Cotton GhVIP1 gene and application thereof in drought resistance and salt tolerance of plants

Abstract

The invention belongs to the technical field of plant breeding in molecular biology, and provides a cotton GhVIP1 gene and application thereof in drought resistance and salt tolerance of plants. The nucleotide sequence of the GhVIP1 gene is as shown in SEQ ID NO: 1, and the amino acid sequence of the GhVIP1 gene is as shown in SEQ ID NO: 2. The gene is obviously up-regulated under the induction of salt and drought stress. An arabidopsis thaliana homozygous line overexpressed with the GhVIP1 gene is obtained through a transgenic technology, under the stress of drought and salt, the seed germination rate of the arabidopsis thaliana overexpressed with the gene is higher than that of a wild type, the growth condition of a transgenic line in the seedling stage is better than that of the wild type, the stem length, the total antioxidant capacity and the chlorophyll content are all superior to those of the wild type, and the MDA content is lower than that of the wild type; further, the drought resistance and the salt resistance of the arabidopsis thaliana are improved. When the gene is applied to drought-resistant and salt-resistant breeding of plants, the drought resistance and salt resistance of the plants can be improved, and an effective alternative scheme is provided for molecular breeding of drought-resistant and salt-resistant crops.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular biology and plant breeding, and particularly relates to a cotton GhVIP1 gene and its application in plant drought resistance and salt tolerance. BACKGROUND

[0002] Drought and soil salinization have become a major challenge to global agricultural sustainable development, especially in arid and semiarid regions, where the two often interact to form a combined stress, severely restricting crop yield and quality. Cotton, as a globally important natural fiber crop, its growth and yield are often affected by drought stress and salt stress. China is one of the countries with the longest history of cotton planting. China has vast territory and vast cotton planting area. As of 2023, China's cotton cultivation area is about 50 million mu, and the yield accounts for 22.4% of the global total. At present, China's cotton planting area is mainly concentrated in the Xinjiang region of the northwest inland, which belongs to arid and semiarid regions and has soil salt parent material, and drought and salt stress often occur. Drought stress can inhibit cotton root development, but also significantly affect the growth of the aboveground part; drought can reduce the number of flower bud differentiation by 20%-30%, the bud and boll shedding rate is as high as 70%-80%, and the fiber length is shortened by 2-3 mm; although cotton is a "pioneer crop" in saline-alkali land and has a certain salt tolerance, salt stress still inhibits cotton root growth, the elongation rate of the main root decreases by 30%-40%, the number of lateral roots decreases, and the water absorption capacity decreases. The aboveground part shows slender stem, reduced leaf area, and under severe stress, the leaves turn yellow, curl, and even fall off. Therefore, the drought resistance and salt tolerance of cotton still need to be improved. In recent years, scientists have conducted extensive research on the drought resistance and salt tolerance of cotton, mined drought resistance and salt tolerance genes, created corresponding transgenic plants, and revealed the mechanism of drought resistance and salt tolerance of cotton, which not only helps to improve the drought resistance and salt tolerance of cotton, but also improves the land utilization rate and solves the problem of land competition between grain and cotton.

[0003] Drought stress not only directly limits water absorption, but also exacerbates ion toxicity by increasing the salt concentration in the root zone. Salt stress affects cotton growth through both ion toxicity and osmotic stress. High concentrations of Na⁺, Cl⁻ and other ions in the soil disrupt cell ion homeostasis, inhibit the absorption of essential elements such as K⁺ and Ca²⁺, leading to decreased stomatal conductance and photosynthetic rate, resulting in stunted plant growth and slow development. Disruption of reactive oxygen species (ROS) balance leads to accumulation of reactive oxygen species (ROS), causing membrane lipid peroxidation, increased malondialdehyde (MDA) content, increased membrane permeability, and electrolyte leakage, and even cell death under severe stress.

