Transcription factor ZmbHLH180 gene as well as encoding protein and application thereof

Abstract

The invention discloses a transcription factor ZmbHLH180 gene as well as an encoded protein and application thereof, and relates to the technical field of plant genetic engineering, the nucleotide sequence of the corn ZmbHLH180 gene is shown as SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO.2. The invention provides a transcription factor ZmbHLH180 gene, the CDS full length of the gene is 864bp, 287 amino acids are encoded, the gene is mainly positioned in a cell nucleus, and the expression of a chlorophyll degradation gene NYC1 and the senescence of leaves can be obviously promoted by over-expressing the ZmbHLH180 gene in arabidopsis thaliana; the trans-ZmbHLH180 gene overexpressed corn can remarkably promote leaf greening under drought stress, a certain technical foundation is laid for regulation and control of the plant growth cycle, a choice is provided for genetic improvement of new plant varieties, and the application value is important.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to a transcription factor. ZmbHLH180 Genes and their encoded proteins and their applications. Background Technology

[0002] Senescence is the final stage of leaf development, most notably characterized by leaf yellowing caused by chlorophyll degradation. This process can be triggered by natural developmental processes or induced by environmental stresses such as drought and high temperatures. Its core regulatory mechanism relies on the expression of chlorophyll-degrading enzyme genes. During chlorophyll degradation, non-yellow coloring (NYELLOW COLORING)... NYC As a key initiating enzyme, it is responsible for catalyzing the degradation of chlorophyll b into chlorophyll a, which is also the first step in the degradation of chlorophyll b. Knockout... NYC Genes can increase the greenness retention of plant leaves and effectively delay drought-induced leaf senescence.

[0003] As one of the world's three major staple crops, maize (Zea mays) is facing a severe challenge to its production stability due to climate change. When drought occurs, maize accelerates its aging process. NYC Enzymes that accelerate chlorophyll breakdown ultimately lead to decreased photosynthetic function and leaf senescence. This can cause seedling death during the seedling stage and insufficient grain filling during the grain-filling stage, resulting in a significant yield reduction. Therefore, identification and regulation are crucial. NYC Upstream transcription factors of chlorophyll-degrading enzyme genes are crucial for breeding stress-resistant new varieties.

[0004] The bHLH transcription factor family is one of the largest families of plant transcription factors, playing a crucial role in plant growth and development, such as floral organ formation, secondary metabolism regulation, and resistance to external stresses. Currently, the molecular mechanisms by which drought-induced bHLH transcription factors regulate chlorophyll degradation pathways remain unclear. In-depth analysis of the drought-induced chlorophyll metabolism regulatory network will not only provide molecular markers for the creation of drought-resistant maize varieties but also drive breakthroughs in drought-resistant breeding technologies. More importantly, revealing the physiological and molecular basis of drought-regulated leaf senescence can enrich the theoretical system of crop stress resistance and provide new strategies for addressing food security challenges under climate change. Summary of the Invention

[0005] In order to overcome the shortcomings of the prior art, the purpose of this invention is to provide a maize ZmbHLH180 gene and its application.

[0006] The present invention achieves the above objectives through the following technical solutions: This invention provides a transcription factor ZmbHLH180 gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] The present invention also provides a protein encoded by the transcription factor ZmbHLH180 gene as described above, the amino acid sequence of which is shown in SEQ ID NO.2.

[0008] This invention also provides an application of the transcription factor ZmbHLH180 gene as described above in regulating plant leaf senescence, specifically: when the plant is Arabidopsis thaliana, the ZmbHLH180 gene controls plant leaf senescence by positively regulating the expression of the chlorophyll degradation gene AtNYC1; when the plant is maize, under drought conditions, the ZmbHLH180 gene controls plant leaf senescence by positively regulating the expression of the chlorophyll degradation gene NYC.

[0009] As a further optimization of the present invention, the Arabidopsis thaliana variety is Columbia Col-0, and the maize variety is B104.

