Composite adjuvant composition and application

Abstract

The invention discloses a composite adjuvant composition and application, and belongs to the technical field of vaccines. The composite adjuvant composition comprises the neutral liposome, the CpG adjuvant and the QS-21, and through the synergistic effect of all the components, the defects that a traditional adjuvant is single in immune response, insufficient in antigen presentation efficiency and the like are effectively overcome. When being applied to a vaccine containing the norovirus-like particles, the norovirus-like particles can efficiently induce humoral immunity (IgG and subtype) and cellular immunity (memory T cells) at the same time, reduce the frequency of boosting immunity, are good in safety, and provide an efficient technical scheme for research and development of antiviral vaccines.

Description

Technical Field

[0001] This application belongs to the field of vaccine technology, specifically relating to a compound adjuvant composition and its application. Background Technology

[0002] In the global vaccine development field, adjuvants play a crucial role in enhancing vaccine efficacy. Currently, traditional adjuvants (such as aluminum salt adjuvants) are the most widely used in the vaccine field and have undergone long-term practical application. However, these traditional adjuvants have significant limitations: firstly, they induce a single type of immune response, mainly humoral immunity, with insufficient activation of cellular immunity; secondly, they cause significant local adverse reactions; and thirdly, they are difficult to stimulate effective T-cell-mediated immunity. Taking the hepatitis B vaccine as an example, this vaccine using traditional aluminum adjuvants requires three doses, and even then, 5%-10% of the population still cannot develop sufficient protective antibodies. This phenomenon highlights the significant inadequacy of existing adjuvants in addressing diseases requiring a strong cellular immune response.

[0003] With the continuous deepening of immunological research and the increasing demand for the development of new vaccines, developing new adjuvants that are more efficient, safer, and capable of simultaneously stimulating a comprehensive immune response (including potent humoral and cellular immunity) has become a critical issue that urgently needs to be addressed. Summary of the Invention

[0004] The purpose of this application is to provide a composite adjuvant composition and its application, wherein the composite adjuvant composition has a significant immune-enhancing effect on vaccines that require simultaneous induction of humoral and cellular immunity to produce effective immune protection, and can comprehensively improve the breadth and intensity of the immune response.

[0005] To achieve the above objectives, this application provides a composite adjuvant composition comprising neutral liposomes, CpG adjuvant, and QS-21.

[0006] Furthermore, the CpG adjuvant includes at least one of CPG-KHS1, CPG-KHS2, CPG-KHS3, CPG-KHS4, CPG-KHS5, and CPG-KHS6.

[0007] Furthermore, the neutral liposomes include dioleoyl lecithin and cholesterol, and the neutral liposomes are nanovesicles composed of a phospholipid bilayer, with a particle size of 100 nm to 200 nm.

[0008] Furthermore, the neutral liposomes are prepared by the following method: Weigh out dioleoyl lecithin and cholesterol, add anhydrous ethanol and melt in a water bath to obtain a mixed solution; The mixed solution was used to prepare crude liposomes using microfluidic technology; The crude liposomes were subjected to dilution, concentration, and filtration sterilization processes in sequence to obtain the neutral liposomes.

[0009] Furthermore, the ratio of dioleoyl lecithin, cholesterol, and anhydrous ethanol is (50mg~100mg):(50mg~100mg):(5mL~15mL), and the water bath melting temperature is 50℃~85℃.

[0010] Furthermore, the step of sequentially diluting, concentrating, and filtration-sterilizing the crude liposomes includes the following steps: The crude liposomes were diluted 10-fold with PBS buffer containing 0.05 wt% Tween 80 to obtain a diluted solution; The diluted solution was added to a 100 kDa ultrafiltration tube and concentrated and filtered at 2000 g / 10 min until the volume of the remaining liquid was the same as the volume of the crude liposomes. The concentrated liquid was filtered through a 0.22 μm filter membrane to remove bacteria, thus obtaining the neutral liposomes.

[0011] Furthermore, the neutral liposomes are in the form of 10 μL / dose to 50 μL / dose, the CpG adjuvant is in the form of 5 μg / dose to 100 μg / dose, and the QS-21 is in the form of 5 μg / dose to 100 μg / dose.