[0004] Transcription factors play an important role in the growth and development of higher plants and their response to the external environment. Plant bZIP (Basic leucine zipper) transcription factors play a major role in seed germination, flower development, biotic and abiotic stress responses. Studies have shown that there are 207 bZIP genes in Gossypium hirsutum, which can be divided into 13 subfamilies, namely A-I, S, M, K and J. Plant hormone abscisic acid (ABA) is related to seed development and abiotic stress response. ABA response element binding protein (AREB) or ABRE binding factor (ABF) is a bZIP protein in group A, which plays an important role in ABA and stress signaling. For example, ABI5 is involved in ABA or stress signaling, regulates seed size and development, seed germination and early growth of seedlings, and response to abiotic stress. Group B bZIP proteins have a transmembrane domain and a specific domain at the C-terminus, which is also important for salt stress response through endoplasmic reticulum stress signaling. For example, group G genes found in tomato have been shown to be negative regulators of salt stress tolerance. For group S, bZIP proteins are transcriptionally induced by salt treatment, resulting in increased salt stress tolerance. The expression changes of peanut bZIP genes under salt stress were investigated using RT-PCR technology, and it was confirmed that many candidate genes in groups A, B and S are related to salt stress response. Maize bZIP transcription factor ABF9 improves the salt tolerance and drought resistance of transgenic cotton. Gossypium hirsutum bZIP transcription factor ABF2 (bZIP36) improves the drought tolerance and salt tolerance of cotton and Arabidopsis. In the research of the present application, a cotton bZIP transcription factor GhVIP1 gene was cloned and identified, and through sequence structure, function analysis and expression pattern analysis, it was found that it was induced to express when subjected to drought and salt stress, and then transgenic plants were created by overexpression method, and the important role of the gene in plant drought resistance and salt tolerance was verified. SUMMARY

[0005] The purpose of the present application is to provide a cotton GhVIP1 gene and its new application in plant drought resistance and salt tolerance.

[0006] The first aspect of the present application provides a cotton GhVIP1 gene, wherein the GhVIP1 nucleotide sequence encoded by the gene is shown as SEQ ID No. 1, and the amino acid sequence encoded by the gene is shown as SEQ ID No. 2.

[0007] The second aspect of the present application provides an application of a cotton GhVIP1 gene in regulating plant drought resistance and salt tolerance, wherein the plant is cotton or Arabidopsis; and the application is to improve the drought resistance and salt tolerance of the plant by overexpressing the cotton gene GhVIP1 in the plant. For example, the cotton gene is introduced into the model organism Arabidopsis thalianaGhVIP1 , to obtain transgenic plants with stronger drought resistance and salt tolerance compared with the model organism.

[0008] The third aspect of the present application provides a method for obtaining drought-resistant and salt-tolerant crops, comprising the following steps: (1) obtaining the cotton GhVIP1 gene and connecting with the expression vector plasmid to construct a recombinant vector containing GhVIP1 ; (2) transforming the recombinant vector containing GhVIP1 into Agrobacterium tumefaciens competent cells by freeze-thaw method, and screening to obtain positive transformants; (3) transfecting the wild type crop with the bacterial liquid containing the positive transformant, harvesting the T0 generation after the crop matures, and screening the T0 generation to obtain transgenic crops with drought resistance and / or salt tolerance; (4) self-reproducing the transgenic crops, screening and harvesting the transgenic plants or seeds with stable traits; selecting the T3 generation GhVIP1 homozygotes with stable traits in the offspring after self-reproduction for reservation to obtain drought-resistant and salt-tolerant crops.

[0009] The present application first identifies a cotton GhVIP1 gene that can improve the drought resistance and salt tolerance of plants. By overexpressing the GhVIP1 gene in Arabidopsis thaliana, the drought resistance and salt tolerance can be improved.

