Sorghum striga resistance related proteins SbSLT1 and SbSLT2, and coding gene and application thereof

By regulating the expression or activity of the genes encoding SbSLT1 and SbSLT2 proteins in sorghum and using the CRISPR/Cas9 system for gene editing, the problem of unimpeded sorghum growth and development was solved, and effective resistance to strigolactone was achieved.

CN120966872APending Publication Date: 2025-11-18INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410615738.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-05-17
Publication Date
2025-11-18

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively reduce the germination rate of *Striga asiatica* seeds without affecting the growth and development of sorghum, and to block the secretion of SLs in the host to resist parasitism.

Method used

By regulating the expression or activity of the genes encoding SbSLT1 and SbSLT2 proteins in sorghum, gene editing was performed using the CRISPR/Cas9 system to achieve resistance to strigophyton in sorghum.

Benefits of technology

Without affecting the normal growth of sorghum, it significantly improved the resistance of sorghum to strigophyte and reduced the parasitism rate of strigophyte.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120966872A_ABST
    Figure CN120966872A_ABST
Patent Text Reader

Abstract

The invention discloses sorghum striga resistance related proteins SbSLT1 and SbSLT2 as well as encoding genes and application thereof, and belongs to the technical field of biology. A knockout experiment proves that the function deletion mutation of the SbSLT1 and SbSLT2 genes endows the sorghum with relatively strong striga asiatica parasitic resistance while not influencing the normal growth of the sorghum, and has great significance in anti-parasitic mechanism research and anti-parasitic breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to Sorghum bicolor related proteins SbSLT1 and SbSLT2, and encoding genes and applications thereof. BACKGROUND

[0002] Sorghum crop is the fifth largest food crop in the world, has strong drought resistance, waterlogging tolerance, and strong salt-tolerant characteristics, so that it can be widely planted in most parts of the world, however, the parasitic weed Striga often causes devastating damage to sorghum agricultural production. Striga is a facultative root parasitic plant, ranking among the world's seven major crop hazards, and is comparable to rice blast, small stripe rust, and potato late blight. The host range of Striga is very wide, and important cereal crops such as sorghum, maize, rice, and millet are all hosts of Striga, and Striga infection often causes crop yield reduction or even complete loss.

[0003] Striga seed germination is the starting point and the most important step in its life cycle. Studies have found that Striga lactones (SLs) secreted by host roots are Striga seed germination stimulants, and Striga seeds grow germination tubes after sensing SLs and begin their life cycle. Therefore, one of the important anti-parasitic ideas is to reduce the Striga seed germination rate by regulating the synthesis and secretion of SLs in the host body to achieve the purpose of anti-parasitism. However, SLs are also an important plant hormone in the plant body, responsible for regulating plant architecture, growth and development, etc., so blocking the SL synthesis pathway in the host body will cause serious growth and development inhibition of the host, which is not conducive to the normal growth of the plant. Therefore, it is crucial to study the host SL secretion process and reduce the Striga seed germination rate by blocking the secretion of SLs to the rhizosphere to endow the host with anti-parasitic ability. SUMMARY

[0004] The technical problem to be solved by the present application is to provide a new application of Sorghum bicolor anti-Striga related proteins SbSLT1 and SbSLT2. The technical problem to be solved is not limited to the technical subject described, and other technical subjects not mentioned herein can be clearly understood by those skilled in the art through the following description.

[0005] To solve the above technical problems, the present application provides the following technical solutions:

[0006] The present application provides the use of a protein or a substance regulating the expression of the encoding gene of the protein or a substance regulating the activity and / or content of the protein in any one of the following,

[0007] M1) regulating the Striga resistance of a plant;

[0008] M2) preparing a product for regulating the Striga resistance of a plant;

[0009] M3) increasing the resistance of a plant to striga;

[0010] M4) producing a product for increasing the resistance of a plant to striga;

[0011] M5) breeding a plant resistant to striga;

[0012] M6) plant breeding;

[0013] the protein is SbSLT2 and / or SbSLT1;

[0014] the SbSLT1 is any one of:

[0015] A1) a protein having an amino acid sequence of SEQ ID No. 1;

[0016] A2) a protein having an amino acid sequence of SEQ ID No. 1, obtained by substitution and / or deletion and / or addition of amino acid residues, having an identity of 95% or more to the protein shown in A1) and having the same function;

[0017] A3) a fusion protein having the same function, obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid shown in any one of A1) or A2);

[0018] the SbSLT2 is any one of:

[0019] R1) a protein having an amino acid sequence of SEQ ID No. 2;

[0020] R2) a protein having an amino acid sequence of SEQ ID No. 2, obtained by substitution and / or deletion and / or addition of amino acid residues, having an identity of 95% or more to the protein shown in R1) and having the same function;

[0021] R3) a fusion protein having the same function, obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid shown in any one of R1) or R2).

[0022] the tag protein includes, but is not limited to, a GST (glutathione S-transferase) tag protein, a His6 tag protein (His-tag), a MBP (maltose binding protein) tag protein, a Flag tag protein, a SUMO tag protein, a HA tag protein, a Myc tag protein, an eGFP (enhanced green fluorescent protein), an eCFP (enhanced cyan fluorescent protein), an eYFP (enhanced yellow green fluorescent protein), an mCherry (monomeric red fluorescent protein), or an AviTag tag protein.

[0023] The nucleotide sequence encoding the above-described protein of the present application can be easily mutated by a person skilled in the art using known methods, such as a method of directed evolution or a method of point mutation. Those nucleotides which are artificially modified and have 75% or more identity with the nucleotide sequence of the above-described protein isolated from the present application are derived from the nucleotide sequence of the present application and equivalent to the sequence of the present application, as long as they encode the above-described protein and have the function of the above-described protein.

[0024] The 75% or more identity described above can be 80%, 85%, 90% or 95% or more identity.

[0025] Herein, the identity refers to the identity of the amino acid sequence or the nucleotide sequence. The identity of the amino acid sequence can be measured using a homology search site on the Internet, such as the BLAST page of the NCBI homepage. For example, the value of the identity (%) can be obtained by performing a search in Advanced BLAST 2.1 using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, and setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values), respectively, and then calculating the identity of the amino acid sequence.

[0026] Herein, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0027] In the above-described use, the regulation can be up-regulation or enhancement or increase in the expression of the gene encoding the above-described protein or the content or activity of the protein, and the regulation can also be down-regulation or inhibition or decrease in the expression of the gene encoding the above-described protein or the content or activity of the protein.

[0028] In the above-described use, the substance which regulates the expression of the gene encoding the above-described protein or the substance which regulates the content or activity of the above-described protein is a substance which decreases the expression of the gene encoding the above-described protein in the cell.