[0012] This application also provides the use of a compound adjuvant composition in vaccine preparation.

[0013] Furthermore, the vaccine also includes antigen norovirus-like particles and PBS buffer solution, wherein the subtypes of the antigen norovirus-like particles include VLP GII.3 and VLP GII.6 in a mass ratio of 1~5:1~5.

[0014] Furthermore, the vaccine comprises the following components: the neutral liposomes at a concentration of 10 μL / dose to 50 μL / dose, the CpG adjuvant at a concentration of 5 μg / dose to 100 μg / dose, the QS-21 at a concentration of 5 μg / dose to 100 μg / dose, the antigen norovirus-like particles at a concentration of 0.5 μg / dose to 50 μg / dose, and the PBS buffer solution at a concentration of 50 μL / dose to 100 μL / dose; wherein the concentration of the PBS buffer solution is 0.1 M.

[0015] In summary, this application has the following advantages: This application provides a composite adjuvant composition whose components are selected based on the unique immunological mechanisms of action and synergistic potential of each component, specifically including neutral liposomes (LNP-A), CpG oligodeoxynucleotide adjuvant (CpG ODN, CpGoligodeoxynucleotide) and saponin QS-21. Neutral liposomes, composed of phospholipid bilayer nanovesicles, passively accumulate in lymph nodes due to their 100nm-200nm size, significantly enhancing the uptake efficiency of antigen-presenting cells (APCs). CpG adjuvant, a specific agonist of Toll-like receptor 9 (TLR9), targets the intracellular endosome region of dendritic cells (DCs) and B cells, activating the MyD88-dependent signaling pathway to induce the secretion of type I interferon and pro-inflammatory cytokines, thereby initiating an innate immune response. QS-21, through synergistic regulation of Th1 / Th2 immune balance, combined with CpG adjuvant, achieves simultaneous enhancement of IgG1 (Th2 antibody) and IgG2a (Th1 antibody) titers, thus comprehensively strengthening the adaptive immune response. These three components, through their respective well-defined targets and pathways, form a synergistic effect, constituting a highly efficient composite adjuvant system. Attached Figure Description

[0016] Figure 1 This is a schematic diagram showing the IgG levels of each experimental group coated with the GⅡ.3 antigen involved in the embodiments of this application; Figure 2 This is a schematic diagram showing the IgG1 levels of each experimental group coated with the GⅡ.3 antigen involved in the embodiments of this application; Figure 3 This is a schematic diagram showing the IgG2a levels of each experimental group coated with the GⅡ.3 antigen involved in the embodiments of this application; Figure 4 This is a schematic diagram showing the IgG levels of each experimental group coated with the GⅡ.6 antigen involved in the embodiments of this application; Figure 5 This is a schematic diagram showing the IgG1 levels of each experimental group coated with the GⅡ.6 antigen involved in the embodiments of this application; Figure 6 This is a schematic diagram showing the IgG2a levels of each experimental group coated with the GⅡ.6 antigen involved in the embodiments of this application; Figure 7 This is a schematic diagram of the IFN-γ detection results of each experimental group involved in the embodiments of this application; Figure 8 This is a schematic diagram of the TNF-α detection results for each experimental group involved in the embodiments of this application; Figure 9 This is a schematic diagram of the IL-2 detection results for each experimental group involved in the embodiments of this application; Figure 10 This is a schematic diagram of the IL-4 detection results for each experimental group involved in the embodiments of this application; Figure 11 This is a schematic diagram showing the serum blocking antibody titer levels of each experimental group involved in the embodiments of this application under the coating of GⅡ.3 antigen; Figure 12 This is a schematic diagram showing the serum blocking antibody titer levels of each experimental group involved in the embodiments of this application under the coating of GⅡ.6 antigen. Detailed Implementation

