Cassava low temperature tolerance meSR34b gene and application thereof

By providing the MeSR34b gene for cassava's low-temperature tolerance and related technologies, the problem of cassava's sensitivity to low temperatures has been solved, improving cassava's low-temperature tolerance and stress resistance, and promoting the expansion of cassava planting and the cultivation of ornamental varieties.

CN120966897BActive Publication Date: 2026-04-28SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511478414.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-16
Publication Date
2026-04-28
Estimated Expiration
2045-10-16

AI Technical Summary

Technical Problem

Cassava is sensitive to low temperatures, which inhibits its growth and development, limiting its planting area and economic benefits. Current technology lacks cold-resistant varieties, making it difficult to meet market demand.

Method used

We provide the MeSR34b gene for cassava's low-temperature tolerance, along with its related recombinant vector, host bacteria, and expression cassette. Through genetic engineering, we aim to improve cassava's low-temperature tolerance, reduce malondialdehyde content, increase proline accumulation, and enhance its resistance to oxidative damage. We also differentiate transgenic lines by the yellowing of new leaves.

Benefits of technology

It significantly improved the low-temperature resistance of cassava, reduced oxidative damage, and enhanced its stress resistance, providing a new approach for the breeding of ornamental cassava varieties and improving the economic benefits and adaptability of cassava.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120966897B_ABST
    Figure CN120966897B_ABST
Patent Text Reader

Abstract

The application provides a cassava low-temperature-resistant MeSR34b gene, and a CDS sequence of the cassava low-temperature-resistant MeSR34b gene is shown as SEQ ID NO:1. The application provides that the cassava low-temperature-resistant MeSR34b gene is cloned from cassava for the first time, the expression of the MeSR34b gene in cassava is inhibited under low-temperature stress, research shows that the gene can significantly improve the low-temperature resistance of cassava, improve the content of malondialdehyde and the accumulation amount of proline in cassava, reduce the oxidative damage of cells, make the new leaves of cassava yellow, and regulate the expression of various protein genes. The application provides a new candidate gene for improving the low-temperature resistance of plants, the resistance to oxidative damage and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biology, specifically relating to the cassava low-temperature resistant MeSR34b gene and its applications. Background Technology

[0002] Cassava (Manihot esculenta) is a globally important food and energy crop. Its storage roots are rich in starch and are a major food source for nearly one billion people in tropical and subtropical regions worldwide. Through long-term evolution and artificial selection, cultivated cassava has achieved exceptional efficiency in utilizing light, heat, and water resources, with a biomass yield per unit area higher than almost all other cultivated crops. It also exhibits high light efficiency, drought tolerance, tolerance to poor soil conditions, and sensitivity to low temperatures. However, due to generally low levels of scientific and technological investment and research on cassava as a tropical crop, fundamental research on its yield, quality, stress resistance, and adaptability has lagged significantly, resulting in its yield, quality, and resistance potential not being fully explored.

[0003] In my country, cassava is mainly cultivated in tropical and subtropical provinces such as Guangxi, Guangdong, and Hainan, with an annual planting area of ​​approximately 6 million mu (about 400,000 hectares) and an annual fresh cassava yield of about 10 million tons. However, more than 15 million tons of dried cassava chips need to be imported annually, indicating a huge demand gap. Meanwhile, due to environmental degradation, reduced arable land, pests and diseases, drought, salinity, and low temperatures, the development of cassava cultivation has been consistently constrained. These factors result in yield losses exceeding 50% annually, leading to a shortage of raw materials for the cassava processing industry. To meet market demand, it is necessary to continue expanding the cassava planting area and improve breeding and cultivation techniques. Therefore, conducting theoretical research on cassava's adaptation to stress and cultivating high-yield, stress-resistant new cassava germplasm plays an irreplaceable role in meeting people's diverse needs for quality of life.