[0029] In the above-described use, the substance is any one of:

[0030] B1) an RNA molecule which inhibits or decreases or down-regulates the expression of the gene encoding the protein or an RNA molecule which inhibits or decreases or down-regulates the activity or content of the protein;

[0031] B2) a gene comprising the RNA molecule of B1);

[0032] B3) an expression cassette comprising the gene of B2);

[0033] B4) a recombinant vector comprising the gene of B2), or a recombinant vector comprising the expression cassette of B3);

[0034] B5) a recombinant microorganism comprising the gene of B2), or a recombinant microorganism comprising the expression cassette of B3), or a recombinant microorganism comprising the recombinant vector of B4).

[0035] Among the above-mentioned substances, the expression cassette containing a nucleic acid molecule according to B3) means a DNA capable of expressing the above-mentioned protein in a host cell. The expression cassette can also comprise single- or double-stranded nucleic acid molecules of all regulatory sequences necessary for the expression of the nucleic acid molecule of any of the above-mentioned proteins. The regulatory sequences are capable of directing the expression of the coding sequences for any of the above-mentioned proteins in a suitable host cell under compatible conditions. The regulatory sequences include, but are not limited to, a leader sequence, a polyadenylation sequence, a prepeptide sequence, a promoter, a signal sequence, and a transcription terminator. At a minimum, the regulatory sequences include a promoter and transcriptional and translational stop signals. The regulatory sequences can be provided with linkers for attachment to the coding region of the nucleic acid sequence encoding the protein in order to introduce specific restriction sites for cleavage. The regulatory sequences can be a suitable promoter sequence, i.e. a nucleic acid sequence that is recognized by the host cell to be used to express the nucleic acid sequence. The promoter sequence contains transcriptional control sequences that mediate the expression of the protein. The promoter can be any nucleic acid sequence that shows transcriptional activity in the host cell of choice including mutated, truncated, and hybrid promoters, and can be derived from genes encoding proteins either homologous or heterologous to the host cell. The regulatory sequences can also be a suitable transcription terminator sequence, i.e. a sequence that is recognized by the host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleic acid sequence encoding the protein. Any terminator that is functional in the host cell of choice can be used in the present application. The regulatory sequences can also be a suitable leader sequence, i.e. a mRNA untranslated region that is vital for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleic acid sequence encoding the protein. Any leader sequence that is functional in the host cell of choice can be used in the present application. The regulatory sequences can also be a signal peptide coding region that codes for an amino acid sequence linked to the amino terminus of the protein that directs the encoded protein into the secretory pathway of the cell. Any signal peptide coding region that is functional in the host cell of choice can be used in the present application. It can also be desirable to add regulatory sequences that allow the regulation of the expression of the protein relative to the growth of the host cell. Examples of regulatory sequences are those that allow expression of the gene product in response to a chemical or physical stimulus, including the presence of a regulatory compound. Other examples of regulatory sequences are those that allow gene amplification.

[0036] In the above-mentioned uses, the RNA molecule according to B1) targets the gene of the aforementioned protein.

[0037] In the above-mentioned uses, the plant is any one of the following:

[0038] G1) a monocotyledonous plant;

[0039] G2) a plant of the order Poales;

[0040] G3) a plant of the family Poaceae;

[0041] G4) Sorghum;

[0042] G5) Sorghum bicolor.

[0043] The present application also provides a method for regulating the stargazing resistance of a plant, which comprises regulating the stargazing resistance of a plant by regulating the expression of a gene encoding the aforementioned protein or regulating the activity or content of the aforementioned protein.

[0044] The aforementioned regulation of the stargazing resistance of a plant can be up-regulation or enhancement or increase of the expression of a gene encoding the aforementioned protein or the content or activity of the aforementioned protein in a plant, or can be down-regulation or inhibition or decrease of the expression of a gene encoding the aforementioned protein or the content or activity of the aforementioned protein in a plant.

[0045] The present application also provides a method for increasing the stargazing resistance of a plant, which comprises down-regulating or inhibiting or decreasing the expression of a gene encoding the aforementioned protein in a plant of interest or regulating the activity or content of the aforementioned protein to increase the stargazing resistance of a plant.

[0046] The aforementioned down-regulation or inhibition or decrease of the expression of a gene encoding the aforementioned protein in a plant of interest or regulation of the activity or content of the aforementioned protein can be achieved by gene knockout or gene silencing. The gene knockout refers to the phenomenon of inactivation of a specific target gene by homologous recombination. Gene knockout is the inactivation of a specific target gene by change of DNA sequence. The gene silencing refers to the phenomenon of non-expression or low-expression of a gene without damaging the original DNA. Gene silencing is premised on no change of DNA sequence to make a gene non-expressed or low-expressed. Gene silencing can occur at two levels, one is the transcription level gene silencing caused by DNA methylation, heterochromatinization and position effect, etc., and the other is post-transcriptional gene silencing, i.e., inactivation of a gene by specific inhibition of target RNA after gene transcription, including antisense RNA, co-suppression, gene quelling, RNA interference (RNAi) and microRNA (miRNA) mediated translation inhibition, etc.

[0047] In the aforementioned method, the plant is any one of the following:

[0048] G1) a monocotyledonous plant;

[0049] G2) a plant of order Poales;

[0050] G3) a plant of family Poaceae;

[0051] G4) Sorghum;

[0052] G5) Sorghum bicolor.

[0053] The substances and proteins mentioned above are also within the scope of protection of this invention.

[0054] This invention demonstrates through knockout experiments that loss-of-function mutations in the SbSLT1 and SbSLT2 genes endow sorghum with strong resistance to strigophyte parasitism without affecting its normal growth. This is of great significance for the study of anti-parasitism mechanisms and anti-parasitism breeding. Attached Figure Description

[0055] Figure 1 This is a schematic diagram of the structure of the recombinant expression vector pYLCRISPR / Cas9Pubi-H-SbSLT1 / 2-sgRNA.

[0056] Figure 2 The relative expression levels of SbSLT1 and SbSLT2 genes in each plant are shown.

[0057] Figure 3 The mutant SbSLT1 ko and SbSLT2 ko SLs secretion level detection.

[0058] Figure 4 The mutant SbSLT1 ko SbSLT2 ko SbSLT1 ko SbSLT2 ko The parasitic situation of strigophytes.

[0059] Figure 5 The mutant SbSLT1 ko SbSLT2 ko SbSLT1 ko SbSLT2 ko Results of strigophyte parasitism resistance test. Detailed Implementation

[0060] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0061] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0062] In the quantitative experiments in the following examples, three replicate experiments were set up, and the average value of the results was taken.

