Method for detecting food-borne pathogenic bacteria by time-of-flight mass spectrometry

Abstract

The invention provides a method for detecting eight food-borne pathogenic bacteria by a time-of-flight mass spectrometry. A primer group comprises a specific primer pair combination of multiple PCR (Polymerase Chain Reaction) of the eight food-borne pathogenic bacteria, wherein the food-borne pathogenic bacteria comprise intestinal aggregation Escherichia coli, intestinal hemorrhagic Escherichia coli, intestinal invasive Escherichia coli, intestinal pathogenic Escherichia coli, Shiga toxin producing Escherichia coli, enterotoxin producing Escherichia coli, listeria monocytogenes and salmonella typhimurium. According to the method, a specific primer is used for performing multiple PCR amplification on pathogen DNA, and the size of a fragment of a multiple PCR product is detected through MALDI-TOF MS. According to the method, multiple PCR and MALDI-TOF MS are combined to be used for identifying clinical pathogenic microorganisms, and the method is rapid, simple, convenient, easy to observe, visual and high in accuracy.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology detection and relates to a method for rapidly identifying eight foodborne pathogens using time-of-flight mass spectrometry. Background Technology

[0002] Food poisoning caused by foodborne pathogens has become a significant threat to public health. Therefore, rapid detection of foodborne pathogens is crucial for improving food safety. Foodborne pathogens such as Salmonella, Staphylococcus aureus, Listeria monocytogenes, Vibrio cholerae, Vibrio vulnificus, Vibrio parahaemolyticus, Shigella, and Escherichia coli pose a serious threat to consumer health. Foodborne illnesses caused by these pathogens, such as abdominal pain, diarrhea, and vomiting, have been on the rise in recent years. The World Health Organization has found that approximately 600 million cases of foodborne illness occur globally each year, resulting in 420,000 deaths. Therefore, early detection of foodborne pathogens is an effective means of preventing foodborne disease outbreaks. While cell culture-based methods have long been considered the gold standard for foodborne pathogen detection, these methods require steps such as enrichment, selective culture, purification, and biochemical identification, making them cumbersome and time-consuming, and thus difficult to meet current rapid detection needs. While detection methods based on the principle of specific antigen-antibody binding are relatively simple to operate, they lack sensitivity and are prone to false negatives. Therefore, developing novel, rapid, and efficient detection technologies for foodborne pathogens is an important issue that urgently needs to be addressed.

[0003] Methods for detecting foodborne pathogens include traditional culture methods and immunological methods. Traditional culture methods are the gold standard, but they are cumbersome, require highly skilled operators, and have long testing cycles, ranging from 2 to 20 days. Furthermore, biochemical differences between species within the same genus are not significant. Immunological methods, based on the principle of specific antigen-antibody binding, are simple, convenient, and rapid, but their biggest drawback is insufficient sensitivity, frequently resulting in false negatives and missed detections, thus failing to fully meet the needs for pathogen detection.

[0004] Over the years, to overcome the limitations of traditional detection methods, a simple, highly specific, and highly sensitive nucleic acid detection method has emerged. This method detects pathogens by hybridizing the target nucleic acid sequence with a synthetic oligonucleotide (probe or primer) complementary to the target sequence, based on the specific DNA or RNA sequence of the target pathogen. Nucleic acid detection technology for foodborne pathogens has advantages such as simplicity, short processing time, high specificity, and high sensitivity, and has been widely used in the detection of foodborne pathogens.

[0005] Chiang et al. (Chiang YC, Tsen HY, Chen HY, et al. Multiplex PCR and achromogenic DNA macroarray for the detection of Listeria monocytogens, Staphylococcus aureus, Streptococcus agalactiae, Enterobacter sakazakii, Escherichia coli O157:H7, Vibrio parahaemolyticus, Salmonella spp.AndPseudomonas fluoresc[J].J Microbiol Methods, 2012, 88(1):110-116) and Zhou et al. (Guan, Zheng P, Gao, et al. Rapid and simultaneous analysis of five foodbornepathogenic bacteria using multiplex PCR[J].European Food A conventional PCR detection method for Escherichia coli O157, Listeria monocytogenes, Vibrio parahaemolyticus, Salmonella, and Shigella in food was established in Research & Technology, 2013, 237(4):627-637. This detection method is highly specific, sensitive, and uses inexpensive instruments, but it is easily affected by inhibitors; moreover, the amplification products need to be interpreted by agarose gel electrophoresis, which is time-consuming and requires high technical skills from the testing personnel.

[0006] Quantitative real-time PCR (qPCR), compared to conventional PCR, does not require post-amplification processing of samples. Instead, it uses fluorescent dyes or fluorescently labeled probes to label and track PCR products, allowing for real-time online monitoring. Due to its speed, high specificity, and high sensitivity, it is increasingly used in the detection of foodborne pathogens. However, this method is difficult to apply to multiplex PCR and is susceptible to fluorescence signal interference.

[0007] Loop-mediated isothermal amplification (LAMP) is a nucleic acid amplification technique established by Notomi et al. in 2000. This method requires 4 to 6 primers to specifically recognize 6 to 8 regions of the target fragment, and has the advantages of being simple, specific, efficient, and rapid. Under the strand displacement action of DNA polymerase, the target sequence can be amplified in a short time, while producing white magnesium pyrophosphate, a characteristic that can be judged by turbidity. Maruyama et al. (Maruyama F, Kenzaka T, Yamaguchi N, et al. Detection of Bacteria Carrying thestx2 Gene by In Situ Loop-Mediated Isothermal Amplification[J]. Applied and Environmental Microbiology, 2003, 69(8):5023-5028) first used this method to detect the foodborne pathogen Escherichia coli O157:H7 (stxa2). However, this method has high requirements for the target sequence and is prone to contamination.

[0008] In summary, each of the above methods has its own advantages and disadvantages. Therefore, it is necessary to establish rapid, multiplex, and high-throughput detection methods for various pathogens in food to improve the ability to prevent public health risks.

[0009] The time-of-flight mass spectrometry (TOF-MS), which emerged in the 1980s, broke with the traditional limitation of mass spectrometry to the analysis of small molecules. It enabled the study of biological macromolecules such as nucleic acids and proteins, greatly advancing the development of genomics and proteomics, and bringing revolutionary breakthroughs to the fields of biology and medicine. Its founders, Koichi Tanaka and John Bennett Fenn, were awarded the Nobel Prize in Chemistry in 2002. In 2014, the U.S. Food and Drug Administration (FDA) approved MALDI-TOF MS for clinical nucleic acid detection.

[0010] Therefore, the inventors have long studied the use of multiplex PCR technology combined with time-of-flight mass spectrometry to detect pathogenic bacteria. As the closest to the prior art, Chinese invention patent application 201810003358.8, entitled "Reagent kit for mass spectrometry identification of multiplex PCR products for Vibrio cholerae typing," provides a method for detecting foodborne pathogens using multiplex PCR technology combined with time-of-flight mass spectrometry. In this method, three sets of specific primers are designed for three specific fragments of Vibrio cholerae. By comparing the obtained nucleic acid fingerprint feature map with the nucleic acid fingerprint map of Vibrio cholerae in the library, the species of the foodborne pathogen to be tested can be determined.

[0011] However, this method is only applicable to foodborne pathogens of a single genus. For multiplex PCR combined with time-of-flight mass spectrometry for foodborne pathogens of different genus, if there are too many pathogens to be detected, factors such as primer self-pairing, primer dimer formation, and low amplification product quantity will affect the detection accuracy of time-of-flight mass spectrometry, and may even be less accurate than traditional multiplex PCR.

[0012] Therefore, there is a current need for multiplex PCR combined with time-of-flight mass spectrometry detection methods and products for detecting various foodborne pathogens. Summary of the Invention

[0013] One of the principles of this invention lies in combining MALDI-TOF mass spectrometry with multiplex PCR. By optimizing the multiplex PCR system, target amplification products are obtained, and these products are then detected by MALDI-TOF MS. More specifically, this method utilizes multiplex PCR to specifically amplify multiple oligonucleotide fragments of different sizes. By establishing a database of characteristic time-of-flight mass spectrometry peaks generated during mass spectrometry typing of different oligonucleotide fragments, the experimental results are compared with the standard chromatogram information of Vibrio cholerae in the database, thus enabling simultaneous detection of multiple target gene fragments from the multiplex nucleic acid amplification products.

[0014] The second principle of this invention lies in the following: during the optimization of the multiplex PCR system, the full sequence of the target nucleic acid is analyzed, and primers with conserved sequences are designed for multiplex PCR amplification. The primers are then improved based on the PCR amplification results, and finally, primer sequences effective for specific amplification are selected. To distinguish PCR products of similar size, tag sequences that do not affect PCR amplification are introduced into the primers. After purification, the multiplex PCR products are directly analyzed by MALDI-TOF MS, thus successfully achieving rapid detection of the target nucleic acid.