[0010] The advantages and positive effects of the present application are: the sequence structure and expression pattern of the GhVIP1 gene are analyzed, and the important role of the GhVIP1 gene in the drought resistance and salt tolerance of plants is determined; the overexpression of the Figure 1 gene in Arabidopsis thaliana is obtained by transgenic technology, and after drought and salt stress treatment, it is found that the transgenic plants have higher chlorophyll content, lower malondialdehyde (MDA) content, and stronger total antioxidant capacity (T-AOC) compared with the wild type plants. Therefore, the present application has important significance in improving the drought resistance and salt tolerance of cotton breeding and research, and can be applied to breeding drought-resistant and salt-tolerant cotton varieties. BRIEF DESCRIPTION OF DRAWINGS

[0011] GhVIP1 The sequence structure and expression pattern of the cotton GhVIP1 gene: (A) the tertiary structure prediction of the GhVIP1 gene protein; (B) the hydrophilicity analysis of the GhVIP1 gene protein; (C) the expression pattern analysis of the GhVIP1 gene in different tissues and organs of cotton; (D) the expression pattern analysis of the Figure 2 gene in cotton after drought and salt stress treatment.

[0012] GhVIP1 cotton Figure 3 Subcellular localization of genes.

[0013] GhVIP1 Arabidopsis overexpression GhVIP1 Screening of transgenic lines: (A) T0 positive seedling screening; (B) T1 transgenic line PCR detection, wells 1-9 are transgenic lines, and well 10 is the wild type control (WT); (C) qRT-PCR detection of the expression level of in T2 transgenic lines. Figure 4

[0014] GhVIP1 Arabidopsis overexpression Figure 5 Germination rate analysis of transgenic lines after drought stress: (A) Phenotype of wild type plants and transgenic lines after 12 days of growth in different concentrations of mannitol medium; (B) Statistical analysis of the germination rate of wild type plants and transgenic lines every day during 12 days of growth in different concentrations of mannitol medium.

[0015] GhVIP1 Arabidopsis overexpression Figure 6 Phenotype and biochemical trait analysis of transgenic lines after 22 days of 20% PEG6000 drought stress: (A) Phenotype of wild type plants and transgenic lines after 22 days of 20% PEG6000 drought stress; (B) Analysis of plant height of wild type plants and transgenic lines after 22 days of drought stress and treatment; (C) Analysis of leaf green content of wild type plants and transgenic lines after 22 days of drought stress and treatment; (D) Analysis of total antioxidant capacity (T-AOC) of wild type plants and transgenic lines under drought stress; (E) Analysis of MDA content of wild type plants and transgenic lines under drought stress.

[0016] GhVIP1 Arabidopsis overexpression AtDREB1A Expression analysis of drought stress marker genes of transgenic lines: (A) Expression amount of drought marker genes under water and drought stress; (B) Expression amount of drought marker genes under water and drought stress. AtDREB2A Figure 7

[0017] GhVIP1 Arabidopsis overexpression Figure 8 Germination rate analysis of transgenic lines after salt stress: (A) Phenotype of wild type plants and transgenic lines after 12 days of growth in different concentrations of NaCl medium; (B) Statistical analysis of the germination rate of wild type plants and transgenic lines every day during 12 days of growth in different concentrations of NaCl medium.

[0018] GhVIP1 Arabidopsis overexpression GhVIP1 ​​​Phenotype and biochemical trait analysis of transgenic lines after 22 days of 350 mM NaCl salt stress: (A) phenotype of wild type and transgenic lines after 22 days of 350 mM NaCl salt stress; (B) analysis of plant height of wild type and transgenic lines after 22 days of salt stress; (C) analysis of leaf green content of wild type and transgenic lines after 22 days of salt stress; (D) analysis of total antioxidant capacity (T-AOC) of wild type and transgenic lines after salt stress; (E) analysis of MDA content of wild type and transgenic lines after salt stress. DETAILED DESCRIPTION

[0019] In order to better explain the present application, the scheme of the present application will be described in detail below in combination with examples. The methods used in the following examples are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0020] Example 1 Cotton GhVIP1 Sequence structure and expression pattern analysis of the gene.