[0010] The present invention has the following beneficial effects: 1) This invention provides a transcription factor ZmbHLH180 gene, whose full-length CDS is 864 bp, encoding 287 amino acids, and is mainly located in the cell nucleus. Overexpression of the ZmbHLH180 gene in Arabidopsis thaliana significantly promotes the expression of the chlorophyll degradation gene AtNYC1 and promotes leaf senescence. Overexpression of the ZmbHLH180 gene in maize significantly promotes leaf chlorosis under drought stress, laying a certain technical foundation for the regulation of plant growth cycle, providing selection for the genetic improvement of new plant varieties, and has important application value. 2) The results of the yeast one-hybrid experiment of this invention show that ZmbHLH180 can directly bind to the promoter of the NYC gene, and ZmbHLH180 can promote the transcription of the NYC gene. The ZmbHLH180 gene provided by this invention can be used in the future to delay crop senescence using gene editing technology. Attached Figure Description

[0011] Figure 1 This is a subcellular localization map of the ZmbHLH180 gene in maize protoplasts; Figure 2 This is a graph showing the results of detecting the expression level and protein content of the ZmbHLH180 gene in transgenic Arabidopsis thaliana lines; Figure 3 This is a comparison diagram of the senescence phenotype during the flowering period of transgenic Arabidopsis thaliana (overexpressing the ZmbHLH180 gene) and wild-type Arabidopsis thaliana. Figure 4 This is a comparison chart of the total chlorophyll content between transgenic Arabidopsis thaliana lines and wild-type Arabidopsis thaliana. Figure 5 This is a comparison of the expression levels of the chlorophyll degradation gene AtNYC1 between transgenic Arabidopsis thaliana lines and wild-type Arabidopsis thaliana. Figure 6 This is a graph showing the results of detecting the expression level and protein content of the ZmbHLH180 gene in transgenic maize lines; Figure 7 This is a comparison diagram of the aging phenotypes of transgenic maize lines (overexpressing the ZmbHLH180 gene) and wild-type maize under normal conditions (CK) and drought treatment (TR). Figure 8 This is a comparison chart of the total chlorophyll content of transgenic maize lines and wild-type maize under drought treatment; Figure 9 This is a comparison of the expression levels of the chlorophyll degradation gene NYC between transgenic maize lines and wild-type maize under drought treatment. Figure 10 This is a diagram showing the experimental results of ZmbHLH180 regulating NYC promoter transcription; Figure 11 This is a diagram showing the results of a yeast one-hybrid (Y1H) experiment; Figure 12 This is a phylogenetic tree of the ZmbHLH180 protein. Detailed Implementation

[0012] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0013] I. Materials Unless otherwise specified, the methods used in this embodiment are conventional methods known to those skilled in the art, and the reagents and materials used are commercially available products.

[0014] II. Methods 2.1 Subcellular localization The full-length coding sequence of the ZmbHLH180 gene (CDS full-length 864 bp, as shown in SEQ ID NO.1, encoding 287 amino acids as shown in SEQ ID NO.2) was fused with green fluorescent protein (GFP) and cloned into the pCambia1305 vector driven by the cauliflower mosaic virus (CaMV) 35S promoter to generate the ZmbHLH180-GFP recombinant plasmid. Subsequently, the recombinant plasmid was transformed into maize protoplasts by PEG percolation. The NLS (nuclear localization signal) of Saccharomyces cerevisiae was fused with red fluorescent protein (RFP) as a nuclear marker. After the cells were cultured in the dark at 26°C for 24 hours, images were taken using a Carl Zeiss LSM800 confocal laser scanning microscope.

[0015] The results are as follows Figure 1 As shown in the figure, the experiment indicates that the ZmbHLH180 protein is located in the cell nucleus.

[0016] 2.2 Experiments on overexpression of the ZmbHLH180 gene To investigate the function of the ZmbHLH180 gene, it was overexpressed in Arabidopsis thaliana and maize, as detailed below: The full-length CDS sequence of the ZmbHLH180 gene was obtained by amplification using amplification primers. Two recombinant plasmids were constructed into the plant expression vectors pCambia1305-35S-GFP (Arabidopsis thaliana) and pCambia1305-Ubi-FLAG (maize) via homologous recombination. These plasmids were then introduced into Arabidopsis thaliana (Columbia Col-0) and maize (maize B104) through genetic transformation to obtain transgenic plants. Transgenic lines of Arabidopsis thaliana (OE#3, 6, 14) and maize (OE#4, 12, 15) were obtained after screening and identification. The nucleotide sequences of the amplification primers are shown below: SEQ ID NO.3: ZmbHLH180-F: 5'>ATGGCAAGCTTCCCACACC<3'; SEQ ID NO.4: ZmbHLH180-R: 5'>CTGGAAAGGGCACATGTGG<3'.