[0063] Sorghum bicolor accession P184: described in the non-patent literature "Geoffrey P Morris, Punna Ramu, Santosh P Deshpande, C Thomas Hash, Trushar Shah, Hari D Upadhyaya, Oscar Riera-Lizarazu, Patrick J Brown, Charlotte B Acharya, Sharon E Mitchell, James Harriman, Jeffrey C Glaubitz, Edward S Buckler, Stephen Kresovich. Population genomic and genome-wide association studies of agroclimatic traits in sorghum. Proc Natl Acad Sci U S A. 2013 Jan 8; 110(2): 453-8. doi: 10.1073 / pnas.1215985110. Epub 2012 Dec 24." in the aforementioned document, the name of the attached table is "PI595745", which is available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and the biological material is only used for repeating the experiments related to the present application and cannot be used for other purposes.

[0064] Agrobacterium tumefaciens EHA105 strain: described in the non-patent literature "Yiyue Zhang, Chengwei Yang, Yin Li, Nuoyan Zheng, Hao Chen, Qingzhen Zhao, Ting Gao, Huishan Guo and Qi Xie (2007). SDIR1 Is a RING Finger E3 Ligase That Positively Regulates Stress-Responsive Abscisic Acid Signaling in Arabidopsis. Plant Cell. 19(6): 1912-1929;", which is available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and the biological material is only used for repeating the experiments related to the present application and cannot be used for other purposes.

[0065] pYLsgRNA-OsU3 plasmid, pYLsgRNA-OsU6a plasmid and pYLCRISPR / Cas9 Pubi-H plasmid: gifted by South China Agricultural University, recorded in the non-patent literature "Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, et al. (2015) A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant 8: 1274-1284", publicly available from South China Agricultural University, and the biological material is only used for repeating the related experiments of the present application and cannot be used for other purposes.

[0066] The following examples use GraphPad Prism 8 statistical software to process data, and the experimental results are expressed as mean ± standard deviation, and student t test is used for inspection, and P<0.05 (*) indicates significant difference.

[0067] Example 1, obtaining of SbSLT1 and SbSLT2 proteins and their encoding genes

[0068] By the laboratory established sorghum hydroponics system, the sorghum seedlings were treated with phosphorus deficiency. By determining the SLs in the root and exudates of sorghum, it was found that the SLs synthesized by sorghum were mainly 5-DS type, and the content of 5-DS in the root and exudates of sorghum increased significantly under phosphorus deficiency treatment. Next, the transcriptome sequencing analysis was performed using the sorghum roots treated with phosphorus deficiency, combined with the transcriptome data of sorghum roots treated with SLs, it was found that the expression of a class of ABC transporter coding genes had significant difference before and after phosphorus deficiency treatment. Among them, two ABCG transporter coding genes Sobic.001G000400 and Sobic.003G216232 had the most obvious differential expression, indicating that they might play a function as SL transporters in sorghum, therefore, they were named as SbSLT1 (amino acid sequence as SEQ ID No. 1) and SbSLT2 (amino acid sequence as SEQ ID No. 2).The nucleotide sequence of the genomic gene of SbSLT1 is 6735 bp in total, the first exon is 1-353, the first intron is 354-448, the second exon is 449-569, the second intron is 570-658, the third exon is 659-747, the third intron is 748-985, the fourth exon is 986-1070, the fourth intron is 1071-1291, the fifth exon is 1292-1451, the fifth intron is 1452-1579, the sixth exon is 1580-1656, the sixth intron is 1657-1770, the seventh exon is 1771-1824, the seventh intron is 1825-1915, the eighth exon is 1916-2006, the eighth intron is 2007-2100, the ninth exon is 2101-2402, the ninth intron is 2403-2482, the tenth exon is 2483-2764, the tenth intron is 2765-2855, the eleventh exon is 2856-3172, the eleventh intron is 3173-3267, the twelfth exon is 3268-3428, the twelfth intron is 3429-3511, the thirteenth exon is 3512-3778, the thirteenth intron is 3779-3871, the fourteenth exon is 3872-4110, the fourteenth intron is 4111-4193, the fifteenth exon is 4194-4526, the fifteenth intron is 4527-4606, the sixteenth exon is 4607-4897, the sixteenth intron is 4898-5047, the seventeenth exon is 5048-5131, the seventeenth intron is 5132-5217, the eighteenth exon is 5218-5351, the eighteenth intron is 5352-5523, the nineteenth exon is 5524-5751, the nineteenth intron is 5752-5838, the twentieth exon is 5839-6010, the twentieth intron is 6011-6124, the twenty-first exon is 6125-6379, the twenty-first intron is 6380-6468, and the twenty-second exon is 6469-6735. The nucleotide sequence of the cDNA gene of SbSLT1 is shown in SbSLT1 CDS sequence (4362 bp).

[0069] The nucleotide sequence of the genomic gene of SbSLT2 is 17603 bp in total, 1-206 is the first exon, 207-409 is the first intron, 410-530 is the second exon, 531-4794 is the second intron, 4795-4877 is the third exon, 4878-5335 is the third intron, 5336-5420 is the fourth exon, 5421-5508 is the fourth intron, 5509-5799 is the fifth exon, 5800-5873 is the fifth intron, 5874-5964 is the sixth exon, 5965-6094 is the sixth intron, 6095-6995 is the seventh exon, 6996-7105 is the seventh intron, 7106-7266 is the eighth exon, 7267-7377 is the eighth intron, 7378-7481 is the ninth exon, 7482-7604 is the ninth intron, 7605-7770 is the tenth exon, 7771-7862 is the tenth intron, 7863-7988 is the eleventh exon, 7989-8202 is the eleventh intron, 8203-8309 is the twelfth exon, 8310-8405 is the twelfth intron, 8406-8738 is the thirteenth exon, 8739-8854 is the thirteenth intron, 8855-9145 is the fourteenth exon, 9146-9252 is the fourteenth intron, 9253-9336 is the fifteenth exon, 9337-15553 is the fifteenth intron, 15554-15687 is the sixteenth exon, 15688-16028 is the sixteenth intron, 16029-16256 is the seventeenth exon, 16257-16368 is the seventeenth intron, 16349-16540 is the eighteenth exon, 16541-16979 is the eighteenth intron, 16980-17234 is the nineteenth exon, 17235-17327 is the nineteenth intron, 17328-17603 is the twentieth exon. The nucleotide sequence of the cDNA gene of SbSLT2 is shown in SbSLT2 CDS sequence (4215 bp).