[0015] The third principle of this invention lies in providing a combined PCR and mass spectrometry detection technology to detect characteristic spectral signatures of fragments related to the typing of the pathogen to be tested. Specifically, for eight pathogens (enterogenes aggregatous Escherichia coli, enterohemorrhagic Escherichia coli, invasive Escherichia coli, enteropathogenic Escherichia coli, Shiga toxin-producing Escherichia coli, enterotoxin-producing Escherichia coli, Listeria monocytogenes, and Salmonella typhimurium), 13 primer sets are designed to simultaneously amplify DNA fragments containing specific target sequences of the eight pathogens in multiplex PCR. Subsequently, the amplified products are purified, and the purified mixture is detected by MALDI-TOF MS mass spectrometry. The molecular weight of each substance in the mixture is determined by the mass spectrometry peaks and compared with the pre-calculated theoretical molecular weight of the amplified product, thereby determining the type of pathogen to be tested in the extended product.

[0016] Therefore, the first objective of this invention is to provide a multiplex primer set for detecting eight foodborne pathogens using a combined time-of-flight mass spectrometry method, the sequences of which are as follows:

[0017]

[0018]

[0019] In one embodiment, the 5' end of the primer may be augmented with a base sequence serving as a linker, the linker sequence being a random combination of A, C, G, and T bases of varying lengths.

[0020] In any of the above embodiments, the primer combination may include a tag sequence as needed, so that the size of the multiplex PCR products can be easily distinguished by MALDI-TOF MS. In one specific embodiment, the tag sequence is ACGTTGGATG.

[0021] The second objective of this invention is to provide a detection kit for detecting genes related to eight foodborne pathogens prepared from the above primer combination, wherein the kit contains the above-mentioned specific primer combination for amplifying the above-mentioned pathogens and a mass spectrometry-specific spotting matrix.

[0022] In one embodiment, the sample matrix has the following composition: 3-HPA∶DHC∶formic acid = 4∶2∶1.

[0023] In one embodiment, the kit further includes reagents for PCR reaction: specific PCR primers, thermostable DNA polymerase, and PCR reaction buffer (containing dNTPs, Tris-HCl, and MgCl2).

[0024] In any of the above embodiments, the kit may further include: negative control, positive control, target sheet for spotting and mass spectrometry detection, DNA extraction reagent, and DNA purification reagent for PCR product purification. In one specific embodiment, the DNA purification reagent for PCR product purification includes one of: an adsorption column, magnetic beads, and resin.

[0025] The third objective of this invention is to provide a method for detecting genes related to eight foodborne pathogens in food using the aforementioned primer set or kit, comprising the following steps:

[0026] (1) Multiplex PCR amplification: Using specific PCR primers, the DNA regions containing genes associated with 8 foodborne pathogens are simultaneously amplified in one reaction system to obtain PCR products containing DNA regions containing different genes.

[0027] (2) PCR product purification: Multiplex PCR products were purified using DNA purification reagents;

[0028] (3) Spotting: The purified product and the matrix form a crystalline mixture, which is then spotted onto the chip;

[0029] (4) MALDI-TOF MS detection;

[0030] (5) Use a mass spectrometry signal processing system to analyze the detection results.

[0031] In one implementation, step (1), the multiplex PCR amplification step, includes:

[0032] (i) PCR reaction system: 0.5-10 μL PCR primer mixture, 1-2 μL PCR amplification enzyme, 5 μL PCR reaction solution, 1-5 μL DNA template, and the remainder is nuclease-free water. The concentration of each primer pair should be controlled between 1-5 μM.

[0033] (ii) Amplification reaction program: digest at 50℃ for 2 min, pre-denature at 95℃ for 2 min, denature at 95℃ for 30 s, anneal at 56℃ for 30 s, extend at 72℃ for 30 s, for 45 cycles, and finally extend at 72℃ for 5 min; or digest at 55℃ for 5 min, pre-denature at 95℃ for 30 s, denature at 95℃ for 2 s, anneal / extend at 60℃ for 15 s, for 45 cycles.

[0034] In one implementation, step (2), the PCR product purification step, includes:

[0035] (i) Remove the Genologue NGS CleanSelect magnetic beads from the refrigerator and let them stand at room temperature for 30 minutes, then vortex or invert the container to mix thoroughly. Note: The magnetic beads must be left at room temperature for 30 minutes after being removed from the refrigerator to avoid affecting the DNA recovery rate.

[0036] (ii) Add 90 μL of magnetic bead reagent to 50 μL of reaction sample, and mix thoroughly by vortexing or by pipetting up and down 10 times.

[0037] Note: The magnetic bead reagent is quite viscous and must be thoroughly mixed. If the sample volume is less than 50 μL, it can be made up to 50 μL with EB or deionized water. If the volume exceeds 50 μL, the amount of magnetic beads can be increased proportionally.

[0038] (iii) Let it sit at room temperature for 2 to 5 minutes.

[0039] (iv) Place the centrifuge tubes on the magnetic rack and let them stand for 2–5 minutes until the magnetic beads are completely adhered to the centrifuge tube walls. Discard all liquid.

[0040] (v) With the centrifuge tube still on the magnetic rack, slowly add 200 μL of 80% ethanol and let stand at room temperature for 1 minute without stirring. Discard all liquid. Note: 80% ethanol must be prepared before use.

[0041] (vi) Repeat step (5) once.

[0042] (vii) Leave the centrifuge tube on the magnetic rack and remove any remaining liquid with a pipette. Let it dry at room temperature for 5 minutes until the magnetic beads are mostly dry.

[0043] Note: Do not over-dry, heat-dry, or dry for too long. Cracks on the surface of the magnetic beads will reduce DNA elution and recovery efficiency.

[0044] (viii) Remove the centrifuge tube from the magnetic rack and add 20 μL (or other volume) of EB or nuclease-free deionized water. Vortex for 1 minute or resuspend the magnetic beads by pipetting up and down 10 times. Let stand at room temperature for 2–5 minutes.

[0045] (ix) Place the centrifuge tube on the magnetic separator and let it stand for 2–5 minutes until the magnetic beads are completely adsorbed onto the tube wall. Use a pipette to transfer 18 μL of the supernatant into a new tube or well to obtain the purified product.

[0046] In one implementation, step (3) the spotting step includes:

[0047] (i) Use tweezers to pick up a time-of-flight mass spectrometry microarray chip and gently place it on the target holder; the chip matrix contains formic acid, and the matrix composition is 3-HPA∶DHC∶formic acid=4∶2∶1;

[0048] (ii) Spot the samples sequentially according to their order, taking 0.5-1.0 μL of each sample;

[0049] (iii) Air dry at room temperature (10-15 min) or use a heater to dry (5 min).

[0050] In one implementation, in step (4) MALDI-TOF MS detection, a time-of-flight mass spectrometry system (model: Clin-ToFⅡ, manufacturer: Beijing Yixin Bochuang Biotechnology Co., Ltd., MALDI-TOF principle) is used to detect the peak signal.

[0051] Technical effect

[0052] This invention demonstrates a method for directly purifying multiplex PCR products and applying them to MALDI-TOF MS to successfully separate the multiplex PCR products. Compared with existing technologies, this invention has the following advantages:

[0053] 1. This invention is the first to propose the use of multiplex PCR combined with clinical mass spectrometry to achieve multiplex detection of foodborne pathogens, which has extremely high biological value;

[0054] 2. This invention provides a rapid and convenient method for detecting foodborne pathogens, allowing for the simultaneous nucleic acid detection of multiple samples containing various foodborne pathogens in a single test.

[0055] 3. The primer combinations of this invention have good specificity and high amplification efficiency, making them well-suited for the amplification of multiplex PCR products. Furthermore, the purified multiplex PCR products can be directly detected by MALDI-TOF MS. Accurate and rapid detection of multiplex PCR products using MALDI-TOF MS can prevent delays in clinical diagnosis and treatment.

[0056] 4. During detection and analysis, the size of the target product can be used to confirm the detection results. The detection results can be easily observed through mass spectrometry, making the operation convenient and quick. Even non-professionals without special training can successfully implement the detection method of this invention under the guidance of the instruction manual;

[0057] 5. In addition to being highly operable, improving detection efficiency, shortening detection time, and increasing the reliability of detection results, the multiplex PCR implemented in this invention is completed in the same PCR system, which saves the amount of sample DNA and reagents used in the PCR amplification system, greatly reducing detection costs. It can be widely used in the rapid diagnosis of various infectious diseases in clinical practice.

[0058] 6. Furthermore, this invention can be used to detect long DNA fragments with characteristic sequences rather than recognizing changes in single bases. It can detect single-stranded signal peaks up to 600 bp in length, broadening the mass range of nucleic acid samples detected by MALDI-TOF MS and making mass spectrometry detection of large nucleic acid molecules possible. Simultaneously, this method overcomes the increased probability of contamination from multiple tubes, simplifies operation, allows for simultaneous detection of multiple samples, shortens detection time, and maintains detection sensitivity and specificity, showing high promise for clinical applications.

[0059] 7. Through numerous comparative examples, this invention has verified that, for the same target gene of this invention, simply increasing or decreasing primer pairs, or even changing primer pairs without reducing the number of primer pairs, or decreasing or changing the target gene, all result in the inability to detect certain specific pathogens in multiple response manifestations. This proves that the experimental results of Example 1 of this invention were obtained through continuous optimization and screening, requiring a great deal of creative work.