[0004] Cassava is highly sensitive to low temperatures and thrives best in areas with an average temperature above 18°C ​​and a frost-free period of at least eight months per year. Its growth and development begin to be inhibited when temperatures drop below 15°C, and below 4°C, apical growth is suppressed, plants wilt, and stems die. Low-temperature stress after tuber formation restricts tuber enlargement and starch accumulation, leading to reduced yield. In recent years, although cassava has been introduced and tested in provinces such as Yunnan, Guizhou, Fujian, Jiangxi, and Shandong, the lack of cold-resistant varieties has limited the planting area and economic benefits due to the impact of low temperatures. Therefore, conducting basic research on cold-resistant breeding to cultivate cold-resistant cassava varieties, enabling the northward expansion of cassava cultivation, and meeting the energy industry's demand for cassava raw materials is an urgent need for the development of the cassava industry. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a cassava low-temperature resistant MeSR34b gene and its application.

[0006] The first aspect of the present invention is to provide a cassava low-temperature resistant MeSR34b gene, the CDS sequence of which is shown in SEQ ID NO:1.

[0007] The second aspect of the present invention is to provide a protein encoded by the cassava low-temperature tolerance MeSR34b gene described in the first aspect of the present invention.

[0008] A third aspect of the present invention is to provide a recombinant vector containing the coding region of the cassava low-temperature tolerance MeSR34b gene as described in the first aspect of the present invention.

[0009] The original vector for the recombinant vector can be a vector commonly used in the field of gene recombination, such as a virus or plasmid. This invention does not limit this. In one specific embodiment of this invention, the original vector is the pCambia1301 vector, etc., but it should be understood that other plasmids or viruses can also be used.

[0010] Preferably, the original vector of the recombinant vector is the pCambia1301 vector, and the coding region of the cassava cold-resistant MeSR34b gene is located between the BanHI and SalI restriction endonuclease sites of the pCambia1301 vector. The 5' end of the pCambia1301 vector contains the CaMV35S promoter and either the myc or RFP sequence, and the 3' end contains the Nos terminator.

[0011] A fourth aspect of the invention is to provide a host bacterium containing the coding region of the cassava low-temperature resistant MeSR34b gene as described in the first aspect.

[0012] The fifth aspect of the present invention is to provide an expression cassette containing the coding region of the cassava low-temperature tolerance MeSR34b gene as described in the first aspect of the present invention.

[0013] The sixth aspect of the present invention is to provide the use of the cassava low-temperature tolerance MeSR34b gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in improving the low-temperature tolerance of cassava and / or reducing malondialdehyde content and / or increasing proline accumulation.

[0014] The seventh aspect of this invention provides the application of the cassava low-temperature tolerance MeSR34b gene as described in the first aspect of this invention, or the protein as described in the second aspect of this invention, or the recombinant vector as described in the third aspect of this invention, or the host bacterium as described in the fourth aspect of this invention, or the expression cassava ...

[0015] The eighth aspect of the present invention is to provide the application of the cassava low-temperature tolerance MeSR34b gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in improving the oxidative damage resistance of cassava.

[0016] The ninth aspect of the present invention is to provide the application of the cassava low-temperature tolerance MeSR34b gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in improving the resistance of cassava to methyl violaroid damage.

[0017] The tenth aspect of the present invention is to provide the use of the cassava low-temperature tolerant MeSR34b gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassava as described in the fifth aspect of the present invention in the breeding of ornamental cassava varieties, and / or the breeding of low-temperature tolerant cassava varieties, and / or the screening of low-temperature tolerant cassava germplasm.

[0018] The eleventh aspect of the present invention is to provide the use of the cassava low-temperature resistant MeSR34b gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in enhancing the expression of the MeBED gene, and / or enhancing the expression of the MeATL54 gene, and / or enhancing the expression of the MeWRKY42 / 33 gene, and / or enhancing the expression of the MeDREB2a / 2f gene.