[0070] Example 2, Establishment and identification of SbSLT1 and SbSLT2 functional loss transgenic sorghum lines

[0071] 1. Strain activation, plasmid extraction preparation: pYLCRISPR / Cas9 strain (TOP10F) and CRISPR / sgRNA vectors strain (DH10B) were respectively inoculated on the plate medium containing kanamycin (25 μg / mL) and ampicillin (50 μg / mL) overnight, and single colonies were picked and cultured in 1 mL seed liquid, which was then expanded for plasmid extraction to obtain pYLCRISPR / Cas9 plasmid and CRISPR / sgRNA vectors plasmid. 150 ng of pYLCRISPR / Cas9 plasmid (10 μL reaction) was digested with 2-3 U of restriction endonuclease BsaI, and electrophoresis was performed to check whether a 690 bp ccdB band was cut (80 ng of uncut plasmid was used as a control), and the pYLCRISPR / Cas9 plasmid that could cut the ccdB band was complete.

[0072] 2. Target linker preparation:

[0073] SbSLT1-OsU3-Target1-F: 5'-agagctagaaat-3'; -CCTTGGTCCGCGCCAGAGACgtttt

[0074] SbSLT1-OsU3-Target1-R: 5'-GTCTCTGGCGCGGACCAAGGtgccacggatcatctgc-3';

[0075] SbSLT1-OsU6a-Target2-F: 5'-CTCCATCGTCAACACAGTCGgttttagagctagaaat-3';

[0076] SbSLT1-OsU6a-Target2-R: 5'-CGACTGTGTTGACGATGGAGcggcagccaagccagca-3';

[0077] SbSLT2-OsU3-Target1-F: 5'-GCATGCGCCAGGGCATCCTCgttttagagctagaaat-3';

[0078] SbSLT2-OsU3-Target1-R: 5'-GAGGATGCCCTGGCGCATGCtgccacggatcatctgc 3';

[0079] SbSLT2-OsU6a-Target2-F: 5'-TCGGTATGAGCAGCTGAATGgttttagagctagaaat-3';

[0080] ​SbSLT2-OsU6a-Target2-R: 5'-CATTCAGCTGCTCATACCGAcggcagccaagccagca-3'.

[0081] The designed synthetic linker primers were dissolved into 100 μΜ stock solution with ddH2O, mixed and diluted to a final concentration of 1 μΜ. Heating was performed on a PCR machine (about 90 °C for 30 s), and annealing was completed by cooling at room temperature to form double-stranded target linkers, resulting in SbSLT1-OsU3 linker, SbSLT1-OsU6a linker, SbSLT2-OsU3 linker and SbSLT2-OsU6a linker.

[0082] 3. sgRNA vector enzyme digestion: 1 μg of CRISPR / sgRNA vectors plasmid was digested with 10 U Bsal enzyme in a 25 μL reaction system for 20 min, and was stored frozen.

[0083] 4. sgRNA expression cassette ligation reaction: digested OsU3 and OsU6a plasmids were ligated with synthetic SbSLT1-OsU3, SbSLT1-OsU6a, SbSLT2-OsU3 and SbSLT2-OsU6a linker primers (10 μL system): 1 μL 10 x T4 DNA ligase Buffer, 10 ng digested plasmid, 0.05 μΜ annealed target linkers (SbSLT1-OsU3 linker, SbSLT1-OsU6a linker, SbSLT2-OsU3 linker and SbSLT2-OsU6a linker), 18 U T4 DNA ligase, and the volume was made up to 10 μL with ultrapure water. Ligation was performed at room temperature (20-28 °C) for 10-15 min.

[0084] 5. First round amplification: each sgRNA expression cassette was divided into two PCR reactions, each with a 15 μL reaction system: 0.5 μL of the ligation product was used as a template, 0.2 μΜ of primers U-F / Linker reverse primer (reaction 1) and Linker forward primer / gRNA-R (reaction 2) were used, and an appropriate amount of high-fidelity PCR enzyme was used. 25-28 cycles: 94 °C for 10 s, 60 °C for 15 s, and 68 °C for 20 s. 4 μL was taken for electrophoresis (the length of the reaction 2 product was about 140 bp);

[0085] U-F: 5'-CTCCGTTTTACCTGTGGAATCG-3'. U-F corresponds to the gRNA segment of the pYLCRISPR / Cas9Pubi-H plasmid.

[0086] gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3'. gRNA-R corresponds to the gRNA region of the pYLCRISPR / Cas9Pubi-H plasmid.

[0087] 6. After recovering the DNA from the first round of PCR products using a DNA gel, take 1 μL of each product and mix them together as the template for the second round of PCR. Use an appropriate amount of KOD FX Neo or other high-fidelity PCR enzyme. Amplify for 28-35 cycles: 95℃ for 10 s, 58℃ for 15 s, and 68℃ for 20 s. Take 3 μL of the product for electrophoresis to check if the product length matches the target band size and estimate the approximate concentration of the sample.

[0088] 7. Mix all the products from the second round of PCR amplification in approximately equal amounts, and purify them by ethanol precipitation or using a DNA gel recovery kit.

[0089] The following PCR products were obtained:

[0090] SbSLT1-OsU3-Target1-sgRNA expression cassette:

[0091] 5'-AGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTC GGTGCTTTTTTTCAAGAGCTTGGAGTGGATGGAATTTTCCTCCGTTTTACCTGTGGAATCGGCAGCAAAGGAAGGAATCTTTAAACATACGAACAGATCACTTAAAGTTCTTCTGAAGCAACTTAAAGTTATCAGGCATGCATGGATCTTGGAGGAATCAGATGTGCAGTCAGGGACCATAGCACAAGACAGGCGTCTTCTACTGGTGCTACCAGCAAATGCTGGAAGCCGGGAACACT GGGTACGTTGGAAACCACGTGTGATGTGAAGGAGTAAGATAAACTGTAGGAGAAAAGCATTTCGTAGTGGGCCATGAAGCCTTTCAGGACATGTATTGCAGTATGGGCCGGCCCATTACGCAATTGGACGACAAAGACTAGTATTAGTACCACCTCGGCTATCCACATAGATCAAAGCTGGTTTAAAAGAGTTGTGCAGATGATCCGTGGCACCTTGGTCCGCGCCAGAGAC-3'.

