Rice salt stress regulation gene OsBBX11 and application thereof

By knocking out the OsBBX11 gene in rice and using the CRISPR/Cas9 system to reduce the expression of OsBBX11 protein, the problem of rice response to salt stress was solved, and a transgenic rice with stronger salt tolerance was bred, which improved its growth adaptability in saline soil.

CN120966843APending Publication Date: 2025-11-18INST OF BOTANY CHINESE ACAD OF SCI +1

Patent Information

Application Number
CN202511342974.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-19
Publication Date
2025-11-18

AI Technical Summary

Technical Problem

Soil salinization poses a serious threat to rice growth, and existing technologies are insufficient to effectively regulate rice's response to salt stress, thus affecting yield and stability.

Method used

By knocking out the OsBBX11 gene in rice plants and using the CRISPR/Cas9 system to reduce the expression level of OsBBX11 protein, salt stress phenotypes can be altered, and salt-tolerant plants can be bred.

Benefits of technology

Under salt stress, transgenic rice exhibits lower salt sensitivity, providing a theoretical basis for breeding new salt-tolerant crop varieties and improving the growth adaptability of rice in saline soils.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120966843A_ABST
    Figure CN120966843A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene engineering, in particular to a rice salt stress regulation gene OsBBX11 and application thereof, and the nucleotide sequence of the rice salt stress regulation gene OsBBX11 is as shown in SEQ ID NO. 1. The nucleotide sequence of the CDS sequence of the rice salt stress regulation gene OsBBX11 is as shown in SEQ ID NO. 2. The OsBBX11 gene is subjected to CRISPR (clustered regularly interspaced short palindromic repeats) gene editing to obtain transgenic rice, compared with receptor rice Dongjing rice, after three different strains of the OsBBX11 gene knockout mutant of the transgenic rice are subjected to 180mM NaCl simulated salt stress treatment, the phenotype is observed, the survival rate after recovery treatment is counted, it is confirmed that the osbbx11 mutant shows a salt sensitive phenotype compared with a wild type, and the OsBBX11 gene knockout mutant shows a salt sensitive phenotype. The OsBBX11 gene plays an important role in the process of responding to rice salt stress.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of genetic engineering, and in particular to a salt stress regulation gene OsBBX11 of rice and application thereof. BACKGROUND

[0002] As the staple food of nearly half of the world's population, rice is undoubtedly one of the most critical crops for maintaining food security. The stability and improvement of its yield are directly related to the foundation of national food supply. However, the increasingly severe global warming trend is bringing a series of serious challenges, among which the continuous deterioration of soil salinization is particularly worrying. Factors such as high temperature, rising sea level and uneven precipitation have jointly led to a continuous increase in the concentration of salt in the soil, and a significant expansion of the area of saline land. This high-salt environment poses a serious threat to rice growth in multiple aspects: it interferes with the normal absorption of water and nutrients by the roots, disrupts cell osmotic balance, inhibits key physiological processes, and can cause ion toxicity. Therefore, soil salinization has become a major environmental stress factor that seriously restricts the stable and high yield of rice in the present and future.

[0003] The OsBBX11 protein involved in the application belongs to the B-box (BBX) protein family, which is a class of zinc finger transcription factors containing one or two B-box motif B-box domains, and some also have CCT (CONSTANS, CO-like and TOC1) domains. Zinc finger transcription factors are a relatively large family of transcription factors in plants (about 15% of the total), which play a core role in plant growth and development. Zinc finger proteins contain zinc finger domains, which are stabilized by metal ions such as zinc ions, and have the characteristics of interacting with DNA, RNA or proteins. The BBX family is a functionally diverse protein family, and its genes are highly conserved in all multicellular species, including blue-green algae and moss. A large number of studies on Arabidopsis thaliana have found that BBX proteins control processes such as seedling photomorphogenesis, photoperiod-regulated flowering, shade avoidance response, and responses to biotic and abiotic stress. This study found that after CRISPR gene editing knockout of the OsBBX11 gene, compared with the recipient rice Dongjing (DJ for short), the three different strains of osbbx11 knockout mutants showed salt-sensitive phenotypes after salt stress treatment, proving that the OsBBX11 gene plays an important role in responding to salt stress in rice. Subsequent research on the OsBBX11 gene and its downstream regulatory genes will have important significance for the salt-tolerant growth of rice. SUMMARY

[0004] Based on the deficiencies in the prior art, the primary objective of this invention is to provide a rice salt stress regulatory gene, OsBBX11. By knocking out the OsBBX11 gene in rice plants, this invention found that, compared with the recipient rice variety Dongjing, the two lines of the osbbx11 knockout mutant exhibited a salt-sensitive phenotype after salt stress treatment, thus successfully altering the salt stress phenotype of the target plant.