[0019] The twelfth aspect of the present invention is to provide a primer pair, said primer pair being MeSR34b cloning primer Sense Primer: CGGGATCCTATGAGTAGCCGCGCGAGCAGAA and MeSR34b cloning primer Antisense Primer: ACGCGTCGACTCACCGGGATAAGCTCCTGCTC.

[0020] This invention provides the first cloned MeSR34b gene for cold tolerance in cassava. Under low-temperature stress, MeSR34b gene expression in cassava is suppressed. Studies show that this gene can significantly improve cassava's cold tolerance, increase malondialdehyde content and proline accumulation, reduce oxidative damage to cells, induce yellowing of new cassava leaves, and regulate the expression of multiple protein genes. This invention provides a new candidate gene for research on improving plant cold tolerance, resisting oxidative damage, breeding ornamental cassava varieties, developing cold-tolerant transgenic cassava, and screening cold-tolerant cassava varieties. Attached Figure Description

[0021] Figure 1 Expression analysis of the MeSR34b gene in different tissue sites and at low temperature.

[0022] Figure 2 Subcellular localization analysis of MeSR34b.

[0023] Figure 3 Identification and phenotypic analysis of cassava MeSR34b high expression lines.

[0024] Figure 4 Phenotypic analysis and stress resistance analysis of cassava MeSR34b high expression lines.

[0025] Figure 5 To identify and validate downstream genes regulated by MeSR34b. Detailed Implementation

[0026] The present invention will be further described below with reference to the accompanying drawings and specific embodiments to better understand the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0027] Example 1: Cloning of the MeSR34b gene for low-temperature tolerance in cassava

[0028] After extracting RNA from cassava leaves, cDNA was obtained by reverse transcription using the TaKaRa PrimeScript II 1st Strand cDNA Synthesis kit. The cDNA was then used as a template for PCR cloning of the MeSR34b gene. The cloning primers used were the MeSR34b cloning primer Sense Primer: CGGGATCCTATGAGTAGCCGCGCGAGCAGAA (containing the BanH 1 site) and the MeSR34b cloning primer Antisense Primer: ACGCGTCGACTCACCGGGATAAGCTCCTGCTC (containing the Sal 1 site). The PCR amplification system is shown in Table 1, and the PCR reaction procedure is shown in Table 2. The amplification products were recovered and sequenced to obtain the CDS sequence of the cassava MeSR34b gene, as shown in SEQ ID NO:1.

[0029] Table 1 PCR amplification system

[0030] Components volume Sense Primer (10µM) 1.0 μL Antisense Primer (10µM) 1.0 μL Cassava leaf cDNA 1.0 μL 2×PrimerSTAR Max DNA Polymerase 25 μL <![CDATA[ddH2O]]> 23 μL Total 50 μL

[0031] Table 2 PCR reaction procedure

[0032]

[0033] Example 2: Expression analysis of the cassava MeSR34b gene in different tissues

[0034] To investigate the expression characteristics of the cassava MeSR34b gene in different tissues, eight tissue samples from cassava were collected and subjected to real-time quantitative PCR to detect the expression of the cassava MeSR34b gene.

[0035] Forward primer: AGAACTCTCTATGTTGGAAATC and Reverse primer: CTCCATGTGCAAGCTCCACTCG were used as primers. The reaction system is shown in Table 3. The reaction program was: 95℃ for 10s, 55℃ for 5s, 72℃ for 15s, for 40 cycles. Each sample was repeated 3 times. 一△△Ct The data was processed using this method, and Microsoft Excel analyzed the output and created charts. The results are as follows: Figure 1 As shown in A, MeSR34b is preferentially expressed in cassava callus, leaves, and terminal buds, while its expression level is lowest in flowers.