[0021] Taking the standard line TM-1 of upland cotton as the research material, the full-length sequence of 972 bp (SEQ ID No. 1) of the gene was obtained from the cDNA of TM-1, which encodes a protein composed of 323 amino acid residues (SEQ ID No. 2). Figure 1 The three-dimensional structure of the conserved domain of GhVIP1 protein was predicted by using SWISS-MODEL software (A). The hydrophilicity analysis of GhVIP1 protein was performed by using Expasy website, and the result showed that the average coefficient of hydrophilicity of the protein was -0.791, which was a hydrophilic protein (B). Figure 1 In order to understand the expression pattern of the gene in different tissues and organs, the tissue samples of roots, stems, cotyledons and true leaves of the seedlings of TM-1 were taken when the plants grew to the three-leaf-one-heart stage, and the samples of roots, stems, leaves and flowers of the plants were taken at the full-bloom stage, and the RNA was extracted after quick freezing in liquid nitrogen, and the cDNA was reverse transcribed, and the expression amount of the gene in different organs was detected by using qRT-PCR. GhVIP1 The results showed that: GhVIP1 The expression in roots, stems and cotyledons was consistent at the seedling stage, but the expression in true leaves was lower; in the full-bloom stage plants, GhVIP1 the expression in various tissues was consistent, such as roots, stems, leaves and flowers (C). GhVIP1 In order to further explore the expression pattern of the gene in different tissues and organs, the expression of the gene in different tissues and organs was detected by using qRT-PCR. Figure 1 The results showed that: GhVIP1 The expression in roots, stems and cotyledons was consistent at the seedling stage, but the expression in true leaves was lower; in the full-bloom stage plants, GhVIP1Expression of upland cotton TM-1 plants in response to drought and salt stress. Upland cotton TM-1 plants at the three-leaf stage were irrigated with 18% PEG 6000 and 350 mM NaCl. Leaf samples were collected at 0, 1, 3, 6, 12, 24, and 48 h for qPCR analysis. The results showed that expression levels were higher in upland cotton TM-1 plants under drought stress (1 h and 12 h) and lower under salt stress (6 h). Figure 1 The expression level of was significantly increased ( GhVIP1 D). This indicates that Figure 2 It may play a role in the early stages of drought resistance and salt tolerance.

[0022] Example 2: Subcellular localization of the cotton GhVIP1 gene.

[0023] By constructing the pCMBIA2300-RFP-GhVIP1 fusion expression vector, one-month-old tobacco plants were transiently transformed with Agrobacterium, with tobacco plants transformed with the empty pCMBIA2300-RFP vector serving as a control. The fluorescence location of RFP was observed under a laser confocal microscope. The results showed that in plants injected with the empty vector, the fluorescence signal was located in the cell nucleus and cell membrane, while in plants injected with the pCMBIA2300-RFP-GhVIP1 fusion vector, the fluorescence signal was located in the cell nucleus. GhVIP1 This indicates that GhVIP1 is a nuclear localized protein that functions as a transcription factor in the cell nucleus.

[0024] Example 3 Overexpression in Arabidopsis thaliana GhVIP1 The role of genes in drought stress.

[0025] Screening of Arabidopsis thaliana lines overexpressing the GhVIP1 gene. GhVIP1 Specific primers for full-length cloning were designed based on the CDS coding region sequence of the gene (forward primer: AGAGGATCCCCGGGGGGTACCATGGACAAAATACCTCCTCG; reverse primer: CTAGGTTAACCATGTGGTACCCTAGGCTCCCTGGTTAAAATC). Using the cDNA of upland cotton TM-1 as a template, the clone was obtained by PCR amplification. GhVIP1The full-length sequence fragment was extracted, and the target band was recovered after agarose gel electrophoresis. It was then ligated into the pCMBIA2300 vector digested with KpnI. The ligation product was transformed into *E. coli* DH5α, and positive strains were detected. Plasmids were extracted from positive strains with consistent sequencing alignment. 2 μL of the constructed GhVIP1 overexpression vector was added to 20 μL of *Agrobacterium tumefaciens* GV3101 competent cells and incubated on ice for 30 minutes. The mixture was then flash-frozen in liquid nitrogen for 2 minutes, followed immediately by a 37°C water bath for 5 minutes. 600 μL of LB solution was added to the mixture, and the mixture was incubated at 28°C and 220 rpm for 2 hours. Finally, the mixture was evenly spread onto LB agar plates containing kanamycin and rifampicin. Colony PCR was used for detection. GhVIP1 The Agrobacterium-mediated positive transformants were used for subsequent transgenic experiments.

