Application of ZmCRY1 gene in improvement of photosynthetic performance of corn

Abstract

The invention relates to the technical field of biology, and particularly discloses application of a ZmCRY1 gene in improvement of photosynthetic performance of corn. According to the invention, a corn transgenic positive plant over-expressing the ZmCRY1 gene is obtained through the steps of cloning of the corn ZmCRY1 gene, construction of a pBCXUN-ZmCRY1 fusion expression vector, agrobacterium transformation and the like, and the chlorophyll content of the corn transgenic positive plant reaches 0.83 mg / g and is increased by 53.7% compared with that of a wild type; the photosynthetic rate reaches 39.5 and is improved by 16.2% compared with that of a wild type, which shows that the ZmCRY1 gene can significantly improve the chlorophyll synthesis and photosynthetic rate of the corn, directly enhance the luminous energy conversion efficiency and improve the photosynthetic performance of the corn, and can be used as a new target for corn variety improvement.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to... ZmCRY1 Application of genes in improving maize photosynthetic performance. Background Technology

[0002] Corn is an important food crop in my country, a significant source of animal feed, and a primary raw material for producing corn-based bioproducts and industrial alcohol. Faced with the growing market demand in the food, economic, and feed sectors, one of the core tasks of grain cultivation is to increase corn yields.

[0003] Light plays a central regulatory role in crop growth and development, and is a key influencing factor in crop morphology, photosynthesis, and metabolism. Maize is a high-light-efficiency C4 crop with a high light saturation point and a low compensation point. It requires strong light to accumulate nutrients through photosynthesis, and its yield is closely related to light conditions. Low light stress caused by cloudy or rainy weather will reduce the photosynthetic performance of maize plants, limit plant growth, and thus affect maize yield.

[0004] Therefore, it is necessary to explore a new way to improve the photosynthetic performance of maize. Summary of the Invention

[0005] To explore a new approach to improve the photosynthetic performance of maize, this invention provides... ZmCRY1 Application of genes in improving maize photosynthetic performance. This invention utilizes maize... ZmCRY1 Gene cloning, pBCXUN-ZmCRY1 Overexpression was obtained through steps such as constructing the fusion expression vector and Agrobacterium-mediated transformation. ZmCRY1 Transgenic positive maize plants (with genes) ZmCRY1-OE The plant's chlorophyll content reached 0.83 mg / g, a 53.7% increase compared to the wild type (0.54 mg / g); its photosynthetic rate reached 39.5, a 16.2% increase compared to the wild type (34), indicating that... ZmCRY1 The gene can significantly improve the rate of chlorophyll synthesis and photosynthesis in maize, directly enhance the efficiency of light energy conversion, and improve the photosynthetic performance of maize, thus serving as a new target for maize variety improvement.

[0006] This invention provides ZmCRY1 The application of genes in improving maize photosynthetic performance, the ZmCRY1 The nucleotide sequence of the gene is shown in SEQ ID NO: 1.

[0007] Overexpression in this invention ZmCRY1 Genes can significantly enhance the light energy conversion efficiency of maize and improve its photosynthetic performance. They can serve as new targets for maize variety improvement and provide new approaches for high-yield maize breeding.

[0008] Further, the application is to increase the chlorophyll content or photosynthetic rate of corn leaves by overexpressing ZmCRY1 a gene.

[0009] Further, the overexpression ZmCRY1 of the gene is achieved by constructing corn ZmCRY1 transgenic positive plants.

[0010] Further, the construction of corn ZmCRY1 transgenic positive plants comprises the following steps: cloning Sma the gene, inserting the Bam gene into a vector through I and ZmCRY1 HI-HF enzyme cutting sites to construct pBCXUN a fusion expression vector. pBCXUN-ZmCRY1 ZmCRY1 The fusion expression vector is transformed into GV3101 Agrobacterium tumefaciens competent cells, and the Agrobacterium is used to transform corn plants.