[0060] Terms and Definitions

[0061] Time-of-flight mass spectrometry (TOF) mainly consists of two parts: a matrix-assisted laser desorption / ionization (MALDI) source and a time-of-flight mass analyzer (TOF). MALDI works by irradiating a co-crystallized film formed by the sample and matrix with a laser. The matrix absorbs energy from the laser and transfers it to nucleic acid fragments, ionizing them. TOF works by accelerating the ionized nucleic acid fragments through a high-voltage electric field and measuring the mass-to-charge ratio (M / Z) of the ions based on their flight time to the detector. A higher M / Z indicates a longer time to reach the receiver, while a lower M / Z indicates a shorter time. Based on this principle, different ions can be separated according to their M / Z. Time-of-flight mass spectrometers have a wide detectable molecular weight range, fast scanning speed, and simple instrument structure. Besides their high accuracy, flexibility, high throughput, and short detection cycle, the most attractive feature of time-of-flight mass spectrometry is its cost-effectiveness. In addition to protein and peptide detection, microbial identification, and glycosylation detection, it can also perform gene SNP, mutation, methylation, and CNV analysis. To date, few other clinical testing platforms can simultaneously handle multi-omics level analysis. The unique multiplex PCR technology, with its stable and accurate results and economical testing costs, meets the growing clinical demand for medium-throughput SNP and gene mutation detection.

[0062] This invention combines multiplex PCR with nucleic acid mass spectrometry for qualitative analysis of foodborne pathogens. The basic principle is to amplify the target pathogen's product through multiplex PCR, then disperse the sample in a matrix to form crystals. When the crystals are irradiated with a laser, the matrix absorbs energy from the laser, causing sample desorption. Charge transfer occurs between the matrix and sample, ionizing the sample molecules. The ionized sample then flies through a vacuum tube under an electric field and is detected based on its flight time to the detector. The analysis of ions is based on the ratio of their mass to charge (M / Z), which is proportional to their flight time, thus determining the molecular weight of the sample molecules. For example, when detecting DNA samples, DNA ions pass through the detector in order of their mass, with shorter DNA fragments arriving earlier. This system integrates PCR and mass spectrometry, thus possessing both high sensitivity and high accuracy. Furthermore, gene mass spectrometry eliminates the need for hybridization, avoiding potential mismatch interference, and eliminates the need for fluorescent dyes or other markers, directly using the molecular weight of the nucleic acid sample as a marker for precise qualitative analysis. This technology has many advantages: ① high accuracy and specificity; ② direct molecular weight detection without fluorescence signal interference; ③ simultaneous detection of multiple DNA fragments; ④ simple data analysis without the need for complex bioinformatics analysis.

[0063] The term "protective base" refers to an extra base added to the 5' end of a PCR primer. The sequence of the protective base increases the molecular weight of the PCR primer, making it easier to distinguish the sizes of multiplex PCR products by MALDI-TOF MS. For example, when the molecular weights of the PCR products corresponding to two genes are similar, adding a base to one of the PCR primers alters its molecular weight, widening the difference between its PCR product and the other products. This avoids excessive concentration of mass spectrometric peaks in local areas, preventing interference and unclear differentiation, thereby improving detection efficiency.

[0064] The term "detection window" refers to the range of nucleotide molecular weights that can be used for mass spectrometry detection, and usually relates to the primer design reference range. To avoid interference between different PCR products due to their similar molecular weights, a relatively wide detection window, such as 18,000-55,000 Da, is used to simultaneously detect multiple substances.

[0065] It should be noted that, given the special characteristics of nucleic acid mass spectrometry, such as the need to amplify the target fragment through PCR, purify the PCR product, and then detect it by mass spectrometry; the absence of significant interference between PCR reactions of different target fragments; and the need for sufficiently large differences in molecular weight between PCR products for differentiation, not all target fragments can be used for nucleic acid mass spectrometry detection, nor can all primers designed for target fragments be used for multiplex PCR reactions. For example, Cláudia MB et al. (Optimization of a multiplex minisequencing protocol for population studies and medical genetics, Genet. Mol. Res4 (2005) 115-125) pointed out that the reaction effect of singlex PCR should be verified before performing multiplex PCR. If the singlex PCR amplification efficiency is low, it should be abandoned; in addition, if the PCR product length is too long, the multiplex PCR effect will be poor, and it should also be abandoned. Nissum M et al. (High-throughput genetic screening using matrix-assisted laser desorption / ionization mass spectrometry, PsychiatrGenets 12 (2002) 109-117) also reported that in the process of high-throughput SNP detection using MALDI-TOF MS, they found that only 90% accuracy could be obtained. Furthermore, under standard experimental conditions, PCR amplification could not be performed in 5% of cases. Therefore, it is necessary to further optimize nucleic acid mass spectrometry experimental conditions (such as amplification primers, experimental parameters, etc.), otherwise it will affect MALDI accuracy.

[0066] – Application of TOF MS in nucleic acid mass spectrometry detection of target fragments. For example, in the control examples 1-5 of this invention, due to unsuitable primer combinations, the nucleic acid mass spectrometry structures of various pathogens appeared, resulting in the inability to identify various pathogens, such as enteroaggregative Escherichia coli, enteroinvasive Escherichia coli, and Listeria monocytogenes.

[0067] Furthermore, interference from the multiplex amplification process during nucleic acid mass spectrometry detection also affects the final PCR product. Sascha Sauer et al. (Typing of single nucleotide polymorphisms by MALDI mass spectrometry: Principles and diagnostic applications, Clinica Chimica Acta 363 (2006) 95–105) and Heyi Yang et al. (Multiplex single-nucleotide polymorphism genotyping by matrix-assisted laser desorption / ionization time-of-flight mass spectrometry, Analytical Biochemistry 314 (2003) 54–62) proposed in their research on nucleic acid mass spectrometry detection using MALDI mass spectrometry that the designed multiplex primers should have similar melting temperatures (Tm values) and weak interactions with each other. If the interaction between primers is too strong (the minimum value of ΔG is -10 kcal / mol), then the theoretically designed primers must be abandoned and redesigned. When multiple primers exist in the same reaction system, the scale of multiple amplification is mainly limited by the degree of interaction between primers, thus affecting the nucleic acid mass spectrometry detection process. For example, in the mass spectra of the control examples 1-5, not only are the characteristic peaks of many pathogenic bacteria not visible (…). Figure 14-15 ), and even the characteristic peaks of a single pathogen cannot be observed ( Figure 11-13 (16-18). It is evident that not all multiplex PCR primer sets designed for specific targets of pathogenic bacteria can be used for nucleic acid mass spectrometry, especially multiplex nucleic acid mass spectrometry. Their actual effectiveness is affected by a variety of experimental factors. Therefore, it is necessary to verify the feasibility of detection and screen different primer combinations through experiments. Attached Figure Description

[0068] Figure 1: This is the MALDI-TOF MS detection spectrum of intestinal aggregated Escherichia coli in Example 2 of the present invention.

[0069] Figure 2 : This is the MALDI-TOF MS detection spectrum of enterohemorrhagic Escherichia coli in Example 2 of the present invention.

[0070] Figure 3 : This is the MALDI-TOF MS detection spectrum of invasive Escherichia coli in Example 2 of the present invention.

[0071] Figure 4 : This is the MALDI-TOF MS detection spectrum of enteropathogenic Escherichia coli in Example 2 of the present invention.

[0072] Figure 5 : This is the MALDI-TOF MS detection spectrum of Shiga toxin-producing Escherichia coli in Example 2 of the present invention.

[0073] Figure 6 : This is the MALDI-TOF MS detection spectrum of enterotoxin-producing Escherichia coli in Example 2 of the present invention.

[0074] Figure 7 : This is the MALDI-TOF MS detection spectrum of Listeria monocytogenes in Example 2 of the present invention.

[0075] Figure 8 : This is the MALDI-TOF MS detection spectrum of Salmonella typhimurium in Example 2 of the present invention.

[0076] Figure 9 : This is the MALDI-TOF MS detection spectrum of enteropathogenic Escherichia coli and Salmonella typhimurium in Example 3 of the present invention.

[0077] Figure 10 : This is the MALDI-TOF MS detection spectrum of Shiga toxin-producing Escherichia coli and Listeria monocytogenes in Example 3 of the present invention.

[0078] Figure 11 : This is the MALDI-TOF MS detection spectrum of Salmonella typhimurium in Comparative Example 1 of the present invention.

[0079] Figure 12 : This is the MALDI-TOF MS detection spectrum of intestinal aggregated Escherichia coli in Comparative Example 2 of the present invention.

[0080] Figure 13 : This is the MALDI-TOF MS detection spectrum of invasive Escherichia coli in Comparative Example 2 of the present invention.

[0081] Figure 14 : This is the MALDI-TOF MS detection spectrum of enterohemorrhagic Escherichia coli in Comparative Example 3 of the present invention.

[0082] Figure 15 : This is the MALDI-TOF MS detection spectrum of Shiga toxin-producing Escherichia coli in Comparative Example 3 of the present invention.