[0026] Arabidopsis overexpression GhVIP1 Screening of gene lines. Wild-type Arabidopsis thaliana Col-0 was sown in nutrient soil and grown under conditions of 20℃ and 16 h / 8 h light / dark cycles. When the plants reached full bloom, the transformed lines were seeded using the flower-dipping method. Figure 3 Agrobacterium tumefaciens infected Arabidopsis thaliana, and seeds of the T0 generation were harvested after the Arabidopsis matured. The T0 generation seeds were sown on 1 / 2 MS solid medium containing Kana (50 mg / mL) for positive seedling selection. Non-positive seedlings exhibited an albino phenotype, while positive seedlings showed a normal green color (…). Figure 3 A). Normally growing, green, positive seedlings were transplanted into nutrient soil. At maturity, individual seedlings were harvested and recorded as T1 generation seeds. T1 generation seeds were then sown on 1 / 2 MS solid medium containing Kana (50 mg / mL). The ratio of positive to non-positive seedlings was calculated, and single-copy lines meeting a segregation ratio of 3:1 were retained. Simultaneously, DNA was extracted from the leaves of each single-line seedling for PCR detection. Agarose gel electrophoresis was used to identify lines containing the target gene band. GhVIP1 B) After maturation, T2 generation seeds were obtained. These T2 seeds were then sown on 1 / 2 MS solid medium containing Kana (50 mg / mL). Lines containing only positive seedlings were transplanted to nutrient soil for further cultivation. RNA was extracted from the leaves of each individual seedling and detected by qRT-PCR. Figure 3 The expression levels of OE40, OE41, and OE46 were the highest. GhVIP1 C), as overexpression GhVIP1 After the genetically modified strain matures, T3 generation homozygous transgenic seeds are obtained for further experiments.

[0027] Arabidopsis overexpression Figure 4Germination rate analysis of transgenic lines after drought stress. Transgenic lines OE40, OE41, OE46 and wild-type Col-0 (WT) Arabidopsis thaliana were sown in normal 1 / 2 MS solid medium and 1 / 2 MS medium supplemented with mannitol at concentrations of 250 mM and 350 mM. Germination was recorded daily over 12 days, and the germination rate was calculated. Each treatment was repeated in triplicate. Figure 4 A). On standard 1 / 2 MS medium, there were no phenotypic differences between WT and the three positive OE lines. After mannitol-simulated drought treatment, germination and growth of the three OE lines and WT were inhibited, but the three OE lines were less sensitive to drought than WT. Seeds of both transgenic and control lines germinated on day 2 on 1 / 2 MS control medium, but after treatment with 250 mM mannitol, seeds of all lines did not begin germination until day 4, and the germination rate of WT seeds was significantly lower than that of the three OE lines. After treatment with 350 mM mannitol, seeds of OE40, OE41, and OE46 began germination on day 4, while WT seeds did not begin germination until day 5, and the germination rate of OE lines was significantly higher than that of WT. GhVIP1 B). The results indicate that overexpression in Arabidopsis thaliana... GhVIP1 It improved the resistance of Arabidopsis seeds to drought stress during the germination stage.

[0028] Arabidopsis overexpression Figure 5 Phenotypic and biochemical traits of transgenic lines under drought stress. Transgenic lines OE40, OE41, OE46 and wild-type Col-0 Arabidopsis thaliana WT were sown in nutrient soil. When they reached five weeks of age, plants of uniform growth were selected and irrigated with 20% PEG6000. Phenotypic characteristics were observed. The experiment was designed with three replicates. Figure 5 A). After 22 days of drought treatment, OE40, OE41, and OE46 showed significantly better growth and higher plant height compared to WT. Figure 5 B). The chlorophyll content of each strain was measured simultaneously using a SPAD-502 chlorophyll meter. GhVIP1 (C) The results showed that the chlorophyll content of the OE line was significantly higher than that of the WT line after drought stress. To reveal... Figure 5 The physiological and biochemical mechanisms of plant drought resistance were investigated, and the malondialdehyde (MDA) content and total antioxidant capacity (T-AOC) in Arabidopsis thaliana WT plants of OE40, OE41, OE46 and wild-type Col-0 were measured.