[0011] Further, the cloning pBCXUN-ZmCRY1 of the gene uses primers as shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0012] The application also provides a fusion expression vector, wherein the pBCXUN-ZmCRY1 fusion expression vector is the pBCXUN-ZmCRY1 fusion expression vector of claim 4; and the pBCXUN-ZmCRY1 fusion expression vector is obtained by inserting Sma a gene into a vector through I and Bam HI-HF enzyme cutting sites. ZmCRY1 pBCXUN pBCXUN

[0013] Further, the vector pCXUN is obtained by replacing the plant resistance gene of the vector Hyg with a resistance gene through enzyme cutting. Bar pBCXUN-ZmCRY1

[0014] The application also provides a method for improving the photosynthetic performance of corn, which comprises the following steps: transforming a fusion expression vector into GV3101 Agrobacterium tumefaciens competent cells, and then transforming the Agrobacterium into corn plants, so as to improve the photosynthetic performance of corn. pBCXUN-ZmCRY1

[0015] Compared with the prior art, the application has the beneficial effects that: The application constructs a fusion expression vector, and then obtains corn ZmCRY1 transgenic positive plants (by transformation. ZmCRY1-OE ZmCRY1 ​​​​​​​​(plants), making corn ZmCRY1-OE Gene overexpression. ZmCRY1 The chlorophyll content of the plant reached 0.83 mg / g, an increase of 53.7% compared to the wild type (0.54 mg / g); the photosynthetic rate reached 39.5, an increase of 16.2% compared to the wild type (34), indicating overexpression. Figure 1 The gene can significantly improve the chlorophyll synthesis and photosynthetic rate of maize, directly enhance the light energy conversion efficiency, and improve maize photosynthetic performance. It can serve as a new target for maize variety improvement and provide a new approach for high-yield maize breeding. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] ZmCRY1 for Figure 2 The gel electrophoresis image of gene amplification shows that M represents Marker III, and the band sizes from top to bottom are 4500 bp, 3000 bp, 2000 bp, 1200 bp, 800 bp, 500 bp and 200 bp, respectively. The two target bands are parallel samples.

[0018] pBCXUN-ZmCRY1 for Figure 3 Gel electrophoresis image of Agrobacterium colony PCR amplification of the fusion expression vector. In the figure, M is Marker III. The band sizes from top to bottom are 4500 bp, 3000 bp, 2000 bp, 1200 bp, 800 bp, 500 bp and 200 bp. The eight target bands are parallel samples.

[0019] Figure 4 The image shows gel electrophoresis results of PCR amplification in wild-type and transgenic positive maize plants. M in the image represents DL2000, and the band sizes from top to bottom are 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp, respectively. The three target bands are parallel samples.

[0020] Figure 5 Phenotypic diagrams and chlorophyll detection results of wild-type and transgenic positive maize plants; In the figure, A represents the phenotypic diagram of wild-type and transgenic positive maize plants; B represents the chlorophyll detection results of wild-type and transgenic positive maize plants.

[0021] ZmCRY1 The results show the photosynthetic rate of wild-type and transgenic positive maize plants. Detailed Implementation