[0083] Figure 16 : This is the MALDI-TOF MS detection spectrum of enteropathogenic Escherichia coli in Comparative Example 3 of the present invention.

[0084] Figure 17 : This is the MALDI-TOF MS detection spectrum of enterotoxin-producing Escherichia coli in Comparative Example 4 of the present invention.

[0085] Figure 18 : This is the MALDI-TOF MS detection spectrum of Listeria monocytogenes in Comparative Example 5 of the present invention. Detailed Implementation

[0086] To further understand the technical features of the present invention, the present invention will be described in detail below with reference to specific embodiments. These embodiments are merely illustrative and not restrictive in any way. Any non-substantial modifications made by those skilled in the art based on the present invention should fall within the protection scope of the present invention.

[0087] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0088] Customs officers conducted on-site inspections of frozen cooked goat meat imported from Mongolia. First, they checked the packaging and labels. Then, they opened the packaging, disinfected the meat, and took a portion of the cooked goat meat to inspect its appearance and quality, taking photos which were then uploaded to the customs' new-generation inspection system. Simultaneously, a random sample of the cooked goat meat was taken; the goods could only be cleared after subsequent laboratory testing confirmed its quality. The laboratory used a tissue sample nucleic acid extraction kit to extract DNA from the meat products. The extracted genomic DNA should not be stored at 2-8℃ for more than one week, at -20±5℃ for more than six months, and can be stored long-term below -70℃.

[0089] The quarantine procedures for the aforementioned samples shall be followed.

[0090] Example 1: Primer Design

[0091] (1) Specific primers were designed for each foodborne pathogen based on its specific sequence, totaling 13 pairs. All primers were synthesized by Shanghai Jierui Biotechnology Co., Ltd.

[0092] serial number Primer (5'→3') SEQ ID No: 1 gGGTCCAGTTTATCGTTATTACCAAAGG SEQ ID No: 2 ACTATGGTAGCGGAATTTCTCACG SEQ ID No: 3 GCAGCGATACATTAAGACGCCT SEQ ID No: 4 gCTACTTCTTATCTGGATTTAATGTCGCA SEQ ID No: 5 CAGCAGAAGCCTTACGCTTC SEQ ID No: 6 ACAAGTCCACAAGGAAAGTAAAGATG SEQ ID No: 7 CGGACAACAGAATACACTCCATC SEQ ID No: 8 gCGCCACTGATCATTAATCGCATC SEQ ID No: 9 GATGTTTTACTACCAGTCTGCGTC SEQ ID No: 10 GACTTCTTATTACCGTTCTATGATTCCG SEQ ID No: 11 TTTATTTGATGTGAATGGTGTGTTAGG SEQ ID No: 12 acgttggatgGGATGCTAAACCAGTAGAGTCTTCAA SEQ ID No: 13 TCACCGTGGTGACGCATG SEQ ID No: 14 tgCGGCCTTCAAATCGGCATC SEQ ID No: 15 gCAGCCAGAGCCGTGGATG SEQ ID No: 16 CCTTTTGACCAATTCGGACAACTAC SEQ ID No: 17 GTAAAGCTTCAGCTGTCACAGTAAC SEQ ID No: 18 CATCGTATACACAGGAGCAGTTTC SEQ ID No: 19 TCTGCGGTCCTAGTTAGAATTGAG SEQ ID No: 20 gTGTTGGCATGCTCTTCATGTTC SEQ ID No: 21 gACTTCCAGCGCTGAGGTG SEQ ID No: 22 gGACGTTGCGCTCATTACTTCTG SEQ ID No: 23 CCGTAAAGCGGGAGTCAATG SEQ ID No: 24 AGATACTCTATACCAGCCTATAATTTGTG SEQ ID No: 25 acgttggatgTACTATTCATGCTTTCAGGACCACTT SEQ ID No: 26 CCGCATCACGCAGTTCAAC

[0093] Note: Lowercase letters indicate connectors.

[0094] Example 2: Mass spectrometry detection of multiplex PCR products (18,000-55,000 Da) of a single foodborne pathogen.

[0095] 1. PCR amplification:

[0096] (1) PCR reaction system: 0.5-10 μL of PCR primer mixture, 1-2 μL of PCR amplification enzyme, 5 μL of PCR reaction solution, 1-5 μL of DNA template, and the remainder is Nuclease-free water. The concentration of each primer pair should be controlled between 1-5 μM.

[0097] (2) Amplification reaction program: digest at 50℃ for 2 min, pre-denature at 95℃ for 2 min, denature at 95℃ for 30 s, anneal at 56℃ for 30 s, extend at 72℃ for 30 s, for 45 cycles, and finally extend at 72℃ for 5 min.

[0098] Alternatively, digest at 55°C for 5 minutes, pre-denature at 95°C for 30 seconds, denature at 95°C for 2 seconds, anneal / extend at 60°C for 15 seconds, and repeat for 45 cycles.

[0099] 2. Purification of multiplex PCR products:

[0100] (1) Remove the Genologue NGS CleanSelect magnetic beads from the refrigerator and let them stand at room temperature for 30 minutes, then vortex or invert the container to mix thoroughly. Note: The magnetic beads must be left at room temperature for 30 minutes after being removed from the refrigerator to avoid affecting the DNA recovery rate.

[0101] (2) Add 90 μL of magnetic bead reagent to 50 μL of reaction sample, and vortex or pipette up and down 10 times to mix thoroughly. Note: The magnetic bead reagent is quite viscous and must be thoroughly mixed. If the sample volume is less than 50 μL, it can be made up to 50 μL with EB or deionized water. If the volume exceeds 50 μL, the amount of magnetic beads can be increased proportionally.

[0102] (3) Place at room temperature for 2 to 5 minutes.

[0103] (4) Place the centrifuge tubes on the magnetic rack and let them stand for 2-5 minutes until the magnetic beads are completely adsorbed onto the centrifuge tube walls. Discard all the liquid.

[0104] (5) Slowly add 200 μL of 80% ethanol to the centrifuge tube while it is still on the magnetic rack. Let it stand at room temperature for 1 minute without stirring. Discard all the liquid. Note: 80% ethanol must be prepared before use.

[0105] (6) Repeat step (5) once.

[0106] (7) Leave the centrifuge tube on the magnetic rack and remove any remaining liquid with a pipette. Allow it to air dry at room temperature for 5 minutes until the magnetic beads are mostly dry. Note: Do not over-dry, heat-dry, or dry for too long. Cracks on the surface of the magnetic beads will reduce DNA elution and recovery efficiency.

[0107] (8) Remove the centrifuge tube from the magnetic rack and add 20 μL (or other volume) of EB or nuclease-free deionized water. Vortex for 1 minute or resuspend the magnetic beads by pipetting up and down 10 times. Let stand at room temperature for 2–5 minutes.

[0108] (9) Place the centrifuge tube on the magnetic separator and let it stand for 2 to 5 minutes until the magnetic beads are completely adsorbed onto the centrifuge tube wall. Use a pipette to take out 18 μL of supernatant and transfer it into a new tube or well to obtain the purified product.

[0109] 3. Chip spotting: (1) Use tweezers to pick up a time-of-flight mass spectrometry microarray chip and place it gently on the target holder; (2) Spot the samples in sequence, taking 0.5-1.0 μL of each sample; (3) Air dry at room temperature (10-15 min) or use a heater to dry (5 min).

[0110] 4. Mass spectrometry detection: Peak signals are detected using a Clin-ToFⅡ (MALDI-TOF principle) mass spectrometer.

[0111] 5. The detection results were analyzed using a time-of-flight mass spectrometry signal processing system (MALDI-MS) to draw conclusions.

[0112] like Figure 1 As shown, the characteristic peaks of the mass spectrum are 28974.95 m / z and 30527.25 m / z, and their corresponding molecular weights are 28974.95 Da and 30527.25 Da.

[0113] like Figure 2 As shown, the characteristic peaks of the mass spectrum are 22178.55 m / z, 24653.55 m / z, 30527.25 m / z, and 31758.2 m / z, and their corresponding molecular weights are 22178.55 Da, 24653.55 Da, 30527.25 Da, and 31758.2 Da.

[0114] like Figure 3As shown, the characteristic peaks of the mass spectrum are 30527.25 m / z, 34233.2 m / z, and 37938.15 m / z, and their corresponding molecular weights are 30527.25 Da, 34233.2 Da, and 37938.15 Da.

[0115] like Figure 4 As shown, the characteristic peaks of the mass spectrum are 23416.3 m / z, 26197.55 m / z, and 30527.25 m / z, and their corresponding molecular weights are 23416.3 Da, 26197.55 Da, and 30527.25 Da.

[0116] like Figure 5 As shown, the characteristic peaks of the mass spectrum are 22178.55 m / z, 24653.55 m / z, 30527.25 m / z, and 31758.2 m / z, and their corresponding molecular weights are 22178.55 Da, 24653.55 Da, 30527.25 Da, and 31758.2 Da.

[0117] like Figure 6 As shown, the characteristic peaks of the mass spectrum are 30527.25 m / z, 35460.15 m / z, and 39164.15 m / z, and their corresponding molecular weights are 30527.25 Da, 35460.15 Da, and 39164.15 Da.