[0036] Table 3 shows the reaction system as follows:

[0037] Component Volume TB Green Premix Ex Taq II 10 μL ROX Reference Dye 0.4 μL Template 1 μL Forward primer 0.8 μL <![CDATA[Reverse primerddH2OTotal]]> 0.8 μL 7.0 μL 20 μL

[0038] Example 3: Expression analysis of cassava MeSR34b gene under low temperature stress

[0039] Cassava seedlings were treated with low temperature (5-week-old tissue culture seedlings were placed in a 4°C light incubator for 24 hours), and RNA was extracted from young leaves and terminal buds for qRT-PCR (the qRT-PCR method was the same as in Example 2) to study the response of the MeSR34b gene to adverse environments. The results showed that low temperature inhibited its expression. Figure 1 B).

[0040] Example 4: Construction of plant overexpression vectors

[0041] The amplification product from Example 1 was ligated into the pCambia1301 vector using BanHI and SalI double digestion. The 5' end of the pCambia1301 vector contains the CaMV35S promoter and either a myc or RFP sequence, while the 3' end contains the Nos terminator. This resulted in the construction of the 1301-35S::myc-MeSR34b and 1301-35S::RFP-MeSR34b vectors.

[0042] Example 5: Subcellular localization analysis of MeSR34b

[0043] The 1301-35S::RFP-MeSR34b plasmid was transferred into Agrobacterium GV3101 competent cells using a heat shock method (i.e., 100 μL of competent Agrobacterium cells were placed in a pre-chilled centrifuge tube, 0.1-1 μg of plasmid DNA was added, the centrifuge tube was quickly placed in liquid nitrogen for 5 minutes, the centrifuge tube was quickly removed from the liquid nitrogen and immediately placed in a 37°C water bath for 5 minutes, and then spread on a culture medium). The Agrobacterium cells were spread on solid YEP medium supplemented with kanamycin and rifampin antibiotics. After colonies grew, PCR identification was performed. PCR-positive colonies were shaken and stored for subsequent plant infection.

[0044] Take Agrobacterium bacterial culture containing plasmid 1301-35S::RFP-MeSR34b, centrifuge, and resuspend in infiltration buffer containing acetylsuccinone and magnesium salt to an appropriate concentration (OD). 600 ≈ 0.5-1.0), after static induction at room temperature, the bacterial solution was injected into the underside of healthy tobacco leaves using a syringe (without a needle) to allow the leaves to be saturated with the bacterial solution. The plants were then cultured normally for 2-5 days for subcellular localization observation. Injection into the lower epidermal leaves of tobacco via transient transformation and observation using confocal fluorescence microscopy revealed that the MeSR34b protein was localized in the cell nucleus ( ). Figure 2 ).

[0045] Example 5: Effects of MeSR34b on plants

[0046] The 1301-35S::myc-MeSR34b plasmid was transferred into Agrobacterium GV3101 competent cells using a heat shock method (i.e., take 100 μL of competent Agrobacterium cells into a pre-cooled centrifuge tube, add 0.1-1 μg of plasmid DNA, quickly place the centrifuge tube into liquid nitrogen for 5 minutes, quickly remove the centrifuge tube from the liquid nitrogen, and immediately place it in a 37℃ water bath for 5 minutes for heat shock). Agrobacterium cells were then spread on solid YEP medium supplemented with kanamycin and rifampicin antibiotics. After colonies grew, PCR identification was performed. PCR-positive colonies were shaken and preserved for subsequent plant infection.

[0047] Embryogenic fragile callus from cassava cultivar cv.60444 was used as recipient material. Agrobacterium tumefaciens with an OD of approximately 1.0 containing the 1301-35S::myc-MeSR34b plasmid was collected by centrifugation, washed twice with MS medium without antibiotics, and resuspended in an equal volume of MS medium supplemented with 100 mmol / L acetylsyringone. A small amount of embryogenic fragile callus was added and suspended at room temperature for 40 min. After centrifugation, the bacterial suspension was removed, and the callus cells were placed on MS solid medium supplemented with 100 mmol / L acetylsyringone and cultured in the dark at 22°C for 3 days. After repeatedly washing the callus cells with sterile water, the callus cells were placed on GD solid medium supplemented with 500 mg / L carbenicillin and 5 mg / L hygromycin and cultured at 26°C under light for 2 weeks. Cells that did not successfully transform were eliminated and resistant callus cells were induced. The callus cells were then transferred to embryo induction medium supplemented with 500 mg / L carbenicillin and 5 mg / L hygromycin to obtain resistant transgenic plants.