[0022] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0023] Example 1: pBCXUN-ZmCRY1 Application of genes in improving maize photosynthetic performance I. Experimental Methods 1. Corn ZmCRY1 Construction of fusion expression vectors 1.1 Corn ZmCRY1 Sequence acquisition Obtain corn from the NCBI website ZmCRY1 Gene sequence: CAGCCTCTTTCTCCACTGGACGAGAACTGTCCCAGCAGAAACCAGA AGCACCAACTGCAAACATCAGAGAAGAGAAGAGTAGGGGGGAAATTACT ACTCTACGACTCGTGCGCCCACTCCTCCACTGTTCTTGGGAATCTCGGGG GAGAAGAGGAAGAAAGCAGTGGGTCTCAGCGCACCACTCATTATTCCTG GCTCCATGGCTTCCTGACGTCCCTGTGCGGCGGGGACCCGGCGATGAGGA TCGTGGTGTGGTTCCGGAGGGACCTCAGGGTGGAGGACAACCCGGCCT CGCGGCGGCGGCGCGTGCCGGTGGGGAGGTGGTGCCGGCGTACGTCTGG TCGCCAGAGGAGGAGGGCCCTTACTACCCCGGCCGCGTATCCCGGTGGTG GATCAGCCAGAGCCTGAACCACCTGGACGCCTCGCTCCGCCGCCTTGGG GCGGGAAAGCTTGTCACGCGGAGGTCGGCCGACGCCGCCGTCGCGCTGC TCCAGCTGGTCCGCGACACCGGCGCCACGCACGTCTACTTCAATCATCTAT ACGACCCGATCTCACTGGTCAGGGACCGCCGGTTGAAGGAGATGCTGGC GGCTGAGGGCATCGTTGTGCAATCTTTCAATTCGGATCTGCTGTACGAGCC ATGGGAAGTTGTCGATGATGAAGGGCAGCCATTCACCATGTTCGACCCGT TCTGGAACAGGTGCCTCAGCATGCCGTATGACCCCCCTGCACCGCTTCTG CCCCCGAAGAGGATCAATTCAGGTGACTTATCGATGTGCCCATCGGAGGA TCTGATCTTTGAGGACGAGTCAGAGAGGGGAAGCAACGCTCTTCTGGCC CGAGCGTGGACGCCAGGGTGGCAGAACGCAGACAAGGCGCTGACGGCC TTCCTCAACGGCCCACTGGCCGACTACTCAGTGAACCGCAAGAAGGCCG ATAGCGCGAGCACGTCCCTGCTGTCGCCTCACCTGCACTTCGGCGAGCTT AGCGTGCGCAAGGTCTTCCACCTAGTTCGCATGAAGCAGCTCGTGTGGAG CAACGAGGGCAACCACGCTGCCGAGGAGAGCTGCACCCTGTTCCTCCGT TCCATCGGCCTGCGGGAGTACTCCCGGTACCTGAGCTTCAATCACCCGAG CAGCCATGAGAGGCCCCTCCTGGCGCACCTCAGGTTCTTCCCCTGGGTGG TGGACGAGAGCTACTTCAAGATTTGGAGGCAGGGAAGGACCGGGTACCC GCTCGTCGACGCTGGCATGAGGGAGCTGTGGGCGACGGGGTGGCTGCAT GACCGGATACGTGTGGTGGTGGCAAGCTTCTTCGTCAAGGTCCTCCAGCT TCCATGGCGATGGGGCATGAAGTACTTTTGGGACACGTTACTGGATGCTG ATCTTGAGAGCGATGCGCTGGGCTGGCAGTACATCACTGGCTCTCTTCCTG ATGGCCGGGAGCTTGACCGCATCGACAACCCCCAGTTTGAAGGCTACAAG TTCGACCCGCATGGGGAGTACGTCCGGCGATGGATTCCTGAGCTCGCAAG GCTGCCGACGGAGTGGATACACCATCCATGGGACGCGCCTGTCTCCGTGC TGCAAGCTGCAGGAATCGAGCTGGGCTCTAACTACCCTCTCCCCATAGTG GAGCTGGACGCGGCCAAGGGCAGGCTGCAAGCGGCCCTGTCAGAGATGT GGCAGCTGGAGGCGGCGTCGAGGGCCACCATGAACAACGGGACGGAGG AAGGCCTCGGCGACTCCTCGGAGGTCCTGTTCCCTCAAGAGCTGCAGATG GAGGTCGACCGGCAGCCAGCCCCAGCCGAGGCAGCAGCCAACGTGCAC GTGCACGTGCCGATGCCTGCCCGGAGGCGCGGGGACCAGATGGTGCCCA CCATGACGACCTCTTCGCTGAACAGAGCTGGAACAGAGGTCTCCGCCGAT CTAGTAGTAGCGAACAGCGAGGAGGAGGACACCAGGGCGCAGGTTCCGT TCCACGCGCATCTCCATCTCCACCCCCGAGCCGAAGCCCCGCCAGCTGCG CGTAGAACCAACAACGGCGCTCGCCAGCACGACGTCTTCCAGCAGCGTC GGAACCACAGGCGAGATGCTCTGCTTGCTCCGTCGGCGTCGGAGGCTTCG AGCAGCTGGACCGGCAGAGAGGGCGCCGTGGTCCCGGTCTGGTCGCCTC CTGCGGCGTCGGGCCATTCGGACGCCTTCGCCGCCGACGAAGCTGACGTC TCTAGTAGGAGCTATCTGGGTAGGCATCCGCAGTCGCACCGCCTGATGAA CTGGAGCCAACTATCGCAGTCATCGTGAGCTCGGATGCACGGACAGCAGC AGAAGATTCTGTGCGGCCAAACTTAATCGAGCTGAAGATTCTCGTATGTAG ATTGTCCACTGAACTACTCATCCATAGTCTGATGGGATGGAAACCAGGCG GCTTTTCCTGGTTGTGGTGGCTATAGCTGTGTAAATCTCGTCTTCTAGAAC GTGTGTGGTCGATATAGTGCGGTTGGCTTTACAACCAAAAAAAAAGGTCG CTATTATTGATCAGACGACAAAGGTTTTCCGTATTTTTTTAGCCTTTTTTGG GGGAGGTATGTGATGTATGTAACCGTAACTGTACATTCCCTTGTGCTGACC ATATTGTTAGTTGTAGTTTCCATGCGTCTTGTATTGCTGTTTTGGGCTGAGG AGTGATGAACCATGGACCATGGTCACGTTTGCCGGTCCATATGGATTGGAG GGCTAAAATTCCTATTAAAAAGTAAGGGGGTTTTAGCTCCTCTAATTCACG TGTTGTTTGGTTCACGAAATGTAACGTAAATGGTAATGTTATTAATTCAC, SEQ ID NO: 1.