[0017] The principles and features of this application are described below with reference to embodiments. The examples are for illustrative purposes only and are not intended to limit the scope of this application. Unless otherwise specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0018] An adjuvant is a non-specific immunostimulant added to a vaccine to enhance its immunogenicity and induce a stronger immune response by providing inflammatory signals, regulating antigen delivery to immune cells, or both. Its mechanism of action is to enhance the adaptive immune response to the vaccine by activating innate immune cells. The core mechanism involves adjuvants activating antigen-presenting cells (APCs) to promote the generation of antigen-presenting and co-stimulatory signals. Given that the immune response induced by a single adjuvant may be weak and biased towards a particular type, thus failing to meet the needs, compound adjuvants have emerged. Compound adjuvants, by integrating adjuvant components with different mechanisms of action (such as immunostimulants and delivery systems), can achieve synergistic effects and are considered an important direction for overcoming the limitations of existing adjuvants. Their advantages mainly lie in: synergistically enhancing antigen presentation, activating multiple immune cell pathways, and finely regulating the cytokine secretion profile, thereby significantly improving the strength, breadth, and duration of the immune response while reducing the risk of adverse reactions that may arise from single components. Based on this, this application studies and prepares a novel composite adjuvant, and explores its application in the fields of preventive and therapeutic vaccines. It has important theoretical value and practical significance for overcoming the shortcomings of existing adjuvants, promoting innovation in biomedical technology, and effectively responding to major public health challenges.

[0019] The CpG adjuvant in this application refers to CpG oligonucleotides, a type of synthetic nucleic acid drug with immunomodulatory function. It belongs to the TLR9 receptor agonist class of immunoadjuvants and is mainly used in anti-infection and adjuvant tumor therapy. It stimulates the mammalian immune system by activating the TLR9 signaling pathway. The neutral liposomes in this application are vesicle structures composed of lipid molecules. Their lipid bilayer forms a hydrophobic outer shell and an internal aqueous cavity, exhibiting both hydrophilic and hydrophobic properties. Lipid nanoparticles (LNPs) are a type of nanoparticle formed using lipids. QS-21 in this application is a saponin compound extracted from the soap tree (Quillaja saponaria), also known as soap tree saponin, with the English name QS-21ADJUVANT and CAS number 141256-04-4. Its molecular formula is C 92 H 148 O 46 With a molecular weight of 1990.14, QS-21 needs to be stored in a sealed container at 4°C, protected from light. QS-21 is primarily used in pharmacological research, biochemical detection, and vaccine adjuvant development. QS-21 stimulates the immune system, including cellular (T cell-mediated) and humoral (antibody-mediated) immunity. When QS-21 is added to a vaccine, it promotes more effective antigen presentation to immune system cells, such as dendritic cells. Dendritic cells can take up and process antigens and present them to T cells, thereby initiating an immune response. After QS-21-mediated disruption of the endosome membrane, the cleaved protein antigens can be further processed into smaller peptides in the cytoplasm by the proteasome mechanism. These smaller peptides can be more effectively recognized by T cells, thereby activating the T cell immune response. Simultaneously, it binds to the dendritic cell non-polymorphic MHC1 class antigen-presenting molecule CD1d, bringing them closer to the iTCR of iNKT cells, leading to iNKT cell activation and further enhancing the immune response. In terms of B cell immune responses, in order to achieve T cell-dependent B cell responses, carbohydrate-based epitopes are coupled to immune carrier proteins. Activated TH cells provide co-stimulatory signals to B lymphocytes through CD40L / CD40 co-receptor interactions, ultimately leading to the production of high-affinity, isotype-switching IgG antibodies and memory effects.

[0020] Specifically, in a first aspect, this application provides a composite adjuvant composition comprising neutral liposomes, CpG adjuvant, and QS-21. This application selects neutral liposomes, CpG adjuvant, and QS-21 to construct a specific composite adjuvant composition. Through the synergistic effect of each component, it effectively overcomes the shortcomings of traditional adjuvants, such as a single immune response and insufficient antigen presentation efficiency, and has the following significant beneficial effects: 1) Improved antigen presentation efficiency: Neutral liposomes, due to their size effect, can passively accumulate in lymph nodes, significantly enhancing the uptake efficiency of antigen-presenting cells (APCs), solving the problem of insufficient immune initiation caused by the limited delivery capacity of traditional adjuvants. 2) Activating a comprehensive immune response: CpG adjuvant, as a specific agonist of Toll-like receptor 9 (TLR9), targets the intracellular endosome region of dendritic cells (DCs) and B cells, inducing the secretion of type I interferon and pro-inflammatory cytokines by activating the MyD88-dependent signaling pathway, effectively enhancing cellular immunity. Simultaneously, QS-21 can synergistically regulate the Th1 / Th2 balance, achieving a simultaneous increase in IgG1 (Th2 antibody) and IgG2a (Th1 antibody) titers when used in combination with CpG, overcoming the limitation of traditional adjuvants in simultaneously inducing humoral and cellular immunity. 3) Achieving synergistic effects: The three components form a highly efficient synergy through their respective well-defined targets and pathways, enhancing both the strength and breadth of the immune response, and reducing the dosage of any single component through multi-mechanism synergy. This improves the immunization effect while reducing the risk of potential adverse reactions, ensuring the high efficacy and safety of the vaccine.