[0092] SbSLT1 -OsU6a-Target2-sgRNA expression cassette:

[0093] 5'-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAA AAAGTGGCACCGAGTCGGTGCTTTTTTTCAAGAGCTTGGAGTGGATGGAATTTTCCTCCGTTTTACCTGTGGAATCGGCAGCAAAGGATTTTTTCCTGTAGTTTTCCCACAACCATTTTTTACCATCCGAATGATAGGATAGGAAAAATATCCAAGTGAACAGTATTCCTATAAAATTCCCGTAAAAAGCCTGCAATCCGAATGAGCCCTGAAGTCTGAACTAGCCGGTCACCTGTACAGGCTATCGAGATGCCATACAAGAGACGGTAGTAGGAACTAGGAAGACGATGGTTGATTCGTCAGGCGAAATCGTCGTCCTGCAGTCGCATCTATGGGCCTGGACGGAATAGGGGAAAAAGTTGGCCGGATAGGAGGGAAAGGCCCAGGTGCTTACGTGCGAGGTAGGCCTGGGCTCTCAGCACTTCGATTCGTTGGCACCGGGGTAGGATGCAATAGAGAGCAACGTTTAGTACCACCTCGCTTAGCTAGAGCAAACTGGACTGCCTTATATGCGCGGGTGCTGGCTTGGCTGCCGCTCCATCGTCAACACAGTCG-3'.

[0094] SbSLT2-OsU3-Target1-sgRNA expression cassette:

[0095] 5'-AGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTC GGTGCTTTTTTTCAAGAGCTTGGAGTGGATGGAATTTTCCTCCGTTTTACCTGTGGAATCGGCAGCAAAGGAAGGAATCTTTAAACATACGAACAGATCACTTAAAGTTCTTCTGAAGCAACTTAAAGTTATCAGGCATGCATGGATCTTGGAGGAATCAGATGTGCAGTCAGGGACCATAGCACAAGACAGGCGTCTTCTACTGGTGCTACCAGCAAATGCTGGAAGCCGGGAACACTGGGTACGTTGGAAACCACGTGTGATGTGAAGGAGTAAGATAAACTGTAGGAGAAAAGCATTTCGTAGTGGGCCATGAAGCCTTTCAGGACATGTATTGCAGTATGGGCCGGCCCATTACGCAATTGGACGACAACAAAGACTAGTATTAGTACCACCTCGGCTATCCACATAGATCAAAGCTGGTTTAAAAGAGTTGTGCAGATGATCCGTGGCAGCATGCGCCAGGGCATCCTC-3'.

[0096] SbSLT2-OsU6a-Target2-sgRNA expression cassette:

[0097] 5'-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAA AAGTGGCACCGAGTCGGTGCTTTTTTTCAAGAGCTTGGAGTGGATGGAATTTTCCTCCGTTTTACCTGTGGAATCGGCAGCAAAGGATTTTTTCCTGTAGTTTTCCCACAACCATTTTTTACCATCCGAATGATAGGATAGGAAAAATATCCAAGTGAACAGTATTCCTATAAAATTCCCGTAAAAAGCCTGCAATCCGAATGAGCCCTGAAGTCTGAACTAGCCGGTCACCTGTACAGGCTATCGAGATGCCATACAAGAGACGGTAGTAGGAACTAGGAAGACGATGGTTGATTCGTCAGGCGAAATCGTCGTCCTGCAGTCGCATCTATGGGCCTGGACGGAATAGGGGAAAAAGTTGGCCGGATAGGAGGGAAAGGCCCAGGTGCTTACGTGCGAGGTAGGCCTGGGCTCTCAGCACTTCGATTCGTTGGCACCGGGGTAGGATGCAATAGAGAGCAACGTTTAGTACCACCTCGCTTAGCTAGAGCAAACTGGACTGCCTTATATGCGCGGGTGCTGGCTTGGCTGCCGTCGGTATGAGCAGCTGAATG-3'.

[0098] 8. Take approximately 2 μg of pYLCRISPR / Cas9-MH / MB plasmid and digest it in a 20 μL enzyme digestion system (30 U Bsa I) for 2 h. Recover the digested plasmid fragments by DNA gel electrophoresis (the ccdB fragment has been removed at this point). Wash the recovered gel with ddH2O for 30 min, melt it at 65℃ for 3 min, add agarosease (1 U / 100 μL gel, NEB) at 40℃ and treat for 30 min. Then aliquot and freeze at -20℃. Add the pre-digested PCR products (approximately 10-15 ng each) of SbSLT1-OsU3-Target1-sgRNA expression cassette, SbSLT1-OsU6a-Target2-sgRNA expression cassette, SbSLT2-OsU3-Target1-sgRNA expression cassette, and SbSLT2-OsU6a-Target2-sgRNA expression cassette, digested with BsaI, to each target site. Add 35 U of T4 ligase to 10 μL of the ligation reaction mixture and ligate at 16°C (or use variable temperature cycling: 10°C for 5 min, 20°C for 5 min; 10-15 cycles) for 2-3 h.

[0099] 9. Drop the ligation product obtained in step 8 onto a dialysis membrane and dialyze to TE for 30 min (in a 4℃ freezer) to remove salt. Take 1-1.5 μL of the ligation product and electroporate it into E. coli DH10B competent cells. After electroporation, add 1 mL of SOC and incubate at 37℃ for 1-1.5 h. The plating medium is LB (25 μg / mL Kan, 0.5 mM IPTG, and appropriate amount of X-gal). Transformers without ccdB removal after IPTG induction will be lethal if they express ccdB. Positive clones containing the target insertion sequence will produce blue plaques due to LacZi expression.

[0100] 10. Extract plasmids and digest them with MluI. Electrophoresis is used to detect the sgRNA expression cassette ligation fragments. If there is any doubt about the banding pattern after MluI digestion, confirm it with AscI digestion. Alternatively, use a small amount of plasmid as a template to perform PCR detection on all target sites. The primer pairing format is as follows: the B1' primer corresponds to the reverse primer of the first target linker; the forward primer of the first target linker corresponds to the reverse primer of the second target linker; the forward linker primer of the second target corresponds to the reverse primer of the third target linker; and so on, pairing the forward linker primer of the last target with the BL primer. Electrophoresis is used to confirm whether the size meets expectations; the correctly confirmed plasmids are named pYL-SbSLT1-Target1 / 2 and pYL-SbSLT2-Target1 / 2.

[0101] pYL-SbSLT1-Target1 / 2 is a recombinant expression vector in which a DNA fragment, which is sequentially connected in 5'-3' direction with SbSLT1-OsU3-Target1-sgRNA expression cassette and SbSLT1-OsU6a-Target2-sgRNA expression cassette, replaces the sequence between 8501 and 9177 of pYLCRISPR / Cas9-MH / MB plasmid while keeping other nucleotide sequences unchanged.