[0029] Total antioxidant capacity (T-AOC) determination: Total antioxidant capacity (T-AOC) is an important indicator for assessing the overall function of the antioxidant defense system in an organism or sample. It reflects the comprehensive ability of antioxidants (such as vitamin C, vitamin E, glutathione, superoxide dismutase, etc.) in an organism or sample to scavenge free radicals and resist oxidative stress. A total antioxidant capacity assay kit (Solarbio, Beijing, China, BC1315) is available; please refer to the instruction manual for specific operating procedures. Results showed that before treatment with 20% PEG6000, there was no significant difference in total antioxidant capacity among transgenic lines OE40, OE41, OE46 and wild-type Col-0. After treatment with 20% PEG6000, the total antioxidant capacity of transgenic lines OE40, OE41, and OE46 was higher than that of wild-type Col-0. Figure 5 D).

[0030] Dynamic changes in malondialdehyde (MDA) content: When plants are subjected to abiotic stress, they produce a large number of superoxide free radicals, which cause membrane lipid peroxidation and produce malondialdehyde (MDA), a commonly used indicator to measure the degree of oxidative stress. MDA content was detected using an activity assay kit (Solarbio, Beijing, China, BC0025). Specific operating procedures can be found in the instruction manual. Results showed that before treatment with 20% PEG6000, there was no significant difference in MDA content among the different lines. After treatment, the MDA content in the transgenic lines OE40, OE41, and OE46 was significantly lower than that in the wild-type Col-0. GhVIP1 E).

[0031] Arabidopsis overexpression GhVIP1 Expression analysis of drought stress marker genes in genetic lines. To study... AtDREB1A To investigate the molecular mechanisms involved in drought stress response, samples were taken from 3-week-old transgenic and WT seedlings treated with 20% PEG6000, and drought stress response marker genes were identified by real-time PCR analysis. AtDREB2A and GhVIP1 The transcriptional levels of drought stress response genes were not significantly changed in wild-type WT before and after drought treatment. However, the transcriptional levels of OE40, OE41, and OE46 lines were lower than those in WT before drought treatment. After drought treatment, the transcription of these genes in the OE lines was induced to increase significantly, and was significantly higher than that in WT. These results indicate... Figure 6 It is possible that tolerance to drought stress is increased by upregulating the expression of drought stress response genes. GhVIP1 AB).

[0032] These results indicate that overexpression GhVIP1 The gene can enhance Arabidopsis' resistance to drought stress.

[0033] Example 4 Overexpression in Arabidopsis thaliana GhVIP1 The role of genes in salt stress.

[0034] Arabidopsis overexpression Figure 7 Germination rate analysis of transgenic lines under salt stress. Transgenic lines OE40, OE41, OE46 and wild-type Col-0 (WT) Arabidopsis thaliana were sown in normal 1 / 2 MS solid medium and 1 / 2 MS medium supplemented with NaCl at concentrations of 100 mM, 150 mM, and 200 mM. Germination was recorded daily over 12 days, and the germination rate was calculated. Each treatment was repeated in triplicate. Figure 7 A). On 1 / 2 MS medium, there were no phenotypic differences between WT and the three positive OE lines. NaCl treatment inhibited germination and growth in both the three OE lines and WT, but the three OE lines were less sensitive to NaCl than WT. Seeds from both transgenic and control lines germinated on day 2 on 1 / 2 MS control medium, but after NaCl treatment, the germination rate of WT seeds was significantly lower than that of the three OE lines. From day 4 to 8 after treatment with 150 mM NaCl, the germination rates of OE40, OE41, and OE46 seeds were significantly higher than those of WT, but from day 9 to 12, the germination rates of OE40 and OE41 remained significantly higher than WT, while the germination rate of OE46 was similar to that of WT. GhVIP1 B).