[0118] like Figure 7 As shown, the characteristic peak of the mass spectrum is 32992 m / z, and its corresponding molecular weight is 32992 Da.

[0119] like Figure 8 As shown, the characteristic peak of the mass spectrum is 36703.8 m / z, and its corresponding molecular weight is 36703.8 Da.

[0120] Therefore, Figures 1-8 It can detect single pathogens contained in a sample.

[0121] Example 3: Detection of multiple foodborne pathogens

[0122] 1. Sample DNA extraction:

[0123] Bacterial genomic DNA was extracted using a commercially available bacterial genomic DNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd., DP-302).

[0124] 2. PCR amplification:

[0125] (1) PCR reaction system: 0.5-10 μL of PCR primer mixture, 1-2 μL of PCR amplification enzyme, 5 μL of PCR reaction solution, 1-5 μL of DNA template, and the remainder is Nuclease-free water. The concentration of each primer pair should be controlled between 1-5 μM.

[0126] (2) Amplification reaction program: digest at 50℃ for 2 min, pre-denature at 95℃ for 2 min, denature at 95℃ for 30 s, anneal at 56℃ for 30 s, extend at 72℃ for 30 s, for 45 cycles, and finally extend at 72℃ for 5 min.

[0127] Alternatively, digest at 55°C for 5 minutes, pre-denature at 95°C for 30 seconds, denature at 95°C for 2 seconds, anneal / extend at 60°C for 15 seconds, and repeat for 45 cycles.

[0128] 3. Purification of multiplex PCR products:

[0129] (1) Remove the Genologue NGS CleanSelect magnetic beads from the refrigerator and let them stand at room temperature for 30 minutes, then vortex or invert the container to mix thoroughly. Note: The magnetic beads must be left at room temperature for 30 minutes after being removed from the refrigerator to avoid affecting the DNA recovery rate.

[0130] (2) Add 90 μL of magnetic bead reagent to 50 μL of reaction sample, and mix thoroughly by vortexing or by pipetting up and down 10 times.

[0131] Note: The magnetic bead reagent is quite viscous and must be thoroughly mixed. If the sample volume is less than 50 μL, it can be made up to 50 μL with EB or deionized water. If the volume exceeds 50 μL, the amount of magnetic beads can be increased proportionally.

[0132] (3) Place at room temperature for 2 to 5 minutes.

[0133] (4) Place the centrifuge tubes on the magnetic rack and let them stand for 2-5 minutes until the magnetic beads are completely adsorbed onto the centrifuge tube walls. Discard all the liquid.

[0134] (5) Slowly add 200 μL of 80% ethanol to the centrifuge tube while it is still on the magnetic rack. Let it stand at room temperature for 1 minute without stirring. Discard all the liquid. Note: 80% ethanol must be prepared before use.

[0135] (6) Repeat step (5) once.

[0136] (7) Leave the centrifuge tube on the magnetic rack and remove any remaining liquid with a pipette. Allow it to air dry at room temperature for 5 minutes until the magnetic beads are mostly dry. Note: Do not over-dry, heat-dry, or dry for too long. Cracks on the surface of the magnetic beads will reduce DNA elution and recovery efficiency.

[0137] (8) Remove the centrifuge tube from the magnetic rack and add 20 μL (or other volume) of EB or nuclease-free deionized water. Vortex for 1 minute or resuspend the magnetic beads by pipetting up and down 10 times. Let stand at room temperature for 2–5 minutes.

[0138] (9) Place the centrifuge tube on the magnetic separator and let it stand for 2 to 5 minutes until the magnetic beads are completely adsorbed onto the centrifuge tube wall. Use a pipette to take out 18 μL of supernatant and transfer it into a new tube or well to obtain the purified product.

[0139] 4. Chip spotting: (1) Use tweezers to pick up a time-of-flight mass spectrometry microarray chip and place it gently on the target holder; (2) Spot the samples in sequence, taking 0.5-1.0 μL of each sample; (3) Air dry at room temperature (10-15 min) or use a heater to dry (5 min).

[0140] 5. Mass spectrometry detection: Peak signals were detected using a Clin-ToFⅡ (MALDI-TOF principle) mass spectrometer.

[0141] 6. The detection results were analyzed using a time-of-flight mass spectrometry signal processing system (MALDI-MS) to draw conclusions.

[0142] Sample 1 ( Figure 9 The test revealed characteristic peaks of enteropathogenic Escherichia coli at 23416.3 m / z, 26197.55 m / z, and 30527.25 m / z, with corresponding molecular weights of 23416.3 Da, 26197.55 Da, and 30527.25 Da. Simultaneously, the test revealed a characteristic peak of Salmonella Typhimurium at 36703.8 m / z, with a corresponding molecular weight of 36703.8 Da. Therefore, sample 1 was determined to be a mixture of enteropathogenic Escherichia coli and Salmonella Typhimurium.

[0143] Sample 2 ( Figure 10 The sample was found to contain characteristic peaks of Shiga toxin-producing Escherichia coli at 22178.55 m / z, 24653.55 m / z, 30527.25 m / z, and 31758.2 m / z, with corresponding molecular weights of 22178.55 Da, 24653.55 Da, 30527.25 Da, and 31758.2 Da. Simultaneously, a characteristic peak of Listeria monocytogenes at 32992 m / z was detected, with a corresponding molecular weight of 32992 Da. Therefore, sample 2 was determined to be a mixture of Shiga toxin-producing Escherichia coli and Listeria monocytogenes.

[0144] As described above, the method of the present invention can accurately identify pathogens and their specific types even for samples containing multiple pathogens.

[0145] Comparative Example 1: Multiplex PCR detection of foodborne pathogens.

[0146] 1. Primer design

[0147] Fourteen pairs of specific primers were designed for each foodborne pathogen's specific sequence. All primers were synthesized by Shanghai Jereh Biotechnology Co., Ltd.

[0148]

[0149]

[0150]

[0151] 2. PCR amplification:

[0152] (1) PCR reaction system: 0.5-10 μL of PCR primer mixture, 1-2 μL of PCR amplification enzyme, 5 μL of PCR reaction solution, 1-5 μL of DNA template, and the remainder is Nuclease-free water. The concentration of each primer pair should be controlled between 1-5 μM.

[0153] (2) Amplification reaction program: digest at 50℃ for 2 min, pre-denature at 95℃ for 2 min, denature at 95℃ for 30 s, anneal at 56℃ for 30 s, extend at 72℃ for 30 s, for 45 cycles, and finally extend at 72℃ for 5 min.

[0154] Alternatively, digest at 55°C for 5 minutes, pre-denature at 95°C for 30 seconds, denature at 95°C for 2 seconds, anneal / extend at 60°C for 15 seconds, and repeat for 45 cycles.

[0155] 3. Purification of multiplex PCR products:

[0156] (1) Remove the Genologue NGS CleanSelect magnetic beads from the refrigerator and let them stand at room temperature for 30 minutes, then vortex or invert the container to mix thoroughly. Note: The magnetic beads must be left at room temperature for 30 minutes after being removed from the refrigerator to avoid affecting the DNA recovery rate.

[0157] (2) Add 90 μL of magnetic bead reagent to 50 μL of reaction sample, and vortex or pipette up and down 10 times to mix thoroughly. Note: The magnetic bead reagent is quite viscous and must be thoroughly mixed. If the sample volume is less than 50 μL, it can be made up to 50 μL with EB or deionized water. If the volume exceeds 50 μL, the amount of magnetic beads can be increased proportionally.

[0158] (3) Place at room temperature for 2 to 5 minutes.

[0159] (4) Place the centrifuge tubes on the magnetic rack and let them stand for 2-5 minutes until the magnetic beads are completely adsorbed onto the centrifuge tube walls. Discard all the liquid.

[0160] (5) Slowly add 200 μL of 80% ethanol to the centrifuge tube while it is still on the magnetic rack. Let it stand at room temperature for 1 minute without stirring. Discard all the liquid. Note: 80% ethanol must be prepared before use.

[0161] (6) Repeat step (5) once.

[0162] (7) Leave the centrifuge tube on the magnetic rack and remove the residual liquid with a pipette. Open the cap and let it dry at room temperature for 5 minutes until the magnetic beads are basically dry.

[0163] Note: Do not over-dry, heat-dry, or dry for too long. Cracks on the surface of the magnetic beads will reduce DNA elution and recovery efficiency.

[0164] (8) Remove the centrifuge tube from the magnetic rack and add 20 μL (or other volume) of EB or nuclease-free deionized water. Vortex for 1 minute or resuspend the magnetic beads by pipetting up and down 10 times. Let stand at room temperature for 2–5 minutes.

[0165] (9) Place the centrifuge tube on the magnetic separator and let it stand for 2 to 5 minutes until the magnetic beads are completely adsorbed onto the centrifuge tube wall. Use a pipette to take out 18 μL of supernatant and transfer it into a new tube or well to obtain the purified product.

[0166] 4. Chip spotting: (1) Use tweezers to pick up a time-of-flight mass spectrometry microarray chip and place it gently on the target holder; (2) Spot the samples in sequence, taking 0.5-1.0 μL of each sample; (3) Air dry at room temperature (10-15 min) or use a heater to dry (5 min).