[0102] pYL-SbSLT2-Target1 / 2 is a recombinant expression vector in which a DNA fragment, which is sequentially connected in 5'-3' direction with SbSLT2-OsU3-Target1-sgRNA expression cassette and SbSLT2-OsU6a-Target2-sgRNA expression cassette, replaces the sequence between 8501 and 9177 of pYLCRISPR / Cas9-MH / MB plasmid while keeping other nucleotide sequences unchanged.

[0103] 11. The specific target is sequenced with vector primers SP1 and SP2 by using the specificity of each target primer. The obtained positive agrobacterium can be used to infect plant tissues, and the specific infection steps are as follows: after the constructed pYL-SbSLT1-Target1 / 2 or / and pYL-SbSLT2-Target1 / 2 is transformed into agrobacterium competent cells EHA105, three kinds of recombinant bacteria EHA105 / pYL-SbSLT1-Target1 / 2, EHA105 / pYL-SbSLT2-Target1 / 2, EHA105 / pYL-SbSLT1-Target1 / 2+pYL-SbSLT2-Target1 / 2 are obtained. The aforementioned three kinds of recombinant bacteria are used to infect sorghum embryo respectively, and T0 transgenic plants are obtained by screening on hygromycin resistant medium. The plants in which the target fragment of 1500bp is amplified by using SP1 and SP2 as primers are the obtained T0 transgenic positive plants.

[0104] SP1: 5'-CCCGACATAGATGCAATAACTTC-3'.

[0105] SP2: 5'-GCGCGGTGTCATCTATGTTACT-3'.

[0106] 12, Targeting effect detection of transgenic T0 plants: the transformation of successful targeting often produces single base insertion or deletion of several single bases at the target site. Synthesize primers at about 200-300 bp away from the target site on both sides for PCR amplification. Key points: design internal primers as sequencing primers at about 150-250 bp upstream and downstream of the target site, and directly sequence the PCR product. If there is no overlapping peak in the sequencing peak chart, it can also be determined as wild type or homozygous mutation by DSDecode. A total of three mutants were obtained, and after being cultured into homozygotes, they were named SbSLT1 ko , SbSLT2 ko and SbSLT1 ko SbSLT2 ko .

[0107] Compared with wild type sorghum P184, SbSLT1 ko has the same 10 bp deletion on the two homologous chromosomes, which deletes the 465th to 474th base of the SbSLT1 nucleotide sequence.

[0108] SbSLT2 ko has the same 1 bp deletion on the two homologous chromosomes, which deletes the 43rd base of the SbSLT2 nucleotide sequence.

[0109] SbSLT1 ko SbSLT2 ko has the same 10 bp deletion and 1 bp deletion on the two homologous chromosomes, which deletes the 465th to 474th base of SEQ ID No. 3, and also deletes the 43rd base of SEQ ID No. 4.

[0110] 13, Take sorghum recipient material (P184), mutant SbSLT1 ko , SbSLT2 ko and SbSLT1 ko SbSLT2 ko homozygous plant of step 12, extract total RNA and reverse transcribe into cDNA, use cDNA as template for real-time fluorescent quantitative PCR detection of the expression amount of SbSLT1 and SbSLT2 genes in each plant, use EIF gene as internal reference gene, take the expression amount of SbSLT1 and SbSLT2 genes in sorghum recipient material P184 as 1, calculate the relative expression amount of SbSLT1 and SbSLT2 genes in each plant, repeat the experiment three times, and take the average value.

[0111] The primer sequences for identifying SbSLT1 and SbSLT2 genes are as follows:

[0112] qRT-SbSLT1-Fw: 5'-CCTCGCAGGTTGACACTTCT-3';

[0113] qRT-SbSLT1-Rev: 5'-GCCGTCCTCTTGGAACAAA-3'.

[0114] qRT-SbSLT2-Fw: 5'-GCTTGGGCTGGACATTTGTG-3';

[0115] qRT-SbSLT2-Rev: 5'-GCCGTCCTCTTGGAACAAA-3'.

[0116] The primer sequences used to identify the EIF gene are as follows:

[0117] qRT-EIF-FW:5'-CAACTTTGTCACCCGCGATGA-3';

[0118] qRT-EIF-Rev:5'-TCCAGAAACCTTAGCAGCCCA-3'.

[0119] Quantitative results such as Figure 2 As shown: SbSLT1 ko SbSLT1 expression was significantly reduced, while SbSLT2 expression was significantly reduced. ko The expression level of SbSLT2 was significantly reduced.

[0120] Example 3, mutant SbSLT1 ko and SbSLT2 ko Reduced root secretion of SLs

[0121] The formulation for the 1 / 2 MS plate was as follows: NH4NO3 825 mg / L, MnSO4·H2O 16.9 mg / L, KNO3 950 mg / L, ZnSO4·7H2O 8.6 mg / L, CaCl2 166.1 mg / L, CoCl2·6H2O 0.025 mg / L, MgSO4 90.35 mg / L, Kl 0.83 mg / L, KH2PO4 85 mg / L, Inositol 100 mg / L, H3BO3 6.2 mg / L, Glycine 2 mg / L, FeNaEDTA 96 mg / L, Thiamine HCl 0.1 mg / L, CuSO4·5H2O 0.025 mg / L, Nicotinic acid 0.5 mg / L, Na2MoO4·2H2O 0.25 mg / L, Pyridoxine HCl 0.5 mg / L.

[0122] SbSLT1ko Group: SbSLT1 obtained in Example 2 was used ko The homozygous plants were grown to harvest seeds, which were surface sterilized with 10% bleach solution and then washed with sterile water for 3 times. The sterile seeds were plated on ½ MS plates and incubated at 28°C for 3 days, then transplanted to full nutrient hydroponic solution (P content of 1 M / L) for further incubation for 14 days, and a total of 12 plants were transplanted. After two weeks of incubation, the plants were replaced with new phosphorus-free hydroponic solution (P content of 0), and the hydroponic solution and plant roots were collected after 4 days and 7 days of phosphorus-free treatment, respectively. The plant roots were quickly frozen in liquid nitrogen and stored at -80°C. The content of 5DS type SLs in the hydroponic solution and roots was determined by liquid chromatography coupled to tandem mass spectrometry (LC-MS / MS) method.

[0123] The specific operation of HPLC is as follows:

[0124] First step: liquid chromatography separation

[0125] LC physically separates the analytes in a liquid sample or a solution of a solid sample. A few microliters of sample solution are injected into a continuous stream of solvent, called the mobile phase. Although the optimal injection volume depends on the experimental conditions, 0.1 μL to 100 μL of sample can be accurately injected using an autosampler. The mobile phase is continuously pumped through a chromatography column (a stainless steel tube) usually packed with silica particles coated with another liquid (stationary phase). When the sample solution-mobile phase mixture reaches the chromatography column, its components will be differentially affected by the stationary phase (retained in the chromatography column) according to their chemical composition or physical properties. LC separations have been classified into different modes according to the mechanism of interaction between the analytes and the stationary phase, for example:

[0126] Partition chromatography: based on the difference in solubility and hydrophobicity of the analytes in the stationary phase compared to the mobile phase.