[0021] As some optional embodiments of this application, the CpG adjuvant includes at least one of CPG-KHS1, CPG-KHS2, CPG-KHS3, CPG-KHS4, CPG-KHS5, and CPG-KHS6. The CpG adjuvant in this application has a good stimulating effect on both murine and human lymphocytes, can enhance the immune response to norovirus-like particles (VLPs), achieve a relatively balanced Th1 / Th2 cell response level, promote the secretion of specific antibody IgG2a, increase the titer of specific blocking antibodies in serum, and significantly enhance the level of specific T cell responses.

[0022] In a specific implementation, the sequence of CPG-KHS1 is: TCGGTCGTTCGGTCGTTCGTT; The sequence of CPG-KHS2 is: TATGTCGTTACGTTGTCGTTGGGGG; The sequence of CPG-KHS3 is: TCGTCGTTGTCGTTCGGGGG; The sequence of CPG-KHS4 is: TTGTCGTTGTCGTTCGTTGGGGG; The sequence of CPG-KHS5 is: TCGTTGTCGTTGTCGAACGTT; The sequence of CPG-KHS6 is: TGTCGTTCGAACGTTCGACGTT.

[0023] As some optional embodiments of this application, the neutral liposomes comprise dioleoyl lecithin and cholesterol. The neutral liposomes are nanovesicles composed of a phospholipid bilayer, with a particle size of 100 nm to 200 nm. Dioleoyl lecithin, as the main phospholipid component, provides the basic framework for the bilayer structure of the liposomes. The addition of cholesterol can regulate the arrangement density of phospholipid molecules, enhance the stability of the bilayer, and reduce antigen leakage caused by structural damage during storage or in vivo, ensuring the integrity of the liposomes as a delivery carrier and laying the foundation for efficient subsequent function. The particle size range of 100 nm to 200 nm is an optimized size; nanovesicles of this size can passively accumulate in lymph nodes due to the size effect. Lymph nodes are key sites for immune cell aggregation, and the accumulation of liposomes here can significantly increase the probability of contact with antigen-presenting cells (APCs). Meanwhile, neutral liposomes composed of dioleoyl lecithin and cholesterol have good biocompatibility, which can reduce adverse stimulation to immune cells, further promote the recognition and uptake of antigens by APCs, significantly improve antigen presentation efficiency, effectively solve the problems of limited delivery capacity and insufficient immune initiation of traditional adjuvants, and work synergistically with other components in compound adjuvants to enhance the overall immune effect.

[0024] As some optional embodiments of this application, the neutral liposomes are prepared by the following method: (1) Weigh dioleoyl lecithin and cholesterol, add anhydrous ethanol and melt in a water bath to obtain a mixed solution; (2) The mixed solution was prepared into crude liposomes using microfluidic technology; (3) The crude liposomes are subjected to dilution, concentration and filtration sterilization in sequence to obtain the neutral liposomes. Specifically: 1) The crude liposomes are diluted 10 times with PBS buffer containing 0.05wt% Tween 80 to obtain a diluted solution; 2) The diluted solution is added to a 100 kDa ultrafiltration tube and concentrated and filtered at 2000 g / 10 min until the volume of the remaining liquid is the same as the volume of the crude liposomes; 3) The concentrated liquid is filtered and sterilized through a 0.22 μm filter membrane to obtain the neutral liposomes.