[0024] Total RNA was extracted from maize using RNAiso Plus reagent from Beijing Baori Biotechnology Co., Ltd., and then reverse transcribed into cDNA using the FastKing cDNA First-Strand Synthesis Kit from Tiangen Biotech Co., Ltd. According to... ZmCRY1 The following specific primers were designed for the CDS region of the gene:

[0025] ZmCRY1-F1: acttctgcagcccgggATGAGGATCGTGGTGTGGTT, SEQ ID NO: 2; ZmCRY1-R1: caagtattggggatccTCACGATGACTGCGATAGTT, SEQ ID NO: 3.

[0026] Using maize cDNA as a template pBCXUN Gene amplification was performed using the following reaction system: 10 µL KOD One PCR MasterMix (2X), 1 µL ZmCRY1-F1, 1 µL ZmCRY1-R1, 2 µL cDNA template, and 6 µL ddH2O. The PCR program was: 98℃ for 5 min; 98℃ for 10 s, 58℃ for 5 s, 68℃ for 30 s, for 35 cycles; 68℃ for 5 min. The amplified products were then detected by gel electrophoresis.

[0027] 1.2, Carrier pBCXUN Get carrier pCXUN The carrier from Kele Biotechnology Co., Ltd. pCXUN It was modified. The carrier... Hyg of Bar Plant resistance gene enzyme cleavage replacement with pBCXUN Resistance gene, to obtain vector pBCXUN-ZmCRY1 .

[0028] 1.3 Sma Construction of fusion expression vector pass Bam I and pBCXUN HI-HF restriction endonuclease pairs Sma The plasmid was digested with enzymes. The enzyme digestion system was as follows: Bam I 1 µL, pBCXUNHI-HF 1 µL, ZmCRY1 10 µL plasmid, 5 µL CutSmart Buffer, 33 µL ddH2O. Reaction program: 37℃ for 1 h. Electrophoresis was performed on a 1% agarose gel, and the correct bands were recovered. The plasmid was then ligated using the Kemix Infusion Ligation Kit. pBCXUN Gene and enzyme digestion ZmCRY1 Plasmid ligation was performed using the following ligation system: SuperFusion Cloning MIX 5 µL. pBCXUN 2 µL, after enzyme digestion pBCXUN-ZmCRY1 Plasmid 3 µL; reaction program: 50℃ 1 h. After ligation, the desired result was obtained. pBCXUN-ZmCRY1 Integration of expression carriers.

[0029] 1.4. Transformation of competent cells using fusion expression vectors 50 μL of GV3101 Agrobacterium tumefaciens competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.) was thawed on ice, and then 2 μL of [unclear text - possibly a typo, should be removed] was added. pBCXUN-ZmCRY1 The fusion expression vector was gently mixed and placed on ice for 5 min, then quickly frozen in liquid nitrogen for 5 min, and finally placed in a 37°C water bath for 5 min. In a clean bench, 1 mL of LB liquid medium was added to the water-bathed competent cells, and the cells were incubated on a shaker at 28°C and 200 rpm for 2 h. After centrifugation at 5000 rpm for 3 min, the supernatant was discarded, and 80 μL of the cells were resuspended. The cells were then plated onto LB solid medium containing rifamycin and kanamycin, and incubated upside down at 28°C for 48 h to obtain cells containing rifamycin and kanamycin. pBCXUN-ZmCRY1 Agrobacterium fusion expression vector was used to select Agrobacterium colonies and place them in 1 mL of LB liquid medium to obtain... ZmCRY1 Agrobacterium bacterial culture template was used for PCR amplification. The reaction system consisted of: 10 µL 2xTaqPCR Mix, 1 µL ZmCRY1-F1, 1 µL ZmCRY1-R1, 1 µL bacterial culture template, and 7 µL ddH2O. The PCR reaction program was: 94℃ for 3 min; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min, for 35 cycles; 72℃ for 5 min. The amplified products were detected by gel electrophoresis.