[0048] like Figure 3 As shown, through genetic transformation of cassava (callus transformation), MeSR34b-expressing plant lines were obtained. Figure 3 (A), Western blot detected high MeSR34b protein expression ( Figure 3 (B). Observation of the overexpression lines revealed that the color of new leaves was yellower than that of the wild type, exhibiting lower chlorophyll content, but the color and chlorophyll content of mature leaves were not significantly different from those of the wild type. The expression of the chlorophyll degradation genes MeSRG1 / 2 in new leaves was detected, and it was found that the expression of both MeSRG1 and MeSRG2 genes in the overexpression lines was higher than that in the wild type. Figure 3 C and Figure 3 The D-value indicates that leaf color is related to faster chlorophyll degradation. Therefore, the color of new leaves can be used to preliminarily distinguish between transgenic and conventional lines. Furthermore, the appearance of yellow new leaves can increase the ornamental value of cassava plants, providing a new avenue for cultivating ornamental cassava varieties.

[0049] Transgenic plants were transferred to an outdoor environment for 30 days of growth, and then subjected to low-temperature treatment for 6 days in a light incubator with a temperature of 4℃, a light / dark cycle of 16h / 8h, and a humidity of 70% along with ordinary cassava plants of similar growth. Morphological observations and photographs were taken at different treatment time points, and the contents of malondialdehyde (MDA) and proline were measured at different time points. The results showed that after low-temperature treatment of WT and MeSR34b OE #1 and #2 for 4h and 6d, phenotypic differences were observed. WT plants showed softened terminal buds and drooping leaves after low-temperature treatment, while the MeSR34b OE lines only showed partial leaf wilting, with no impact on the terminal buds. This indicates that overexpression of MeSR34b significantly improved the tolerance of cassava. Figure 4 Physiological indicators revealed that the malondialdehyde (MDA) content in the transgenic lines was significantly lower than that in the wild-type lines. Figure 4 The B group, while the proline accumulation was significantly higher than that of the wild type. Figure 4 (C).

[0050] Leaves from transgenic plants and ordinary cassava plants with similar growth patterns were collected. The detached leaves were soaked in a 100 μM methyl viologen aqueous solution and placed in a light incubator at 26℃, with a light / dark cycle of 16h / 8h and 70% humidity for 5 days. Methyl viologen rapidly induced typical oxidative damage symptoms such as chlorosis and necrosis in the leaves. The antioxidant capacity of the leaves was then assessed by photographing. Methyl viologen can induce oxidative damage in plants. Treatment of mature leaves from cassava WT and MeSR34b OE lines with methyl viologen revealed that the yellowing rate of WT leaves was significantly earlier than that of MeSR34b OE leaves, and the chlorophyll content was also lower in WT leaves than in MeSR34b OE leaves. Figure 4 D and Figure 4 The results (E) indicate that high expression of MeSR43b reduces oxidative damage in cells, thereby enhancing the plant's tolerance to low temperatures.

[0051] Example 5: Cassava MeSR34b specifically regulates the expression of 2930 protein-coding genes.