[0017] (1) Experiments with transgenic Arabidopsis thaliana overexpressing the ZmbHLH180 gene Wild-type Arabidopsis thaliana (Col-0) and transgenic Arabidopsis thaliana lines overexpressing the ZmbHLH180 gene (OE#3, 6, 14) were cultured and grown in a greenhouse at 22℃ under a photoperiod of 16 hours light / 8 hours dark. The expression level and protein content of the ZmbHLH180 gene in wild-type and transgenic Arabidopsis thaliana lines were detected by quantitative real-time PCR (using AtUBC as an internal control gene) and Western blot, respectively. The results are shown below. Figure 2 As shown; and observe and record the phenotypic traits of Arabidopsis thaliana plants during their peak flowering period as follows. Figure 3 As shown; the results of the total chlorophyll content determination are as follows. Figure 4 As shown; the expression level detection results of the chlorophyll degradation gene NYC1 are as follows. Figure 5 As shown; The real-time PCR primers used to detect the expression level of the ZmbHLH180 gene are shown below: SEQ ID NO.5: qAtUBC-F: 5'>CTGCGACTCAGGGAATCTTCTAA<3'; SEQ ID NO.6: qAtUBC-R: 5'>TTGTGCCATGAATTGAACCC<3'; SEQ ID NO.7: qZmbHLH180-F: 5'>GCTCGCTCCAAGGACTCAAA<3'; SEQ ID NO.8: qZmbHLH180-R: 5'>GTGGTTGTCCGTTGCTTGTC<3'; The real-time PCR primers used to detect the expression level of the chlorophyll degradation gene AtNYC1 (gene number AT4G13250, GenBank Accession: NM_117396) are shown below: SEQ ID NO.9: qAtNYC1-F: 5'>CAGTGGTTCGAGCATTAAAA<3'; SEQ ID NO. 10: qAtNYC1-R: 5'>ACAATATCCGAGGAGGAGTT<3'.

[0018] based on Figure 2-5The experimental results showed that the expression level of the ZmbHLH180 gene in transgenic Arabidopsis thaliana lines was significantly higher than that in wild-type Arabidopsis thaliana, and the ZmbHLH180-GFP protein was significantly enriched in transgenic Arabidopsis thaliana lines as detected by GFP antibody. Furthermore, the rosette leaves of transgenic Arabidopsis thaliana lines were significantly more yellow than those of wild-type Arabidopsis thaliana during the full flowering period. The total chlorophyll content of transgenic Arabidopsis thaliana lines was significantly lower than that of wild-type Arabidopsis thaliana. Moreover, the expression of the chlorophyll metabolism-related gene AtNYC1 was significantly upregulated. These results indicate that overexpression of the ZmbHLH180 gene in Arabidopsis thaliana significantly promotes chlorophyll metabolism and leaf senescence.

[0019] (2) Transgenic maize experiment overexpressing the ZmbHLH180 gene Wild-type maize (WT) and transgenic maize lines overexpressing the ZmbHLH180 gene (OE#4, 12, 15) were cultured and grown under a 12-hour light / 12-hour dark cycle at 28°C (light) and 22°C (dark). Irrigation was provided to ensure all plants had sufficient moisture. When the maize plants developed four leaves, the normal culture group served as a control, while the drought treatment group stopped irrigation and received 20 ml of water every other day to gradually achieve drought conditions until significant phenotypic differences appeared. Quantitative real-time PCR (using ZmGAPDH as an internal reference gene) and Western blot were used to detect the expression level and protein content of the ZmbHLH180 gene in wild-type and transgenic maize lines, respectively. The structural analysis results are shown below. Figure 6 As shown; and observe and record the phenotypic traits of the plants, such as Figure 7 As shown; the results of the total chlorophyll content determination are as follows. Figure 8 As shown; the expression level detection results of the maize chlorophyll degradation gene NYC (gene number Zm00001d039312, GenBank accession: ONM28273) are as follows. Figure 9 As shown; The primers for the internal reference gene used in real-time PCR to detect the expression level of the ZmbHLH180 transgene are: SEQ ID NO.11: qZmGAPDH-F:5'>CCTGCTTCTCATGGATGGTTG<3'; SEQ ID NO. 12: qZmGAPDH-R:5'>CTGTCACAGATGGTAGCAGGAAGG<3'.