[0025] In the above scheme, after weighing dioleoyl lecithin and cholesterol in step (1), a mixed solution is prepared by melting in anhydrous ethanol in a water bath. This ensures that the two components are fully dissolved and uniformly mixed, laying the foundation for the subsequent formation of a structurally stable phospholipid bilayer. Step (2) uses microfluidic technology to prepare crude liposomes. This technology can precisely control fluid parameters to enable the orderly assembly of lipid molecules, which is conducive to the formation of nanovesicles with uniform particle size distribution. It avoids the problem of excessive particle size difference that is easy to occur in traditional preparation methods, and provides a reliable guarantee for obtaining liposomes with target particle size in the range of 100nm~200nm. In terms of purification and sterilization, the series of treatments in step (3) further improves the purity and safety of liposomes. The crude liposomes were diluted 10-fold with PBS buffer containing 0.05% Tween 80 to adjust the osmotic pressure of the system. Tween 80, as a mild surfactant, also helped maintain the stability of the liposomes. The liposomes were concentrated and filtered by centrifugation at 2000g / 10min using a 100kDa ultrafiltration tube, which effectively removed unassembled free lipid molecules and small molecule impurities. The concentration was also made to the same volume as the crude liposomes, which facilitated the control of the final liposome concentration. Finally, the liposomes were filtered through a 0.22μm filter membrane for sterilization, which completely removed any microorganisms that may have been introduced during the preparation process and ensured the biosafety of the liposomes in subsequent applications.

[0026] As some optional embodiments of this application, the ratio of dioleoyl lecithin, cholesterol and anhydrous ethanol is (50mg~100mg):(50mg~100mg):(5mL~15mL), and the water bath melting temperature is 50℃~85℃.

[0027] As some optional embodiments of this application, the neutral liposomes are 10 μL / dose to 50 μL / dose, the CpG adjuvant is 5 μg / dose to 100 μg / dose, and the QS-21 is 5 μg / dose to 100 μg / dose.

[0028] Secondly, based on a general inventive concept, this application also provides the application of a compound adjuvant composition in vaccine preparation.

[0029] As some optional embodiments of this application, the vaccine further includes norovirus-like particles (VLPs) and PBS buffer solution. The subtypes of the norovirus-like particles include VLP GII.3 and VLPGII.6 in a mass ratio of 1-5:1-5, preferably 1:1. In this application, norovirus-like particles (VLPs) are selected as the antigen. These particles do not contain viral nucleic acid and retain only the natural spatial structure of the viral capsid protein, thus avoiding the risk of viral infectivity while efficiently mimicking viral epitopes to elicit a specific immune response, achieving both safety and immunogenicity. Further selection of VLP GII.3 and VLP GII.6 subtypes and setting a specific mass ratio improves the immune protection coverage of the multivalent vaccine, addressing the problem of limited protection range of a single subtype antigen.

[0030] As some optional embodiments of this application, the vaccine comprises the following components: neutral liposomes at 10 μL / dose to 50 μL / dose, CpG adjuvant at 5 μg / dose to 100 μg / dose, QS-21 at 5 μg / dose to 100 μg / dose, antigen norovirus-like particles at 0.5 μg / dose to 50 μg / dose, and PBS buffer solution at 50 μL / dose to 100 μL / dose; wherein the concentration of the PBS buffer solution is 0.1 M. In this application, neutral liposomes deliver norovirus VLP and adjuvant to lymph nodes through targeted delivery, thereby enhancing the uptake efficiency of antigen-presenting cells (APCs); CpG adjuvant activates cellular immune pathways, inducing the secretion of type I interferon and pro-inflammatory factors; QS-21 synergistically regulates the Th1 / Th2 balance, promoting the simultaneous increase of IgG1 (humoral immunity) and IgG2a (cellular immunity) antibodies. These three components work synergistically with norovirus VLP to simultaneously enhance specific neutralizing antibody titers and memory T cell responses, addressing the issues of insufficient immune response and short protection period associated with traditional vaccines against norovirus. The introduction of PBS buffer solution precisely maintains the physiological osmotic pressure and pH stability of the vaccine system, preventing problems such as VLP structure damage and adjuvant aggregation caused by environmental fluctuations, ensuring the stability of vaccine component activity during storage and use. Its concentration setting matches the physiological environment, reducing local irritation after vaccination and further improving the clinical applicability of the vaccine.