[0167] 5. Mass spectrometry detection: Peak signals were detected using a Clin-ToFⅡ (MALDI-TOF principle) mass spectrometer.

[0168] 6. The detection results were analyzed using a time-of-flight mass spectrometry signal processing system (MALDI-MS) to draw conclusions.

[0169] Mass spectrometry detection results as follows Figure 11 As shown: In Comparative Example 1, eltA and SEQ 27-28 primers were added. Because of this extra pair of primers, the primers interfered with the detection in the multiplex system, hindering the detection of Salmonella Typhimurium. Consequently, the characteristic peak of Salmonella Typhimurium at 36703.8 m / z, corresponding to a molecular weight of 36703.8 Da, was not detected. Therefore, this primer combination could not identify Salmonella Typhimurium.

[0170] Therefore, it is clear that more primers are not necessarily better. Increasing the number of primers and their interactions can affect the detection of multiplex systems. This can cause some bacteria to fail to amplify peaks, interfering with the detection of pathogenic bacteria.

[0171] Comparative Example 2: Multiplex PCR detection of foodborne pathogens.

[0172] 1. Primer design

[0173] Eleven pairs of specific primers were designed for each foodborne pathogen's specific sequence. All primers were synthesized by Shanghai Jereh Biotechnology Co., Ltd.

[0174]

[0175]

[0176] serial number Primer (5'→3') SEQ ID No: 1 gGGTCCAGTTTATCGTTATTACCAAAGG SEQ ID No: 2 ACTATGGTAGCGGAATTTCTCACG SEQ ID No: 4 gCTACTTCTTATCTGGATTTAATGTCGCA SEQ ID No: 5 CAGCAGAAGCCTTACGCTTC SEQ ID No: 6 ACAAGTCCACAAGGAAAGTAAAGATG SEQ ID No: 8 gCGCCACTGATCATTAATCGCATC SEQ ID No: 9 GATGTTTTACTACCAGTCTGCGTC SEQ ID No: 10 GACTTCTTATTACCGTTCTATGATTCCG SEQ ID No: 11 TTTATTTGATGTGAATGGTGTGTTAGG SEQ ID No: 12 acgttggatgGGATGCTAAACCAGTAGAGTCTTCAA SEQ ID No: 13 TCACCGTGGTGACGCATG SEQ ID No: 14 tgCGGCCTTCAAATCGGCATC SEQ ID No: 15 gCAGCCAGAGCCGTGGATG SEQ ID No: 17 GTAAAGCTTCAGCTGTCACAGTAAC SEQ ID No: 18 CATCGTATACACAGGAGCAGTTTC SEQ ID No: 19 TCTGCGGTCCTAGTTAGAATTGAG SEQ ID No: 21 gACTTCCAGCGCTGAGGTG SEQ ID No: 22 gGACGTTGCGCTCATTACTTCTG SEQ ID No: 23 CCGTAAAGCGGGAGTCAATG SEQ ID No: 24 AGATACTCTATACCAGCCTATAATTTGTG SEQ ID No: 25 acgttggatgTACTATTCATGCTTTCAGGACCACTT SEQ ID No: 26 CCGCATCACGCAGTTCAAC

[0177] 2. PCR amplification:

[0178] (1) PCR reaction system: 0.5-10 μL of PCR primer mixture, 1-2 μL of PCR amplification enzyme, 5 μL of PCR reaction solution, 1-5 μL of DNA template, and the remainder is Nuclease-free water. The concentration of each primer pair should be controlled between 1-5 μM.

[0179] (2) Amplification reaction program: digest at 50℃ for 2 min, pre-denature at 95℃ for 2 min, denature at 95℃ for 30 s, anneal at 56℃ for 30 s, extend at 72℃ for 30 s, for 45 cycles, and finally extend at 72℃ for 5 min.

[0180] Alternatively, digest at 55°C for 5 minutes, pre-denature at 95°C for 30 seconds, denature at 95°C for 2 seconds, anneal / extend at 60°C for 15 seconds, and repeat for 45 cycles.

[0181] 3. Purification of multiplex PCR products:

[0182] (1) Remove the Genologue NGS CleanSelect magnetic beads from the refrigerator and let them stand at room temperature for 30 minutes, then vortex or invert the container to mix thoroughly. Note: The magnetic beads must be left at room temperature for 30 minutes after being removed from the refrigerator to avoid affecting the DNA recovery rate.

[0183] (2) Add 90 μL of magnetic bead reagent to 50 μL of reaction sample, and vortex or pipette up and down 10 times to mix thoroughly. Note: The magnetic bead reagent is quite viscous and must be thoroughly mixed. If the sample volume is less than 50 μL, it can be made up to 50 μL with EB or deionized water. If the volume exceeds 50 μL, the amount of magnetic beads can be increased proportionally.

[0184] (3) Place at room temperature for 2 to 5 minutes.

[0185] (4) Place the centrifuge tubes on the magnetic rack and let them stand for 2-5 minutes until the magnetic beads are completely adsorbed onto the centrifuge tube walls. Discard all the liquid.

[0186] (5) Slowly add 200 μL of 80% ethanol to the centrifuge tube while it is still on the magnetic rack. Let it stand at room temperature for 1 minute without stirring. Discard all the liquid. Note: 80% ethanol must be prepared before use.

[0187] (6) Repeat step (5) once.

[0188] (7) Leave the centrifuge tube on the magnetic rack and remove the residual liquid with a pipette. Open the cap and let it dry at room temperature for 5 minutes until the magnetic beads are basically dry.

[0189] Note: Do not over-dry, heat-dry, or dry for too long. Cracks on the surface of the magnetic beads will reduce DNA elution and recovery efficiency.

[0190] (8) Remove the centrifuge tube from the magnetic rack and add 20 μL (or other volume) of EB or nuclease-free deionized water. Vortex for 1 minute or resuspend the magnetic beads by pipetting up and down 10 times. Let stand at room temperature for 2–5 minutes.

[0191] (9) Place the centrifuge tube on the magnetic separator and let it stand for 2 to 5 minutes until the magnetic beads are completely adsorbed onto the centrifuge tube wall. Use a pipette to take out 18 μL of supernatant and transfer it into a new tube or well to obtain the purified product.

[0192] 4. Chip spotting: (1) Use tweezers to pick up a time-of-flight mass spectrometry microarray chip and place it gently on the target holder; (2) Spot the samples in sequence, taking 0.5-1.0 μL of each sample; (3) Air dry at room temperature (10-15 min) or use a heater to dry (5 min).

[0193] 5. Mass spectrometry detection: Peak signals were detected using a Clin-ToFⅡ (MALDI-TOF principle) mass spectrometer.

[0194] 6. The detection results were analyzed using a time-of-flight mass spectrometry signal processing system (MALDI-MS) to draw conclusions.

[0195] 7. The primer combination compared with Example 2 affected the nucleic acid mass spectrometry of enteroaggregative Escherichia coli and enteroinvasive Escherichia coli.

[0196] Mass spectrometry detection results as follows Figure 12-13 As shown: Figure 12 The characteristic peak of enteroaggregative Escherichia coli at 28974.95 m / z was not detected, corresponding to a molecular weight of 28974.95 Da. Figure 13The characteristic peak of 37938.15 m / z for invasive enteric Escherichia coli was not detected, corresponding to a molecular weight of 37938.15 Da. This primer combination could not identify either enteric aggregate Escherichia coli or enteric invasive Escherichia coli.

[0197] That is, in the case that the target and primer set are the same as those of the present invention, the control example 2 lacks the target fragment aggR and its corresponding primer pair for detecting enteroaggregative Escherichia coli, indicating that the PCR + mass spectrometry method cannot be used to detect this strain based on only one target uidA.

[0198] Similarly, without the target fragment ipaHR and its corresponding primer pair for detecting invasive entero Escherichia coli, PCR-mass spectrometry detection of this strain cannot be completed using only the other two targets lacY and uidA.

[0199] Therefore, as illustrated in Example 2, it is not always better to have fewer target genes and primers for the same pathogenic bacteria. Reducing the number of primers can also lead to the loss of characteristic peaks, making it impossible to detect the target bacteria. Therefore, it is necessary to select an appropriate number of target genes and primer pairs.

[0200] Comparative Example 3: Multiplex PCR detection of foodborne pathogens.

[0201] 1. Primer design

[0202] Nine pairs of specific primers were designed for each foodborne pathogen's specific sequence. All primers were synthesized by Shanghai Jereh Biotechnology Co., Ltd.

[0203]

[0204]

[0205]

[0206]

[0207] 2. PCR amplification:

[0208] (1) PCR reaction system: 0.5-10 μL of PCR primer mixture, 1-2 μL of PCR amplification enzyme, 5 μL of PCR reaction solution, 1-5 μL of DNA template, and the remainder is Nuclease-free water. The concentration of each primer pair should be controlled between 1-5 μM.

[0209] (2) Amplification reaction program: digest at 50℃ for 2 min, pre-denature at 95℃ for 2 min, denature at 95℃ for 30 s, anneal at 56℃ for 30 s, extend at 72℃ for 30 s, for 45 cycles, and finally extend at 72℃ for 5 min.

