ALDHTt) of the two were highly conserved.

[0017] 2. Molecular docking and site screening: YASARA software was used to perform molecular docking and site screening of ALDHTt with substrates acetaldehyde (ALD) and coenzyme NAD. + Molecular docking was performed. Based on the acetaldehyde molecule in the docking result, amino acid residues within a 5 Å radius around it were selected as potential mutation targets, and a total of 12 key sites were screened (including Asn159, Val164, Trp167, Lys168, Thr238, Arg294, Thr296, Glu113, etc.).

[0018] 3. FoldX Calculation and Screening: Virtual saturation mutations were performed on the 12 sites using FoldX software, and the change in folding free energy (ΔΔG) between each mutant and the wild type was calculated. The impact of mutations on protein stability was predicted based on the ΔΔG values. Mutants with lower ΔΔG values ​​(predicted improved stability or no significant impact) and potential substrate binding were selected for further experimental validation, ultimately identifying candidate mutants such as N159Y.

[0019] Example 2: Construction, expression and purification of mutant N159Y 1. Site-directed mutagenesis: Using the pET-22b(+)-ALDHTt recombinant plasmid as a template, primers containing the N159Y mutation site were designed and synthesized (upstream primer: CGGGCTATTTTCCGATTGCGG; downstream primer: TCGGAAAATAGCCCGCGGTAATAATG). Site-directed mutagenesis was performed by PCR. After digestion of the template with Dpn I, the sample was transformed into E. coli DH5α and sequenced to obtain the mutant plasmid pET-22b(+)-ALDHTt-N159Y.

[0020] 2. Expression and Purification: The correctly sequenced plasmid was transformed into *E. coli* BL21(DE3) competent cells. Expression was performed under optimal induction conditions (final IPTG concentration 0.3 mM, induction temperature 25℃, induction time 14 h). Cells were collected, resuspended, lysed, and the supernatant was collected by centrifugation. The mutant protein with the 6×His tag was purified using a Ni-NTA affinity chromatography column. SDS-PAGE results showed a single band at approximately 57 kDa (e.g., ...). Figure 2 As shown in the figure, it is consistent with the expected molecular weight.

[0021] Example 3: Enzymatic characterization of mutant N159Y Enzyme activity assay: NAD+ activity was determined spectrophotometrically at 37°C and pH 8.0. + The absorbance change at 340 nm when reduced to NADH. The results showed that the specific enzyme activity of mutant N159Y was 2.08 times that of the wild type (e.g., ...). Figure 3 (As shown).

[0022] Kinetic parameter determination: Initial reaction rates were determined at different concentrations of acetaldehyde substrate (0.1-2.0 mM), and the Michaelis-Menten equation was fitted using nonlinear regression. The results are shown in Table 1. [The remaining text appears to be incomplete and requires further context.] k cat From 36.4 min - ¹Up to 57.0 min - ¹, K m The catalytic efficiency decreased from 0.068 mmol / L to 0.039 mmol / L.k cat / K m The affinity was 2.7 times that of the wild type and 2.96 times that of the human ALDH2. This indicates that the mutant not only has enhanced substrate affinity but also significantly improved catalytic efficiency.

[0023] Table 1. Kinetic parameters of wild type and N159Y Example 4: Molecular docking analysis of wild-type WT and mutant N159Y Wild-type ALDH and NAD + When they interact, their binding energy is measured to be -8.8 kcal / mol. For example... Figure 4 As shown in A and B, NAD + It forms a salt bridge with one residue (Ar342) of WT, hydrogen bonds (including C-H bonds) with six residues (Ser184, Glu404, Ser240, Gly239, Ala157, Gly215), van der Waals forces with 18 residues (Phe406, Gly158, Lys216, Val243, Trp246, Gln221, Val224, Gly220, Ile247, Ile155, Gly215, Thr156, Thr238, Leu262, Cys295, Thr241, Phe237, Gly263), and a Pi-alkyl interaction with one residue (Phe343). NAD... + The binding energy between it and the mutant N159Y is –9.1 kcal / mol, such as Figure 4 As shown in C and D, NAD + It forms hydrogen bonds (including C-H bonds) with 5 residues (Thr296, Glu106, Tyr437, Asn460, Trp285) of the mutant N159Y, van der Waals forces with 16 residues (Asp110, Val463, Lys102, Gly109, Lys105, Trp284, Glu281, Leu278, Asn459, Gly282, Ala461, Glu113, Trp167, Ala465, Phe471, Cys295), and Pi-alkyl interactions with 2 residues (Phe160, Ala163). It can be seen that the mutant N159Y has formed more Pi-alkyl interactions compared to the wild type. At the same time, the asparagine at position 159 is mutated to tyrosine, and a benzene ring is introduced into its side chain, which reduces the size of the substrate cavity, improves the conformational stability of the active site, and enhances the affinity between the substrate and the catalytic residue.

[0024] Example 5: Molecular dynamics simulations of wild-type WT and mutant N159Y To elucidate the mechanism of enhanced activity at the molecular level, studies were conducted on wild-type and N159Y mutants and NAD. + The complex was subjected to molecular dynamics simulations for 50 ns.

[0025] RMSD analysis: The results showed that the mean root mean square deviation (RMSD) of mutant N159Y (0.686 nm) was lower than that of the wild type (0.783 nm). Figure 4 B) indicates that the overall conformational stability is improved after the mutation.

[0026] RMSF Analysis: Root Mean Square Fluctuation (RMSF) analysis shows ( Figure 4 C), the mutant N159Y has mutations in the G130-V150 region (near the substrate binding channel) and the 260-270 region (near the cofactor NAD). + The flexibility of the binding site and catalytic center is significantly increased.

[0027] Rg and SASA analysis: Radius of gyration (Rg) analysis showed that the mutant's structure was moderately expanded ( Figure 4 A) This mutation may facilitate the opening of the active pocket; solvent accessible surface area (SASA) analysis showed that the mutation did not adversely affect the overall stability of the protein. The simulation results indicate that the N159Y mutation, by introducing appropriate flexibility into key functional regions, optimizes the kinetics of substrate entry and cofactor binding, thereby achieving a significant improvement in catalytic activity while maintaining overall structural stability.

Claims

1. An ALDHTa mutant comprising the following amino acid substitutions relative to the ALDHTa shown in SEQ ID NO: 4: The asparagine at position 159 is replaced with tyrosine.

2. The ALDHTa mutant according to claim 1, wherein, It also includes at least one of the following amino acid substitutions: The lysine at position 168 is replaced with tyrosine; The asparagine at position 159 is replaced with phenylalanine.

3. The ALDHTt mutant according to claim 1 or 2, wherein, The amino acid sequence of the ALDHTt mutant includes or consists of sequences such as SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO:

4.

4. The ALDHTt mutant according to claim 1 or 2, wherein, The ALDHTt variant exhibits enhanced activity compared to the ALDHTt shown in SEQ ID NO: 1.