[0020] based on Figure 6-9The experimental results showed that the expression level of the ZmbHLH180 gene in transgenic maize lines was significantly higher than that in wild-type maize. Under drought treatment, all transgenic maize lines showed leaf yellowing phenotype. The total chlorophyll content of transgenic maize lines overexpressing the ZmbHLH180 gene was significantly lower than that of wild-type maize, and the expression of the chlorophyll metabolism gene NYC was significantly upregulated. These results indicate that overexpression of the ZmbHLH180 gene in maize also promotes chlorophyll metabolism under drought induction.

[0021] 2.3 Verification Experiment of ZmbHLH180 Regulating NYC (1) Transcription activation experiment in tobacco leaves Specific amplification primers were designed, the NYC promoter proNYC was cloned and ligated into the pGreenII-0800-LUC vector, transformed into Agrobacterium, and then mixed with pCambia1305-35S:ZmbHLH180-GFP Agrobacterium and injected into tobacco. The regulatory effect of ZmbHLH180 on the NYC promoter was detected. The amplification primers used to amplify the NYC promoter are as follows: SEQ ID NO.13: ProNYC-F:5'>TACCGCGCTAGGATACAGCAC<3'; SEQ ID NO. 14: ProNYC-R: 5'>GGCGCGGCGTGCAGATAA<3'.

[0022] based on Figure 10 The experimental results (quantitative LUC activity analysis of NYC promoter activation) showed that overexpression of the ZmbHLH180 gene significantly promoted the transcriptional level of the NYC promoter.

[0023] (2) Yeast one-hybrid (Y1H) experiment In the Y1H experiment, the NYC promoter was cloned into the pAbAi vector to construct the pAbAi-proNYC bait plasmid. The transcriptional activation domain AD of the yeast GAL4 transcription factor was linked to ZmbHLH180 to construct the fusion protein AD-ZmbHLH180. Using AD-ZmbHLH180 as the bait protein, pAbAi-proNYC was transformed into Y1H Gold yeast cells using PEG4000-induced transformation technology and cultured on SD medium lacking uracil. After 3 days of culture, clones capable of preparing competent cells were screened. These cells were then transformed with AD-ZmbHLH180. Cells containing pAbAi-proNYC were cultured on SD medium lacking leucine with 850 ng / mL AbA added. After 4 days of further growth, the yeast clones were imaged and analyzed.

[0024] based on Figure 11 The experimental results showed that the binding of ZmbHLH180 to the NYC promoter was detected by yeast one-hybrid assay. The results showed that yeast containing ZmbHLH180 could grow on a medium containing 850 mmol / L basidiosin, indicating that ZmbHLH180 can bind to the NYC promoter.

[0025] 2.4 Homology Analysis A phylogenetic tree of ZmbHLH180 was constructed using MEGA7 software, and evolutionary relationships were analyzed. The results are as follows: Figure 12 As shown, phylogenetic analysis revealed that ZmbHLH180 is distantly related to PIF4 and ZmbHLH106, which have been reported to regulate leaf senescence. This indicates that ZmbHLH180 is a novel gene that regulates leaf senescence and is distantly related to other members of the bHLH family.

[0026] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. A transcription factor ZmbHLH180 gene, characterized in that: The nucleotide sequence of the transcription factor ZmbHLH180 gene is shown in SEQ ID NO.

1.

2. The protein encoded by the transcription factor ZmbHLH180 gene as described in claim 1, characterized in that: The amino acid sequence of the protein encoded by the transcription factor ZmbHLH180 gene is shown in SEQ ID NO.

2.

3. An application of the transcription factor ZmbHLH180 gene as described in claim 1 in regulating plant leaf senescence.

4. The application according to claim 3, characterized in that, The plant in question is Arabidopsis thaliana, and the ZmbHLH180 gene controls leaf senescence by positively regulating the expression of the chlorophyll degradation gene AtNYC1.

5. The application according to claim 4, characterized in that, The Arabidopsis thaliana variety in question is Colombia Col-0.

6. The application according to claim 3, characterized in that, The plant in question is maize. Under drought conditions, the ZmbHLH180 gene controls leaf senescence by positively regulating the expression of the chlorophyll degradation gene NYC.

7. The application according to claim 6, characterized in that, The corn variety mentioned is B104.

Images