[0030] 2. Corn pBCXUN-ZmCRY1 Obtaining and detecting transgenic positive plants use ZmCRY1-OE Infecting corn with Agrobacterium tumefaciens bacterial solution yielded transgenic positive plants. pBCXUN-ZmCRY1 The above process was completed by Tianjin Genov Biotechnology Co., Ltd.

[0031] DNA was extracted from wild-type and transgenic positive maize plants using CTAB reagent (purchased from Solarbio Science & Technology Co., Ltd.). pBCXUN-ZmCRY1 Specific primers were designed using the fusion expression vector as a template. The primer information is as follows: Upstream primer pBCXUN-F: ATGCTCACCCTGTTGTTTGG, SEQ ID NO: 4; Downstream primer ZmCRY1-R: ATACCTCAATGGGATGGACT, SEQ ID NO: 5.

[0032] Using DNA as a template, ZmCRY1 PCR amplification was performed using specific primers and a PrimerSTAR Max DNA Polymerase kit (purchased from TAKARA). The reaction mixture consisted of 12.5 μl PrimerSTAR Max Premix (2X), 0.75 μl each of forward and reverse primers, 1 μl DNA template, and 10 μl ddH2O. The PCR program was as follows: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 58℃ annealing for 15 s, 72℃ extension for 5 s, for 35 cycles; final extension at 72℃ for 5 min. The amplified products were detected by agarose gel electrophoresis.

[0033] 3. Determination of chlorophyll content and photosynthetic rate in wild-type and transgenic positive maize plants. Wild-type and transgenic positive maize plants were planted in the field in Wen County, Jiaozuo City, Henan Province. The planting density was 25 cm between plants and 60 cm between rows. Stanley compound fertilizer (N:P2O5:K2O=14%:16%:15%) was applied at a rate of 50 kg / mu, and 15 kg / mu was applied as top dressing at the jointing stage.

[0034] Select mature leaves from corn plants and cut them into small pieces (about 1 cm). 2 Afterwards, place the mixture in a mortar, add 0.5 mL of 80% acetone, a small amount of calcium carbonate and quartz sand, grind into a homogenate, transfer to a centrifuge tube, add 0.5 mL of 80% acetone, centrifuge at 12000 rpm for 15 min at room temperature, collect the supernatant, and use a spectrophotometer to measure its absorbance at wavelengths of 663 nm and 647 nm to calculate the chlorophyll content (total chlorophyll content = 18.71 × OD). 647 +7.15×OD 663 ).

[0035] The photosynthetic rate of mature maize leaves was measured using a portable photosynthesis meter LI-6400. The instrument and light source were turned on 30 minutes in advance, ensuring sufficient desiccant and CO2 absorbent were available inside the instrument. A standard transparent-topped leaf chamber was used, and the chamber area was confirmed to be 6 cm².2 Airflow velocity Flow = 500 μmol / s, light intensity (PAR) set to 1800 μmol m -2 s -1 The intercellular CO2 concentration was 135 μmol / mol, and the actual leaf temperature was measured at 39℃. Select fully expanded, healthy, disease-free, and well-lit ear leaves from maize plants after jointing. Carefully insert the leaves into the leaf chambers, ensuring the leaves completely cover the chamber windows and that the edges are well-sealed without air leakage, avoiding leaf folding or twisting. Record data once the photosynthetic rate displayed on the instrument stabilizes.

[0036] II. Test Results 1. Corn ZmCRY1 Gene amplification Using maize cDNA as a template ZmCRY1 The gene was amplified by PCR, and the amplification products were detected by gel electrophoresis. The gel electrophoresis results showed that... ZmCRY1 The gene length is 2067 bp, which is consistent with the information on the NCBI website. ZmCRY1 The consistency of gene registration information indicates that Figure 1 Gene amplification successful ( pBCXUN-ZmCRY1 ).

[0037] 2. pBCXUN-ZmCRY1 Detection of bacterial culture amplification using fusion expression vector Pick those containing ZmCRY1 Agrobacterium colonies containing the fusion expression vector were subjected to PCR amplification, and the amplification products were detected by gel electrophoresis. The gel electrophoresis results showed that each group of bacterial cultures amplified a 2067 bp vector. pBCXUN-ZmCRY1 Genes indicate Figure 2 The fusion expression vector was successfully constructed and successfully transformed into competent cells. ZmCRY1 ).