[0127] Ion exchange chromatography: separates analytes according to their ionic charge.

[0128] Size exclusion chromatography: separates analytes by exploiting differences in their molecular size.

[0129] Affinity chromatography: separates analytes according to their ability to bind to the stationary phase.

[0130] Some analytes interact more strongly with the stationary phase than others, causing them to separate as they pass through the column. The analytes that interact the least with the stationary phase come out of the column first. As the mobile phase continues to flow through the column, the remaining analytes are sequentially flushed out, with the most strongly interacting analytes appearing last. The time a particular analyte spends in the column is characteristic of that analyte and is called its retention time (RT).

[0131] Step 2: LC Detection

[0132] The mobile phase that flows out of the column (eluent) passes through a detector that "responds" to some physical or chemical property of the analytes in it, such as refractive index or light absorbance. This response is captured as a signal or "peak" whose intensity (peak area or peak height) corresponds to the amount of component present in the sample. The time at which the detector "sees" the analyte is its RT. The identity of a compound in a sample can be confirmed by comparing its RT to that of known compounds. While this is not an exact method of compound identification, it can be helpful if some information about the sample is known beforehand.

[0133] Step 3: LC Detection with MS

[0134] While a variety of different techniques and sensitivities of detectors have been added to LC for analyzing different sample types, mass spectrometers have become a selective, sensitive, and universal detector.

[0135] Unlike other detectors, the LC eluent carrying the separated analytes is not allowed to flow into the mass spectrometer. While the LC system operates at ambient pressure, the mass spectrometer operates under vacuum, and the two are coupled through an interface. As the column eluent flows into the interface, the solvent is evaporated by heating, and the analyte molecules are vaporized and ionized. This is a crucial step because the mass spectrometer can only detect and measure ions in the gas phase.

[0136] Since the analyte ions are generated at atmospheric pressure at the interface, the process is called atmospheric pressure ionization (API), and the interface is called an API source. Electrospray ionization (ESI) and atmospheric pressure chemical ionization (APCI) are the most commonly used sources in LC-MS analysis.

[0137] The analyte ions are drawn into the mass spectrometer and subjected to electric and / or magnetic fields therein. By varying the applied fields the flight path of the ions is changed, which ensures that the ions separate from each other on the basis of their mass-to-charge (m / z) ratio. After separation, the ions can be collected and detected by various mass detectors, the most common of which is the electron multiplier. When the separated ions hit the surface of the electron multiplier (dynode), secondary electrons are released. These secondary electrons are multiplied by a series of dynode cascades. At any given point in time, the amplified current generated by the stream of secondary electrons is measured and correlated to the ion concentration in the mass spectrometer.

[0138] Step 3: Plotting LC-MS data

[0139] The ion abundances measured during the analysis of the sample by LC-MS are plotted as a total ion chromatogram (TIC). This plot shows the peak intensity of the analyte ions as a function of their RT. In addition, each point in the chromatogram is associated with a mass spectrum. The mass spectrum plot depicts the ion abundance as a function of the measured m / z value.

[0140] SbSLT2 ko Group: This group differs from the SbSLT1 ko group in that seeds of SbSLT2 ko are used instead of seeds of SbSLT1 ko . The rest is done as in the SbSLT1 ko group.

[0141] SbSLT1 ko SbSLT2 ko Group: This group differs from the SbSLT1 ko group in that seeds of SbSLT1 ko are used instead of seeds of SbSLT2 ko . The rest is done as in the SbSLT1 ko group. ko

[0142] Wild type P184 group: This group differs from the SbSLT1 ko group in that seeds of P184 are used instead of seeds of SbSLT1 ko . The rest is done as in the SbSLT1 ko group.

[0143] The results are shown in Figure 2 . The mutant SbSLT1 ko and SbSLT2 ko did not show a significant difference in the content of 5DS in the root system compared to the wild type (P>0.05), the SbSLT1 ko SbSLT2 ko double mutant showed a higher content of 5DS in the root system than the wild type (​Figure 3 (A, P < 0.01); mutant SbSLT1 ko and SbSLT2 ko The 5DS content in the hydroponic solution was significantly lower than that in the wild type. ko SbSLT2 ko The 5DS content in the hydroponic solution of the double mutant was also significantly lower than that of the wild type, with a greater reduction than that of the single mutant. Figure 3 (B, P < 0.001).

[0144] In summary, the root SLs exudation of transgenic sorghum plants lacking the functions of SbSLT1 and SbSLT2 was significantly inhibited compared to sorghum P184, indicating that the loss of function of SbSLT1 and SbSLT2 is beneficial to the resistance of sorghum to strigophyte parasitism.

[0145] Example 4, mutant SbSLT1 ko and SbSLT2 ko Identification of parasitic resistance in strigophytes

[0146] A plot of land in Yunfu City, Guangdong Province, was selected and divided into four plots. A 30-centimeter layer of soil was removed from each plot to ensure the experimental results were not affected by existing weed seeds. River mud was then dried and used to fill the plots. An equal amount of *Striga asiatica* seeds (24 grams per acre, sourced locally) was sown in each plot. A layer of river mud was then added, and finally, sorghum was planted in rows 2 meters long and 50 centimeters wide, with sorghum seeds spaced 20 centimeters apart.

[0147] During the sorghum heading stage, the growth of *Striga asiatica* plants in each plot can be observed. Parasitized sorghum plants, due to the *Striga asiatica* absorbing their water and nutrients, exhibit obvious yellowing of leaves and poor development, and most are unable to head and bear grain normally. For example... Figure 4 As shown, SbSLT1 ko and SbSLT2 ko Number of single-legged gold medals in the community ( Figure 4 The white-flowered grass (Striga asiatica) is significantly less abundant than the wild type, while SbSLT1 ko SbSLT2 ko There are absolutely no Strelitzia plants growing in the community. Statistical data shows ( Figure 5 Compared to the wild type, the mutant SbSLT1 ko SbSLT2 ko and SbSLT1 ko SbSLT2 ko The number of single-stripe golds in the community ( Figure 5 The A value was significantly reduced (***, indicating P<0.001), and the mutant SbSLT1 was also significantly reduced. koSbSLT2 ko SbSLT1 ko SbSLT2 ko Single plant yield of mutants Figure 5 Plot yield of mutants Figure 5 Grain number per spike of mutants Figure 5 Grain number per spike of mutants

[0148] In summary, the loss-of-function mutations of SbSLT1 and SbSLT2 genes confer sorghum stronger resistance to dodder without affecting the normal growth of sorghum, which is of great significance to the study of anti-parasitic mechanisms and anti-parasitic breeding.