[0031] In summary, given the limitations of traditional adjuvants, such as their limited range of immune response types (difficulty in simultaneously inducing humoral and cellular immunity), the need for multiple vaccinations, and poor responses in some populations, the composite adjuvant provided in this application precisely addresses these shortcomings. It not only exhibits significant immune-enhancing effects on vaccines requiring the simultaneous induction of both humoral and cellular immunity to generate effective immune protection, comprehensively improving the breadth and intensity of the immune response; furthermore, the long-lasting antibody maintenance capacity and persistent presence of memory T cells possessed by this composite adjuvant are expected to reduce the frequency of booster immunizations, thereby resolving the vaccination burden caused by the insufficient duration of immunity with traditional adjuvants. Therefore, the composite adjuvant composition of this application demonstrates significant potential value in clinical vaccine applications.

[0032] The technical solutions described above in this application will be explained in detail below with reference to specific embodiments.

[0033] Example 1 This embodiment discloses a method for preparing neutral liposomes LNP-A, including the following steps: (1) Preparation of oil phase: Weigh 100 mg of dioleoyl lecithin (DOPC) and 100 mg of cholesterol (CHO-HP) into a 15 mL centrifuge tube, then add 15 mL of anhydrous ethanol and melt in a water bath at 65 °C. After the sample has melted completely, remove the centrifuge tube and place it at room temperature for later use.

[0034] (2) Then, LNP-A was prepared using a nanoparticle preparation system: Install the chip box and syringe: Insert the chip box into the chip slot, flip the entire chip box fixing device, select the syringe adapter that matches the syringe, insert it into the syringe port, rotate it to the magnetic position to fix it, use the syringe to draw the corresponding volume of material according to the software prompts, insert the syringe into the chip, then flip the entire chip box fixing device back to the starting position, and you will hear a click to complete the process. Then hang the waste liquid tube and collection tube to complete the equipment operation preparation.

[0035] (3) Double-click the software icon to open the login page and log in to your account. According to the experimental requirements, select the syringe specifications, total volume of the sample to be prepared, flow rate ratio, total flow rate, automatic switching of waste liquid, and the amount of initial and final waste liquid. Finally, click "Start" to confirm the parameters again. After clicking "Confirm", the machine will start running and complete the preparation of liposomes.

[0036] (4) Finally, select the cleaning mode, use a disposable syringe, use pure water for the aqueous phase and anhydrous ethanol for the oil phase to clean the chip and the pipeline. After cleaning twice, the liquid in the disposable syringe needs to be drained and a final cleaning is performed to drain the liquid from the chip. Only then is the chip cleaning complete.

[0037] (5) Remove the chip for storage, close the program and end the experiment.

[0038] (6) The prepared LNP-A was diluted 10 times with phosphate buffer (PBS, concentration 0.1M) containing 0.05wt% Tween 80.

[0039] (7) Add the diluted liquid to a 100 kDa ultrafiltration tube and concentrate and filter it under centrifugation at 2000 g / 10 min until the remaining liquid volume is consistent with the initial preparation volume.

[0040] (8) Transfer the concentrated liquid to an EP tube, then filter it with a 0.22μm filter membrane for sterilization, and finally seal it with a sealing film and store it in a refrigerator at 4℃ for later use.

[0041] Experimental Example 1. Experimental Preparation (1) Laboratory animals Healthy BALB / c mice ( Mus musculus 32 females, aged 6 to 8 weeks, weighing 18.0g ± 2.0g.