[0005] Another objective of this invention is to provide a polypeptide, namely the protein OsBBX11, whose amino acid sequence is shown in SEQ ID NO.3. Knocking out the OsBBX11 gene significantly reduces the expression level of the OsBBX11 protein, thereby causing the plant to exhibit a salt-sensitive phenotype.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides a rice salt stress regulatory gene OsBBX11, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] Preferably, the nucleotide sequence of the CDS sequence of the rice salt stress regulatory gene OsBBX11 is shown in SEQ ID NO.2.

[0009] The present invention also provides an OsBBX11 protein encoded by the rice salt stress regulatory gene OsBBX11, wherein the OsBBX11 protein is any one of the following:

[0010] (A1) The amino acid sequence is that of the protein shown in SEQ ID NO.3;

[0011] (A2) A protein that is more than 90% identical to the protein shown in (A1) and is associated with rice salt stress, obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO.3.

[0012] (A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

[0013] The present invention also provides biological materials containing the rice salt stress regulatory gene OsBBX11, wherein the biological materials are one or more of the following: expression cassette, recombinant vector, recombinant microorganism, or transgenic plant cell line.

[0014] This invention also provides applications of the rice salt stress regulatory gene OsBBX11, including one or more of the following applications:

[0015] (B1) Application in regulating plant salt tolerance;

[0016] (B2) Application in cultivating salt-tolerant / salt-intolerant plants;

[0017] (B3) Application in the preparation of products that improve / reduce plant salt tolerance;

[0018] (B4) Application in plant breeding.

[0019] Preferably, the plant is a monocotyledonous plant or a dicotyledonous plant.

[0020] The present invention also provides a method for cultivating salt-sensitive plants, comprising reducing the expression of the rice salt stress regulatory gene OsBBX11 in the target plant to obtain a transgenic plant with lower salt tolerance than the target plant.

[0021] Preferably, the reduction in the expression of the rice salt stress regulatory gene OsBBX11 is achieved by knocking out the rice salt stress regulatory gene OsBBX11 using the CRISPR / Cas9 gene editing system, thereby significantly reducing its expression level.

[0022] Preferably, the target plant is a monocotyledonous plant or a dicotyledonous plant.

[0023] The present invention has the following technical effects and advantages:

[0024] This invention experimentally demonstrates that knocking down the OsBBX11 gene in wild-type rice can yield transgenic rice with altered salt stress phenotypes. Compared to the recipient rice, OsBBX11 gene expression is reduced in the transgenic rice, with no significant difference in heading date under long-day and short-day conditions. Therefore, the OsBBX11 gene is associated with rice's response to salt stress, laying a theoretical foundation for breeding transgenic plants that positively regulate salt stress response.

[0025] This invention has important theoretical significance for further elucidating the molecular mechanism of plant regulation of salt stress and for cultivating new salt-tolerant crop varieties through genetic engineering. Attached Figure Description

[0026] Figure 1 The mutation types of the osbbx11 mutants in the DJ background obtained using CRISPR / Cas9 technology were named osbbx11-L1, osbbx11-L2, and osbbx11-L3, respectively. All three belong to loss-of-function mutants.

[0027] Figure 2Phenotypic images of wild-type DJ and mutants osbbx11-L1, osbbx11-L2, and osbbx11-L3 after 180 mM NaCl salt stress treatment were obtained. First, photos were taken before treatment. During treatment, 180 mM NaCl was added to the nutrient solution. Photos were taken after 21 days of treatment. Then, normal nutrient solution without salt was added during recovery. Photos were taken after 7 days of recovery, and the survival rate was calculated.

[0028] Figure 3 A statistical chart showing the survival rate of homozygous mutants osbbx11-L1, osbbx11-L2, osbbx11-L3 and wild-type DJ three-week-old seedlings after salt stress recovery. Detailed Implementation

[0029] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0030] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0031] The experimental material used in this study was the commonly used japonica rice variety Dongjing (abbreviated as DJ).

[0032] The CRISPR / Cas9 vectors used in the following examples were kindly provided by the laboratory of Liu Yaoguang at South China Agricultural University.

[0033] The Agrobacterium EHA105 competent cells in the following examples were produced in our laboratory, and the same competent cells are also available commercially.

[0034] The rice seedling cultivation method used in the following embodiments of the present invention is as follows: Well-developed and plump seeds are selected and soaked in distilled water in a 37°C incubator for 48 hours, with the water changed every 12 hours. Germination is then continued for 11 hours under a humid environment. Seeds with consistent germination are selected and placed in bottomless 96-well plates, then placed in culture boxes containing Kimura B rice nutrient solution for growth. Greenhouse growth conditions are 12 hours of light / 12 hours of darkness at a temperature of 28°C. The rice nutrient solution is replaced with fresh solution every 3 days during the cultivation process.