[0149] SbSLT1 nucleotide sequence (6735bp)

[0150]

[0151] SbSLT2 nucleotide sequence (17603 bp)

[0152]

[0153] SbSLT1 CDS sequence (4362 bp)

[0154]

[0155] SbSLT2 CDS sequence (4215 bp)

[0156]

[0157] LacZ-U3-sgRNA

[0158] 5'-GGATCCTAGCCGGGTCTCGgttttagagctagaaatAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCAAGAGCTTGGAGTGGATGGAATTTTCCTCCGTTTTACCTGTGGAATCGGCAGCAAAGGAAGGAATCTTTAAACATACGAACAGATCACTTAAAGTTCTTCTGAAGCAACTTAAAGTTATCAGGCATGCATGGATCTTGGAGGAATCAGATGTGCAGTCAGGGACCATAGCACAAGACAGGCGTCTTCTACTGGTGCTACCAGCAAATGCTGGAAGCCGGGAACACTGGGTACGTTGGAAACCACGTGTGATGTGAAGGAGTAAGATAAACTGTAGGAGAAAAGCATTTCGTAGTGGGCCATGAAGCCTTTCAGGACATGTATTGCAGTATGGGCCGGCCCATTACGCAATTGGACGACAACAAAGACTAGTATTAGTACCACCTCGGCTATCCACATAGATCAAAGCTGGTTTAAAAGAGTTGTGCAGATGATCCGTGGCAAGAGACCTCTGAAGATAACATACTAAGCTT-3'.

[0159] LacZ-U6a-sgRNA

[0160] 5'-GGATCCTAGCCGGGTCTCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCAAGAGCTTGGAGTGGATGGAATTTTCCTCCGTTTTACCTGTGGAATCGGCAGCAAAGGATTTTTTCCTGTAGTTTTCCCACAACCATTTTTTACCATCCGAATGATAGGATAGGAAAAATATCCAAGTGAACAGTATTCCTATAAAATTCCCGTAAAAAGCCTGCAATCCGAATGAGCCCTGAAGTCTGAACTAGCCGGTCACCTGTACAGGCTATCGAGATGCCATACAAGAGACGGTAGTAGGAACTAGGAAGACGATGGTTGATTCGTCAGGCGAAATCGTCGTCCTGCAGTCGCATCTATGGGCCTGGACGGAATAGGGGAAAAAGTTGGCCGGATAGGAGGGAAAGGCCCAGGTGCTTACGTGCGAGGTAGGCCTGGGCTCTCAGCACTTCGATTCGTTGGCACCGGGGTAGGATGCAATAGAGAGCAACGTTTAGTACCACCTCGCTTAGCTAGAGCAAACTGGACTGCCTTATATGCGCGGGTGCTGGCTTGGCTGCCGAGAGACCTTCTGAAGATAACATACTAAGCTT-3'.

[0161] The application has been described in detail. Those skilled in the art who are familiar with this field will be able to implement the application without departing from the spirit and scope thereof, and without unnecessary experiments, within the equivalent parameters, concentrations and conditions, in a wider range. Although the application gives a specific example, it should be understood that further improvements can be made to the application. In general, according to the principles of the application, this application is intended to include any variations, uses or improvements of the application, including changes made outside the scope of the application disclosed in this application, using conventional techniques known in the art.

Claims

1. Application, characterized in that, The use of a protein, or a substance that regulates the expression of the gene encoding the protein, or a substance that regulates the activity and / or content of the protein, in any of the following: M1) regulates the resistance of plants to strigolactone; M2) to prepare products that regulate plant resistance to strigolactone; M3) enhances the plant's resistance to strigolactone; M4) to prepare products that enhance the resistance of plants to strigolactone; M5) Cultivate plants resistant to strigophytes; M6) Plant breeding; The protein is SbSLT2 and / or SbSLT1; The SbSLT1 is any one of the following: A1) The amino acid sequence of this protein is that of SEQ ID No. 1; A2) A protein that has more than 95% identity with and has the same function as the protein shown in A1) obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in A1). A3) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of any of the amino acids shown in A1) or A2); The SbSLT2 is any one of the following: R1) The amino acid sequence is that of the protein in SEQ ID No. 2; R2) A protein with more than 95% identity and the same function as the protein shown in R1) obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in R1). R3) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of any of the amino acids shown in R1) or R2).

2. The application according to claim 1, characterized in that, The substance is a substance that reduces the expression of the gene encoding the protein of claim 1 in the cell or knocks out the gene encoding the protein.

3. The application according to claim 2, characterized in that, The substance is any one of the following: B1) RNA molecules that inhibit, reduce, or downregulate the expression of the gene encoding the protein or RNA molecules that inhibit, reduce, or downregulate the activity or content of the protein. B2) The gene encoding the RNA molecule described in B1); B3), an expression cassette containing the gene described in B2); B4), a recombinant vector containing the gene described in B2), or a recombinant vector containing the expression cassette described in B3); B5) recombinant microorganisms containing the gene described in B2), or recombinant microorganisms containing the expression cassette described in B3), or recombinant microorganisms containing the recombinant vector described in B4).

4. The application according to claim 3, characterized in that, B1) The RNA molecule targets the gene of the protein described in claim 1.

5. The application according to any one of claims 1-4, characterized in that, The plant is any one of the following: G1) Dicotyledons; G2) Plants of the order Poales; G3) Gramineae plants; G4) Sorghum genus; G5) Sorghum.

6. A method for regulating plant resistance to strigolactone, characterized in that, The method includes regulating plant strigolactone resistance by regulating the expression of the gene encoding the protein of claim 1 or 2 or by regulating the activity or content of the protein of claim 1 or 2.

7. A method for improving the strigolaconic properties of plants, characterized in that, This includes downregulating or inhibiting or reducing the expression level of the gene encoding the protein described in claim 1 or 2 in the target plant, or regulating the activity or content of the protein described in claim 1 or 2, to improve the plant's resistance to strigolactone.

8. The method according to claim 6 or 7, characterized in that, The plant is any one of the following: G1) Dicotyledons; G2) Plants of the order Poales; G3) Gramineae plants; G4) Sorghum genus; G5) Sorghum.

9. The substance as described in claim 2 or 3.

10. The protein as described in claim 1.