[0042] (2) Experimental reagents RPMI 1640 culture medium, from Shanghai Yisheng Biotechnology Co., Ltd., catalog number 41402ES76; Fetal bovine serum, from Gibco, catalog number A5669801; Penicillin-streptomycin bispecific antibody, from Gibco, catalog number 15140-122; Red blood cell lysis buffer, from Shanghai Yisheng Biotechnology Co., Ltd., catalog number 40401ES76; Sterile phosphate-buffered saline (PBS), from Wuhan PONOS Biotechnology Co., Ltd., catalog number PB180327; Trypan blue solution, from Beijing Solarbio Technology Co., Ltd., product number C0040; Norovirus-like particles (VLP) GⅡ.3 and VLP GⅡ.6 were obtained from the Norovirus Project Team of Chengdu Kanghua Biological Products Co., Ltd., batch number 202401. Aluminum hydroxide adjuvant, from CRODA, catalog number Vac-alu-250; Mouse cytokine IL-2 ELISA detection kit, from Shenzhen Dakwei Biotechnology Co., Ltd., catalog number 1210202; Mouse cytokine IFN-γ ELISA kit, from Shenzhen Dakwei Biotechnology Co., Ltd., catalog number 121002; Mouse cytokine IL-4 ELISA detection kit, from Shenzhen Dakwei Biotechnology Co., Ltd., catalog number 1210402; Mouse cytokine TNF-α ELISA detection kit, from Shenzhen Dakwei Biotechnology Co., Ltd., catalog number 1217202; HRP-labeled goat anti-mouse IgG, from Abcam, catalog number Ab6789; HRP-labeled goat anti-mouse IgG1, from Abcam, catalog number Ab97240; HRP-labeled goat anti-mouse IgG2a, from Abcam, catalog number Ab9245; The ELISA plate is from Corning Incorporated, catalog number 9018. TMB developer, from Seracare, product number 5120-0074; QS-21, from Aivito (Shanghai) Pharmaceutical Technology Co., Ltd., item number: B01001; Cholesterol (CHO-HP), from Aivito (Shanghai) Pharmaceutical Technology Co., Ltd., product number: C40110; Dioleoyl lecithin (DOPC), from Aivito (Shanghai) Pharmaceutical Technology Co., Ltd., product number: C40462; CpG2006, from Coley Pharmaceuticals, has the following gene sequence: TCGTCGTTTTGTCGTTTTGTCGTT.

[0043] (3) Experimental grouping In this experiment, 32 mice were randomly divided into 4 groups of 8 mice each, with the PBS group serving as the control group. The injection volume was 0.1 mL / mouse, with 50 μL injected intramuscularly into each of the left and right hind legs. Grouping and experimental details are shown in Table 1.

[0044] Table 1. Animal Experiment Grouping and Immunization Status

[0045] (4) Immunization with vaccines The immunization route was intramuscular injection in the hind leg. Each group was immunized twice: the first time as a basic immunization and the second time as a booster immunization, 14 days apart. The control group received the same volume of phosphate-buffered saline (PBS) for each immunization. The dosage of each component in each experimental group was as follows: 0.5 μg / mouse to 50 μg / mouse for each antigen (VLP GⅡ.3 / VLP GⅡ.6), 5 μg / mouse to 100 μg / mouse for CpG, 50 μg / mouse to 500 μg / mouse for aluminum adjuvant, 5 μg / mouse to 100 μg / mouse for QS-21, 10 μL / mouse to 50 μL / mouse for LNP-A, and 50 μL / mouse to 100 μL / mouse for 0.1M PBS buffer.

[0046] The preparation methods for each group of vaccines are shown in Table 2 below.

[0047] Table 2. Vaccine preparation methods for each group in animal experiments

[0048] Note: Each immunization dose is prepared for 10 mice, with VLP GⅡ.3 concentration of 1233.7 μg / mL, VLP GⅡ.6 concentration of 937.85 μg / mL, Al(OH)3 concentration of 10 mg / mL, QS-21 concentration of 1 mg / mL, and CpG (including CpG-2006 and the CpG series of this application) concentration of 1 mg / mL. All vaccines in this application are prepared under sterile conditions and used immediately after preparation.

[0049] 2. Mouse blood collection and antibody / cytokine detection experiments (1) Blood collection from mice: After immunization, observe and record the living conditions of mice in each group. Mainly observe whether the mice have sudden death, ruffled fur, rapid weight loss, or reduced activity. If so, record it in time.

[0050] Orbital blood was collected from each mouse on days 21, 28, 35, 56, and 120 after the initial immunization. Blood was collected in 1.5 mL EP tubes, with a minimum volume of 150 µL per mouse per collection. The collected blood was incubated overnight at 4°C. The next day, it was centrifuged at 5000 rpm for 15 min in a refrigerated centrifuge. The supernatant was collected and stored at -20°C for subsequent analysis of relevant parameters.