[0035] Example 1: Cloning of the rice salt stress response gene OsBBX11

[0036] The inventors of this invention isolated and cloned a salt stress-responsive rice gene OsBBX11 from the rice variety Dongjing. Its nucleotide sequence is shown in SEQ ID NO.1, and the protein it encodes is named OsBBX11 protein, whose amino acid sequence is shown in SEQ ID NO.3.

[0037] Total RNA was extracted from rice DJ and reverse transcribed into cDNA. PCR amplification was performed using primers F (as shown in SEQ ID NO.4): ATGAGGATCCAGTGCGACGCGT and R (as shown in SEQ ID NO.5): TCATCCAAGATCAGGAACG. The PCR system was as follows: 10 μL of 2×Rapid Taq MasterMix (Vazyme), 1 μL of template, 0.5 μL each of forward primer (F) and reverse primer (R), and 8 μL of ddH2O, for a total of 20 μL. The PCR reaction program was: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min. The PCR products were then subjected to Sanger sequencing. Sequencing results showed that the nucleotide sequence of the PCR amplification product was as shown in SEQ ID NO.1, and its coding sequence was nucleotides 1-774 shown in SEQ ID NO.2, encoding the protein OsBBX11 shown in SEQ ID NO.3 (amino acids 1-257 shown in SEQ ID NO.3); the DNA shown in SEQ ID NO.1 was named the OsBBX11 gene.

[0038] Example 2: Construction of OsBBX11 gene deletion mutant rice

[0039] (1) Construction of vector and recombinant bacteria

[0040] Suitable targets were screened on the E-CRISPR website (http: / / www.e-crisp.org / E-CRISP / designcrispr.html) using the DNA sequence shown in SEQ ID NO.1. Based on the score and target location, the nucleotide sequences shown in SEQ ID NO.6 (CGACGAGCCCATCCACGTCC) and SEQ ID NO.7 (GAGGGGGTACATCGGCATG) located on exon OsBBX11 were selected as the two CRISPR / Cas9 targets. The primer sequences were synthesized as follows: F1 (as shown in SEQ ID NO. 8): ggcaCGACGAGCCCATCCACGTCC, R1 (as shown in SEQ ID NO. 9): aaacGGACGTGGATGGGCTCGTCG, F2 (as shown in SEQ ID NO. 10): ggcaGAGGGGGTACATCGGCATGC, and R2 (as shown in SEQ ID NO. 11): aaacCATGCCGATGTACCCCCTC. These were obtained according to the literature (Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu YG (2015) A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant). (8:1274-1284) pCRISPR / Cas9 plasmid was constructed, and the vector pCRISPR / Cas9-OsBBX11 was finally obtained. The plasmid pCRISPR / Cas9-OsBBX11 was transformed into Agrobacterium EHA105 competent cells to obtain recombinant Agrobacterium pCRISPR / Cas9-OsBBX11.

[0041] (2) pCRISPR / Cas9-OsBBX11 transformation of rice

[0042] The genetic transformation of rice was carried out by Wuhan Boyuan Biotechnology Co., Ltd., which obtained the T0 generation transgenic line of CRISPR / Cas9-OsBBX11 under the DJ background, namely the T0 generation of rice osbbx11 mutant.

[0043] Example 3: Identification of transgenic rice CRISPR / Cas9-OsBBX11 T0 generation plants

[0044] DNA was extracted from leaves of the T0 generation of the rice osbbx11 mutant. Using the extracted DNA as a template, PCR amplification was performed using specific primers for the OsBBX11 gene. The primer sequences were F (as shown in SEQ ID NO.4): ATGAGGATCCAGTGCGACGCGT; R (as shown in SEQ ID NO.5): TCATCCAAGATCAGGAACG. The PCR system was as follows: 10 μL of 2×RapidTaq Master Mix (Vazyme), 1 μL of template, 0.5 μL each of forward primer (F) and reverse primer (R), and 8 μL of ddH2O, for a total of 20 μL. The PCR reaction program was: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min. The PCR products were subjected to Sanger sequencing to check for mutations at the target site.

[0045] The extraction of DNA from the leaves was performed according to the CTAB method: Rice leaves were placed in a 2.0 mL centrifuge tube, and steel balls were added to grind them into powder using a grinder. 400 μL of CTAB extraction buffer was added to the centrifuge tube and vortexed to mix. An equal volume of a 1:1 mixture of chloroform and phenol was added, vortexed to mix, and centrifuged at 12000 rpm for 10 min. 200 μL of the supernatant was collected, and an equal volume of chloroform was added, vortexed vigorously to mix, and centrifuged at 12000 rpm for 10 min. 100 μL of the supernatant was collected, and twice the volume of anhydrous ethanol was added to precipitate at 0 °C for 10 min. Centrifugation was then performed at 4 °C and 12000 rpm for 10 min. The supernatant was discarded, and the mixture was washed twice with 500 μL of 75% ethanol, dried, and dissolved in 30 μL of ddH2O.