[0038] 3. Corn ZmCRY1 Detection of transgenic positive plants The maize constructed by Tianjin Genovo Biotechnology Co., Ltd. ZmCRY1-OE Transgenic positive plants ( pBCXUN-ZmCRY1 Verification was performed using specific primers pBCXUN-F and ZmCRY1-R on wild-type and transgenic positive maize plants. The amplification products were then detected by gel electrophoresis. The gel electrophoresis results showed that the transgenic positive plants amplified a specific fragment of 760 bp, while the control showed no band, indicating that maize… Figure 3 Transgenic positive plants were successfully constructed. ZmCRY1-OE ).

[0039] 4. Detection of chlorophyll content and photosynthetic rate in wild-type and transgenic positive maize plants. Wild-type and transgenic positive maize plants under normal field conditions ( ZmCRY1-OE The phenotypic diagram shows that Figure 4 The plant's leaves are noticeably greener than those of the wild type. ZmCRY1-OE (A); chlorophyll detection results showed that, ZmCRY1-OE The chlorophyll content of the plant leaves was 0.83 mg / g, while the chlorophyll content of the wild-type plant leaves was 0.54 mg / g. ZmCRY1 The chlorophyll content of the plant was 53.7% higher than that of the wild-type plant, a highly significant difference, indicating that... Figure 4 It can significantly increase the chlorophyll content of corn leaves. ZmCRY1-OE (B). Photosynthetic rate detection results show that, ZmCRY1-OE The photosynthetic rate of the plant's leaves was 39.5, while that of the wild-type plant's leaves was 34. ZmCRY1 The photosynthetic rate of the plant was 16.2% higher than that of the wild-type plant, a highly significant difference, indicating that... Figure 5 It can significantly increase the photosynthetic rate of maize leaves ( ​ ).

[0040] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments.

[0041] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. ZmCRY1 The application of genes in improving maize photosynthetic performance, the ZmCRY1 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

2. As described in claim 1 ZmCRY1 The application of genes in improving maize photosynthetic performance is characterized by, The application is: through overexpression ZmCRY1 Genes can be used to increase the chlorophyll content or photosynthetic rate of corn leaves.

3. As described in claim 2 ZmCRY1 The application of genes in improving maize photosynthetic performance is characterized by, The overexpression ZmCRY1 Genes build corn ZmCRY1 This is achieved through transgenic positive plants.

4. The method according to claim 3 ZmCRY1 The application of genes in improving maize photosynthetic performance is characterized by, The construction of corn ZmCRY1 Transgenic positive plants include the following steps: cloning ZmCRY1 Genes, through Sma I and Bam HI-HF restriction site will ZmCRY1 Gene insertion vector pBCXUN China Construction pBCXUN-ZmCRY1 Fusion expression vector was used to transform GV3101 Agrobacterium tumefaciens competent cells, and Agrobacterium tumefaciens was used to transform maize plants.

5. The method according to claim 4 ZmCRY1 The application of genes in improving maize photosynthetic performance is characterized by, The clone ZmCRY1 The primers used for the gene are shown in SEQ ID NO:1 and SEQ ID NO:

2.

6. A kind pBCXUN-ZmCRY1 The integrated expression carrier is characterized by, The pBCXUN-ZmCRY1 The fusion expression carrier is as described in claim 4 pBCXUN-ZmCRY1 The integrated expression carrier; pBCXUN-ZmCRY1 Integration of expression carriers through Sma I and Bam HI-HF restriction site will ZmCRY1 Gene insertion vector pBCXUN Obtained through construction.

7. The method according to claim 6 pBCXUN-ZmCRY1 The integrated expression carrier is characterized by, The carrier pBCXUN By carrier pCXUN of Hyg Plant resistance gene enzyme digestion replacement with Bar Obtained after the resistance gene.

8. A method for improving the photosynthetic performance of maize, characterized in that, The method is as follows: [The method described in claim 6] pBCXUN-ZmCRY1 After transforming GV3101 Agrobacterium tumefaciens competent cells with the fusion expression vector, Agrobacterium tumefaciens was then used to transform maize plants, thereby improving the photosynthetic performance of maize.

Images