[0035] Arabidopsis overexpression Figure 8 Phenotypic and biochemical traits of transgenic lines under salt stress. Transgenic lines OE40, OE41, OE46 and wild-type Col-0 Arabidopsis thaliana WT were sown in nutrient soil. When they reached five weeks of age, plants of uniform growth were selected and irrigated with 350 mM NaCl. Phenotypic characteristics were observed. The experiment was designed with three replicates. Figure 8 A). After 22 days of treatment, OE40, OE41, and OE46 showed significantly better growth than WT, exhibiting a marked increase in plant height ( Figure 8 B), and the chlorophyll content was also significantly higher than WT (B). Figure 8 C). The malondialdehyde (MDA) content and total antioxidant capacity (T-AOC) in Arabidopsis thaliana WT plants OE40, OE41, OE46, and wild-type Col-0 were also determined after salt treatment (methods are described in Example 3). Before treatment, there were no significant differences in total antioxidant capacity and MDA content among the transgenic lines OE40, OE41, OE46, and wild-type Col-0. After treatment with 350 mM NaCl, the total antioxidant capacity of the transgenic lines OE40, OE41, and OE46 was higher than that of the wild-type Col-0. Figure 8 D), malondialdehyde content was significantly lower than that of wild-type Col-0 (GhVIP1 E).

[0036] The above results indicate that overexpression GhVIP1 The gene enhanced the resistance of Arabidopsis thaliana to salt stress.

[0037] This invention analyzes cotton GhVIP1 Gene sequence structure and expression patterns were analyzed to identify responses to drought and salt stress. GhVIP1 The expression level of GhVIP1 was significantly upregulated, and GhVIP1 is a nuclear localized protein that functions as a transcription factor in the cell nucleus. Subsequently, transgenic technology was used to obtain overexpression... GhVIP1 Overexpression of the gene was found in homozygous Arabidopsis lines after salt and drought treatment. GhVIP1 The strains significantly enhanced the tolerance of Arabidopsis thaliana to drought and salt stress. Therefore, it is hoped that by creating strains that overexpress these strains, we can further improve their resistance. ​ Transgenic cotton materials will introduce target genes into widely cultivated upland cotton varieties to create new, high-quality upland cotton lines that are salt- and drought-resistant. Simultaneously, applying these genes to drought- and salt-tolerant breeding of other plants can improve their drought and salt tolerance, providing an effective alternative for molecular breeding of drought- and salt-tolerant crops.

[0038] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A type of cotton GhVIP1 Genes, characterized by, The GhVIP1 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

2. The cotton according to claim 1 GhVIP1 Genes, characterized by, The GhVIP1 The amino acid sequence encoded by the gene is shown in SEQ ID No.

2.

3. The cotton as described in claim 1 GhVIP1 Application of genes in plant drought and salt tolerance.

4. The cotton according to claim 3 GhVIP1 The application of genes in plant drought and salt tolerance is characterized by, By overexpressing the above in plants GhVIP1 Genes that enhance the drought and salt tolerance of plants.

5. The cotton according to claim 3 or 4 GhVIP1 The application of genes in plant drought and salt tolerance is characterized by, The plant in question is cotton or Arabidopsis thaliana.

6. A method for obtaining drought-resistant and salt-tolerant crops, characterized in that, Includes the following steps: (1) Obtaining the as described in claim 1 GhVIP1 Genes were ligated with expression vector plasmids to construct a gene containing... GhVIP1 Recombinant vectors; (2) containing GhVIP1 The recombinant vector was transformed into competent Agrobacterium tumefaciens cells using a freeze-thaw method, and positive transformants were obtained by screening. (3) Transfect wild-type crops with bacterial solutions containing positive transformants, harvest the T0 generation after the crops mature, and screen the T0 generation to obtain drought-resistant and / or salt-tolerant transgenic crops; (4) Self-pollinate the transgenic crop, screen and harvest transgenic plants or seeds with stable traits; select the T3 generation with stable traits from the self-pollinated offspring. GhVIP1 By retaining homozygous individuals, drought-resistant and salt-tolerant crops can be obtained.

Images