[0046] The identification results showed that two independent transgenic plants with mutations in the OsBBX11 gene were finally identified (osbbx11-L1 and osbbx11-L2, osbbx11-L3, respectively). DNA sequence alignment revealed the mutation sites as follows: Figure 1 As shown in the diagram, osbbx11-L1 loses a single G base, causing a frameshift mutation in the OsBBX11 gene, resulting in loss of function. osbbx11-L2 inserts a 19bp base, also resulting in a frameshift mutation and loss of function. osbbx11-L3 inserts a 1bp base, also resulting in a frameshift mutation and loss of function.

[0047] Example 4: Salt tolerance analysis of osbbx11 mutant plants

[0048] Following the same culture conditions, after three weeks of growth of wild-type DJ and osbbx11-L1, osbbx11-L2, and osbbx11-L3 mutant materials, 180 mM NaCl stress treatment was initiated. After 14 days of treatment, photos were taken of both the treated and untreated materials. Then, recovery treatment was initiated, and after 14 days of recovery, photos were taken again. Figure 2 As shown, where Figure 2 In this context, osbbx11-L1 represents line 1, a mutant strain of the OsBBX11 gene. Figure 2 In this context, osbbx11-L2 represents line 2, a mutant strain of the OsBBX11 gene. Figure 2 In this context, osbbx11-L3 represents line 3 of the OsBBX11 gene mutant, and DJ represents wild-type DJ. After 14 days of recovery treatment, the survival rates of DJ and osbbx11-L1, osbbx11-L2, and osbbx11-L3 were calculated. Figure 3 As shown, the survival rate of DJ was approximately 80%, while the survival rates of osbbx11-L1, osbbx11-L2, and osbbx11-L3 were only about 40%. This result indicates that the loss of function of the OsBBX11 gene leads to greater sensitivity of plants to salt stress. Therefore, the OsBBX11 gene plays a positive regulatory role in the plant's response to salt stress.

[0049] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A rice salt stress regulatory gene OsBBX11, characterized in that, The nucleotide sequence of the rice salt stress regulatory gene OsBBX11 is shown in SEQ ID NO.

1.

2. The rice salt stress regulatory gene OsBBX11 according to claim 1, characterized in that, The nucleotide sequence of the CDS sequence of the rice salt stress regulatory gene OsBBX11 is shown in SEQ ID NO.

2.

3. The OsBBX11 protein encoded by the rice salt stress regulatory gene OsBBX11 as described in claim 1 or 2, characterized in that, The OsBBX11 protein is any one of the following: (A1) The amino acid sequence is that of the protein shown in SEQ ID NO.3; (A2) A protein that is more than 90% identical to the protein shown in (A1) and is associated with rice salt stress, obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO.

3. (A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

4. A biomaterial comprising the rice salt stress regulatory gene OsBBX11 as described in claim 1 or 2, characterized in that, The biological material is one or more of the following: expression cassette, recombinant vector, recombinant microorganism, or transgenic plant cell line.

5. The application of the rice salt stress regulatory gene OsBBX11 as described in claim 1 or 2, characterized in that, The applications include one or more of the following: (B1) Application in regulating plant salt tolerance; (B2) Application in cultivating salt-tolerant / salt-intolerant plants; (B3) Application in the preparation of products that improve / reduce plant salt tolerance; (B4) Application in plant breeding.

6. The application according to claim 5, characterized in that, The plant is a monocotyledonous plant or a dicotyledonous plant.

7. A method for cultivating salt-sensitive plants, characterized in that, This includes reducing the expression of the rice salt stress regulatory gene OsBBX11 as described in claim 1 or 2 in the target plant, to obtain a transgenic plant with lower salt tolerance than the target plant.

8. The method according to claim 7, characterized in that, The reduction in the expression of the rice salt stress regulatory gene OsBBX11 was achieved by knocking out the rice salt stress regulatory gene OsBBX11 using the CRISPR / Cas9 gene editing system, which significantly reduced its expression level.

9. The method according to claim 8, characterized in that, The target plant is a monocotyledonous plant or a dicotyledonous plant.

Citation Information

Patent Citations

  • Plants having enhanced yield-related traits and a method for making the same

    CN102027120A

  • Application of Camellia oleifera CoBBX22 protein in regulation and control of plant drought tolerance

    CN115851813A

  • Rice salt stress regulation gene OsEra1 and application thereof

    CN118360289A

  • Gene enhancing anthocyanin biosynthesis derived from Oryza sativa and uses thereof

    KR1020180106316A

Cited By

  • Application of OsJAZ12 gene in regulation and control of plant salt stress response

    CN121759511A