[0052] To further investigate key downstream genes and signaling pathways regulated by MeSR34b, we performed transcriptomic sequencing analysis on WT and MeSR34b-overexpressing lines. We used DEseq for differential expression analysis of downstream genes, comparing transgenic lines with the control group, and selecting genes with |log2Ratio|≥1 and q<0.05 as differentially expressed downstream genes. We found that a considerable number of protein-coding genes are directly or indirectly regulated by MeSR34b (…). Figure 5A). KEGG analysis of differentially regulated genes by MeSR34b revealed a significant enrichment of genes involved in secondary metabolism. Figure 5 Using quantitative and semi-quantitative PCR, it was found that MeSR34b can induce differential expression of the alternative splice variants of the MeBED (Manes.03G090703) and MeATL54 (Manes.13G097400) genes. Figure 5 The expression of genes such as MeWRKY42 / 33 (Manes.03G132901 / Manes.04G102600) and MeDREB2a / 2f (Manes.08G096900 / Manes.08G048500) (https: / / phytozome-next.jgi.doe.gov / ) is strongly induced by MeSR34b. Figure 5 (D), these will be the focus of in-depth research in subsequent studies.

[0053] In crop cultivation and breeding, identifying downstream genes and interacting factors regulated by target genes is of paramount importance. Its functions are: First, to elucidate regulatory networks, revealing the complete molecular pathways through which target genes control cold resistance and yield via cascade reactions. Second, to precisely guide breeding, as downstream genes and interacting factors can serve as more direct and stable molecular markers to guide genetic breeding, accelerate the aggregation of superior alleles, and avoid the unpredictability of multi-gene regulation. Third, to discover new targets, as downstream genes and interacting factors themselves may be key switches regulating traits, serving as new targets for gene editing or transgenic breeding, thereby bypassing the potential negative effects of upstream major genes and achieving more refined trait improvement. In this invention, the study of regulatory genes in cassava using MeSR34b provides a theoretical basis and gene resources for the targeted and efficient genetic improvement of cassava's stress resistance traits.

[0054] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to this invention are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. The application of overexpression of the cassava cold-resistance MeSR34b gene, or overexpression of the protein encoded by the cassava cold-resistance MeSR34b gene, or the use of a recombinant vector, host bacterium, or expression cassette containing the cassava cold-resistance MeSR34b gene in improving the cold resistance of cassava, characterized in that, The CDS sequence of the cassava low-temperature resistant MeSR34b gene is shown in SEQ ID NO:

1.

2. The application of overexpression of the cassava low-temperature tolerance MeSR34b gene, or overexpression of the protein encoded by the cassava low-temperature tolerance MeSR34b gene, or the use of a recombinant vector, host bacterium, or expression cassette containing the cassava low-temperature tolerance MeSR34b gene in inducing yellowing of new cassava leaves, characterized in that, The CDS sequence of the cassava low-temperature resistant MeSR34b gene is shown in SEQ ID NO:

1.

3. The application of overexpression of the cassava low-temperature tolerance MeSR34b gene, or overexpression of the protein encoded by the cassava low-temperature tolerance MeSR34b gene, or the use of a recombinant vector, host bacterium, or expression cassette containing the cassava low-temperature tolerance MeSR34b gene in improving the oxidative damage resistance of cassava, characterized in that, The CDS sequence of the cassava low-temperature resistant MeSR34b gene is shown in SEQ ID NO:1; the antioxidant damage is anti-methyl viologen damage.

4. The application of overexpression of the cassava low-temperature tolerance MeSR34b gene, or overexpression of the protein encoded by the cassava low-temperature tolerance MeSR34b gene, or a recombinant vector, host bacterium, or expression cassette containing the cassava low-temperature tolerance MeSR34b gene, in the cultivation of ornamental cassava varieties with yellowing new leaves, and / or the cultivation of low-temperature tolerant cassava varieties, and / or the screening of low-temperature tolerant cassava germplasm, characterized in that, The CDS sequence of the cassava low-temperature resistant MeSR34b gene is shown in SEQ ID NO:

1.

5. The application according to any one of claims 1-4, characterized in that, The original vector of the recombinant vector is the pCambia1301 vector. The coding region of the cassava low-temperature resistant MeSR34b gene is located between the BanHI and SalI restriction endonuclease sites of the pCambia1301 vector. The 5' end of the pCambia1301 vector is the CaMV35S promoter and the myc or RFP sequence, and the 3' end is the Nos terminator.