[0210] Alternatively, digest at 55°C for 5 minutes, pre-denature at 95°C for 30 seconds, denature at 95°C for 2 seconds, anneal / extend at 60°C for 15 seconds, and repeat for 45 cycles.

[0211] 3. Purification of multiplex PCR products:

[0212] (1) Remove the Genologue NGS CleanSelect magnetic beads from the refrigerator and let them stand at room temperature for 30 minutes, then vortex or invert the container to mix thoroughly. Note: The magnetic beads must be left at room temperature for 30 minutes after being removed from the refrigerator to avoid affecting the DNA recovery rate.

[0213] (2) Add 90 μL of magnetic bead reagent to 50 μL of reaction sample, and vortex or pipette up and down 10 times to mix thoroughly. Note: The magnetic bead reagent is quite viscous and must be thoroughly mixed. If the sample volume is less than 50 μL, it can be made up to 50 μL with EB or deionized water. If the volume exceeds 50 μL, the amount of magnetic beads can be increased proportionally.

[0214] (3) Place at room temperature for 2 to 5 minutes.

[0215] (4) Place the centrifuge tubes on the magnetic rack and let them stand for 2-5 minutes until the magnetic beads are completely adsorbed onto the centrifuge tube walls. Discard all the liquid.

[0216] (5) Slowly add 200 μL of 80% ethanol to the centrifuge tube while it is still on the magnetic rack. Let it stand at room temperature for 1 minute without stirring. Discard all the liquid. Note: 80% ethanol must be prepared before use.

[0217] (6) Repeat step (5) once.

[0218] (7) Leave the centrifuge tube on the magnetic rack and remove any remaining liquid with a pipette. Allow it to air dry at room temperature for 5 minutes until the magnetic beads are mostly dry. Note: Do not over-dry, heat-dry, or dry for too long. Cracks on the surface of the magnetic beads will reduce DNA elution and recovery efficiency.

[0219] (8) Remove the centrifuge tube from the magnetic rack and add 20 μL (or other volume) of EB or nuclease-free deionized water. Vortex for 1 minute or resuspend the magnetic beads by pipetting up and down 10 times. Let stand at room temperature for 2–5 minutes.

[0220] (9) Place the centrifuge tube on the magnetic separator and let it stand for 2 to 5 minutes until the magnetic beads are completely adsorbed onto the centrifuge tube wall. Use a pipette to take out 18 μL of supernatant and transfer it into a new tube or well to obtain the purified product.

[0221] 4. Chip spotting: (1) Use tweezers to pick up a time-of-flight mass spectrometry microarray chip and place it gently on the target holder; (2) Spot the samples in sequence, taking 0.5-1.0 μL of each sample; (3) Air dry at room temperature (10-15 min) or use a heater to dry (5 min).

[0222] 5. Mass spectrometry detection: Peak signals were detected using a Clin-ToFⅡ (MALDI-TOF principle) mass spectrometer.

[0223] 6. The detection results were analyzed using a time-of-flight mass spectrometry signal processing system (MALDI-MS) to draw conclusions.

[0224] 7. The primer combination used in Example 3 affected the nucleic acid mass spectrometry of enterohemorrhagic Escherichia coli, Shiga toxin-producing Escherichia coli, and enteropathogenic Escherichia coli. The mass spectrometry results are as follows: Figure 14-16 . Figure 14 The characteristic peaks of enterohemorrhagic Escherichia coli (34446.5 m / z, 35432.1 m / z, and 36354.9 m / z) were not detected, and their corresponding molecular weights were 34446.5 Da, 35432.1 Da, and 36354.9 Da. Figure 15 The characteristic peaks of Shiga toxin-producing Escherichia coli (34446.5 m / z, 35432.1 m / z, and 36354.9 m / z) were not detected, with corresponding molecular weights of 34446.5 Da, 35432.1 Da, and 36354.9 Da. Figure 16 The characteristic peak of enteropathogenic Escherichia coli at 23538.5 m / z was not detected, corresponding to a molecular weight of 23538.5 Da. This primer combination could not identify enterohemorrhagic Escherichia coli, Shiga toxin-producing Escherichia coli, or enteropathogenic Escherichia coli.

[0225] Comparative Example 3 further confirms Comparative Example 2: the number of target genes and their primers for the same pathogenic bacteria is not necessarily better the less there are. A reduction in the number of primers will also lead to the loss of characteristic peaks, thus making it impossible to detect the target bacteria. Therefore, it is necessary to select an appropriate number of target genes and their primer pairs.

[0226] Comparative Example 4: Multiplex PCR detection of foodborne pathogens.

[0227] 1. Primer design

[0228] Thirteen pairs of specific primers were designed for each foodborne pathogen based on its specific sequence. All primers were synthesized by Shanghai Jereh Biotechnology Co., Ltd.

[0229]

[0230]

[0231]

[0232] 2. PCR amplification:

[0233] (1) PCR reaction system: 0.5-10 μL of PCR primer mixture, 1-2 μL of PCR amplification enzyme, 5 μL of PCR reaction solution, 1-5 μL of DNA template, and the remainder is Nuclease-free water. The concentration of each primer pair should be controlled between 1-5 μM.

[0234] (2) Amplification reaction program: digest at 50℃ for 2 min, pre-denature at 95℃ for 2 min, denature at 95℃ for 30 s, anneal at 56℃ for 30 s, extend at 72℃ for 30 s, for 45 cycles, and finally extend at 72℃ for 5 min.

[0235] Alternatively, digest at 55°C for 5 minutes, pre-denature at 95°C for 30 seconds, denature at 95°C for 2 seconds, anneal / extend at 60°C for 15 seconds, and repeat for 45 cycles.

[0236] 3. Purification of multiplex PCR products:

[0237] (1) Remove the Genologue NGS CleanSelect magnetic beads from the refrigerator and let them stand at room temperature for 30 minutes, then vortex or invert the container to mix thoroughly. Note: The magnetic beads must be left at room temperature for 30 minutes after being removed from the refrigerator to avoid affecting the DNA recovery rate.

[0238] (2) Add 90 μL of magnetic bead reagent to 50 μL of reaction sample, and vortex or pipette up and down 10 times to mix thoroughly. Note: The magnetic bead reagent is quite viscous and must be thoroughly mixed. If the sample volume is less than 50 μL, it can be made up to 50 μL with EB or deionized water. If the volume exceeds 50 μL, the amount of magnetic beads can be increased proportionally.

[0239] (3) Place at room temperature for 2 to 5 minutes.

[0240] (4) Place the centrifuge tubes on the magnetic rack and let them stand for 2-5 minutes until the magnetic beads are completely adsorbed onto the centrifuge tube walls. Discard all the liquid.

[0241] (5) Slowly add 200 μL of 80% ethanol to the centrifuge tube while it is still on the magnetic rack. Let it stand at room temperature for 1 minute without stirring. Discard all the liquid. Note: 80% ethanol must be prepared before use.

[0242] (6) Repeat step (5) once.

[0243] (7) Leave the centrifuge tube on the magnetic rack and remove the residual liquid with a pipette. Open the cap and let it dry at room temperature for 5 minutes until the magnetic beads are basically dry.

[0244] Note: Do not over-dry, heat-dry, or dry for too long. Cracks on the surface of the magnetic beads will reduce DNA elution and recovery efficiency.

[0245] (8) Remove the centrifuge tube from the magnetic rack and add 20 μL (or other volume) of EB or nuclease-free deionized water. Vortex for 1 minute or resuspend the magnetic beads by pipetting up and down 10 times. Let stand at room temperature for 2–5 minutes.

[0246] (9) Place the centrifuge tube on the magnetic separator and let it stand for 2 to 5 minutes until the magnetic beads are completely adsorbed onto the centrifuge tube wall. Use a pipette to take out 18 μL of supernatant and transfer it into a new tube or well to obtain the purified product.

[0247] 4. Chip spotting: (1) Use tweezers to pick up a time-of-flight mass spectrometry microarray chip and place it gently on the target holder; (2) Spot the samples in sequence, taking 0.5-1.0 μL of each sample; (3) Air dry at room temperature (10-15 min) or use a heater to dry (5 min).

[0248] 5. Mass spectrometry detection: Peak signals were detected using a Clin-ToFⅡ (MALDI-TOF principle) mass spectrometer.

[0249] 6. The detection results were analyzed using a time-of-flight mass spectrometry signal processing system (MALDI-MS) to draw conclusions.

[0250] 7. The primer combination used in Example 4 affected the nucleic acid mass spectrometry of enterotoxigenic Escherichia coli. The mass spectrometry results are as follows: Figure 17 . Figure 17 The characteristic peak of enterotoxigenic Escherichia coli at 33024.7 m / z, corresponding to a molecular weight of 33024.7 Da, was not detected. This primer combination could not identify enterotoxigenic Escherichia coli.

[0251] Since only one primer pair in Comparative Example 4 is the same as that of the present invention, while the remaining 12 primer pairs are different, this illustrates that even when targeting the same gene and using the same number of primer pairs, continuous optimization and screening are necessary; otherwise, it will be impossible to detect the relevant pathogens in a multiplex reaction system.

[0252] Comparative Example 5: Multiplex PCR detection of foodborne pathogens.

[0253] 1. Primer design

[0254] Fourteen pairs of specific primers were designed for each foodborne pathogen's specific sequence. All primers were synthesized by Shanghai Jereh Biotechnology Co., Ltd.

[0255]

[0256]

[0257]

[0258]

[0259] 2. PCR amplification:

[0260] (1) PCR reaction system: 0.5-10 μL of PCR primer mixture, 1-2 μL of PCR amplification enzyme, 5 μL of PCR reaction solution, 1-5 μL of DNA template, and the remainder is Nuclease-free water. The concentration of each primer pair should be controlled between 1-5 μM.

[0261] (2) Amplification reaction program: digest at 50℃ for 2 min, pre-denature at 95℃ for 2 min, denature at 95℃ for 30 s, anneal at 56℃ for 30 s, extend at 72℃ for 30 s, for 45 cycles, and finally extend at 72℃ for 5 min.

[0262] Alternatively, digest at 55°C for 5 minutes, pre-denature at 95°C for 30 seconds, denature at 95°C for 2 seconds, anneal / extend at 60°C for 15 seconds, and repeat for 45 cycles.

[0263] 3. Purification of multiplex PCR products:

[0264] (1) Remove the Genologue NGS CleanSelect magnetic beads from the refrigerator and let them stand at room temperature for 30 minutes, then vortex or invert the container to mix thoroughly. Note: The magnetic beads must be left at room temperature for 30 minutes after being removed from the refrigerator to avoid affecting the DNA recovery rate.

[0265] (2) Add 90 μL of magnetic bead reagent to 50 μL of reaction sample, and vortex or pipette up and down 10 times to mix thoroughly. Note: The magnetic bead reagent is quite viscous and must be thoroughly mixed. If the sample volume is less than 50 μL, it can be made up to 50 μL with EB or deionized water. If the volume exceeds 50 μL, the amount of magnetic beads can be increased proportionally.

[0266] (3) Place at room temperature for 2 to 5 minutes.

[0267] (4) Place the centrifuge tubes on the magnetic rack and let them stand for 2-5 minutes until the magnetic beads are completely adsorbed onto the centrifuge tube walls. Discard all the liquid.

[0268] (5) Slowly add 200 μL of 80% ethanol to the centrifuge tube while it is still on the magnetic rack. Let it stand at room temperature for 1 minute without stirring. Discard all the liquid. Note: 80% ethanol must be prepared before use.

[0269] (6) Repeat step (5) once.

[0270] (7) Leave the centrifuge tube on the magnetic rack and remove any remaining liquid with a pipette. Allow it to air dry at room temperature for 5 minutes until the magnetic beads are mostly dry. Note: Do not over-dry, heat-dry, or dry for too long. Cracks on the surface of the magnetic beads will reduce DNA elution and recovery efficiency.

[0271] (8) Remove the centrifuge tube from the magnetic rack and add 20 μL (or other volume) of EB or nuclease-free deionized water. Vortex for 1 minute or resuspend the magnetic beads by pipetting up and down 10 times. Let stand at room temperature for 2–5 minutes.

[0272] (9) Place the centrifuge tube on the magnetic separator and let it stand for 2 to 5 minutes until the magnetic beads are completely adsorbed onto the centrifuge tube wall. Use a pipette to take out 18 μL of supernatant and transfer it into a new tube or well to obtain the purified product.

[0273] 4. Chip spotting: (1) Use tweezers to pick up a time-of-flight mass spectrometry microarray chip and place it gently on the target holder; (2) Spot the samples in sequence, taking 0.5-1.0 μL of each sample; (3) Air dry at room temperature (10-15 min) or use a heater to dry (5 min).

[0274] 5. Mass spectrometry detection: Peak signals were detected using a Clin-ToFⅡ (MALDI-TOF principle) mass spectrometer.

[0275] 6. The detection results were analyzed using a time-of-flight mass spectrometry signal processing system (MALDI-MS) to draw conclusions.

[0276] 7. The primer combination used in Example 5 affected the nucleic acid mass spectrometry of Listeria monocytogenes. The mass spectrometry results are as follows: Figure 18 . Figure 18 The characteristic peak of Listeria monocytogenes at 37652.6 m / z was not detected, corresponding to a molecular weight of 37652.6 Da. This primer combination could not identify Listeria monocytogenes.

[0277] Comparative Example 5 confirms that, as in Comparative Example 1, more primers are not necessarily better. Increasing the number of primers and their interactions can affect the detection in multiplex systems. This can lead to primers failing to amplify peaks for certain pathogens, thus affecting the detection results.

Claims

1. A method for detecting genes related to eight foodborne pathogens in food, comprising the following steps: (1) Multiplex PCR amplification: Using specific PCR primers, the DNA regions containing genes associated with 8 foodborne pathogens are simultaneously amplified in one reaction system to obtain PCR products containing DNA regions containing different genes. (2) PCR product purification: multiplex PCR products were purified using DNA purification reagents; (3) Spotting: The purified product and the matrix form a crystalline mixture, which is then spotted onto the chip; (4) MALDI-TOF MS detection; (5) Analyze the detection results using a mass spectrometry signal processing system; The sequences of the multiple primer sets are as follows:

2. The method according to claim 1, wherein step (1) multiplex PCR amplification step comprises: (i) PCR reaction system: 0.5-10 μL PCR primer mixture, 1-2 μL PCR amplification enzyme, 5 μL PCR reaction solution μl of DNA template, 1-5 μl of primer, and the remainder is nuclease-free water. The concentration of each primer pair should be controlled at 1-5 μM. between. (ii) Amplification reaction program: digest at 50℃ for 2 min, pre-denaturate at 95℃ for 2 min, denature at 95℃ for 30 s, and de-denature at 56℃. Digest at 72°C for 30 seconds, then extend at 72°C for 30 seconds, repeating this cycle 45 times, followed by a final extension at 72°C for 5 minutes; or digest at 55°C for 5 minutes. Pre-denaturation at 95℃ for 30 seconds, denaturation at 95℃ for 2 seconds, annealing / extending at 60℃ for 15 seconds, for 45 cycles.

3. The method according to claim 1, wherein step (2) PCR product purification step comprises: (i) Remove the Genologue NGS CleanSelect magnetic beads from the refrigerator and let them stand at room temperature for 30 minutes, then vortex or invert the container to mix thoroughly. Note: The magnetic beads must be left at room temperature for 30 minutes after being removed from the refrigerator to avoid affecting the DNA recovery rate. (ii) Add 90 μL of magnetic bead reagent to 50 μL of reaction sample, and mix thoroughly by vortexing or by pipetting up and down 10 times. (iii) Let it sit at room temperature for 2 to 5 minutes. (iv) Place the centrifuge tubes on the magnetic rack and let them stand for 2–5 minutes until the magnetic beads are completely adhered to the centrifuge tube walls. Discard all liquid. (v) With the centrifuge tube still on the magnetic rack, slowly add 200 μL of 80% ethanol and let stand at room temperature for 1 minute without stirring. Discard all liquid. Note: 80% ethanol must be prepared before use. (vi) Repeat step (5) once. (vii) Leave the centrifuge tube on the magnetic rack and remove any remaining liquid with a pipette. Let it dry at room temperature for 5 minutes until the magnetic beads are mostly dry. (viii) Remove the centrifuge tube from the magnetic rack and add 20 μL (or other volume) of EB or nuclease-free deionized water. Vortex for 1 minute or resuspend the magnetic beads by pipetting up and down 10 times. Let stand at room temperature for 2–5 minutes. (ix) Place the centrifuge tube on the magnetic separator and let it stand for 2–5 minutes until the magnetic beads are completely adsorbed onto the tube wall. Use a pipette to transfer 18 μL of the supernatant into a new tube or well to obtain the purified product.

4. The method according to claim 1, wherein step (3) the spotting step comprises: (i) Use tweezers to pick up a time-of-flight mass spectrometry microarray chip and gently place it on the target holder; the chip matrix contains formic acid, and the matrix composition is 3-HPA∶DHC∶formic acid=4∶2∶1; (ii) Spot the samples sequentially according to their order, taking 0.5-1.0 μL of each sample; (iii) Air dry at room temperature (10-15 min) or use a heater to dry (5 min).

5. The method according to claim 1, 2, 3 or 4, wherein the 5' end of the primer may be added as a linker sequence, the linker sequence being a combination of A, C, G, and T bases of different lengths arranged randomly.

6. The method according to claim 1, 2, 3 or 4, wherein a tag sequence may be added to the 5' end of the primers to make the size of the multiplex PCR products easily distinguishable by MALDI-TOF MS, wherein the tag sequence is ACGTTGGATG.

7. The method according to claim 5 or 6, wherein the DNA purification reagent used for PCR product purification in step (2) comprises: One of the following: adsorption column, magnetic beads, and resin.

8. The method according to claim 7, wherein in step (4) MALDI-TOF MS detection step, the peak signal is detected using a Clin-ToFⅡ time-of-flight mass spectrometry system.

Images