[0051] (2) Mouse serum antibody detection: (2.1) Coating. Dilute the antigen VLP with PBS to 1 μg / mL, add 100 μL / well to the microplate, and coat overnight at 4°C.

[0052] (2.2) Washing the plate. On the second day, take out the coated microplate and wash it three times with PBS solution containing 0.05wt% Tween-20, 300μL per well, for 1 min each time. After the last wash, discard the washing solution and pat the liquid in the wells dry on paper.

[0053] (2.3) Blocking. Add 300 μL of PBS blocking buffer containing 5 wt% skim milk powder to each well and seal at 37°C for 2 h.

[0054] (2.4) Washing the plate. Discard the blocking solution and wash the plate 3 times with washing solution, 300 μL per well, 1 min each time. After the last wash, discard the washing solution and pat the liquid in the wells dry on paper.

[0055] (2.5) Sample addition. Mouse serum was diluted 1:10000 and added to the microplate at 100 μL / well. The plate was sealed with a sealing film and incubated at 37°C for 2 h.

[0056] (2.6) Washing the plate. Discard the sample in the plate, wash the plate 3 times with washing solution, 300 μL per well, 1 min each time. After the last wash, discard the washing solution and pat the liquid in the wells dry on paper.

[0057] (2.7) Add secondary antibody. Add the corresponding HRP-labeled (1:10000 dilution) IgG, IgG1 or IgG2a, cover with sealing film, and incubate at 37°C for 1 h.

[0058] (2.8) Washing the plate. Discard the sample in the plate, wash the plate 6 times with washing solution, 300 μL per well, 1 min each time. After the last wash, discard the washing solution and pat the liquid in the wells dry on paper.

[0059] (2.9) Color development. Add TMB color development solution, 100 μL / well, and develop for 10 min.

[0060] (2.10) Termination of reading. Add 2M sulfuric acid to terminate the reaction, and then use an enzyme-linked immunosorbent assay (ELISA) reader to read the absorbance value at a wavelength of 450nm and process the data.

[0061] 3. Mouse spleen lymphocyte stimulation experiment (1) On day 28 and day 120 after the first immunization, the spleens of 3 mice in each group were taken. The mice were euthanized by dislocation of the neck and disinfected by immersion in alcohol. The spleens were separated under sterile conditions. The spleens were thoroughly ground and broken by a combination of syringe plunger and cell sieve (40μm pore size). 10mL of sterile PBS was added to rinse the spleens and the lymphocytes were rinsed into the bottom 50mL centrifuge tube. (2) The lymphocytes were centrifuged to the bottom using a low-temperature centrifuge at a speed of 2000 rpm for 5 min; (3) Discard the supernatant PBS, add 10 mL of red blood cell lysis buffer, gently shake and mix for 1 min to completely lyse the red blood cells, and centrifuge again with the same centrifugation parameters as before. (4) Discard the red blood cell lysis buffer, add PBS and gently pipette the bottom cells to resuspend them. Wash the lymphocytes once, centrifuge and discard the PBS. (5) Finally, add 10 mL of 1640 medium containing 10 wt% fetal bovine serum and 1 wt% penicillin antibiotics to resuspend the cells. After cell sampling and counting, adjust the cell concentration to 5 × 10⁻⁶. 6 Cells / mL ~6×10 6 cells / mL; (6) Lymphocytes were seeded at 100 μL / well in a 96-well plate, with 3 replicates per group; (7) Cells in each group were restimulated with antigen VLP at a concentration of 10 μg / mL. After culturing lymphocytes in a 37°C incubator for 4 days, the supernatant was collected and centrifuged at 2000 rpm for 5 min. Cell debris was discarded, and the supernatant was used for cytokine detection. The steps were briefly described in the instructions of the Shenzhen Dakwei Company Cytokine ELISA Kit as follows: a. Prepare standards with concentrations of 0 pg / mL, 7.8 pg / mL, 15.6 pg / mL, 31.3 pg / mL, 62.5 pg / mL, 125 pg / mL, 250 pg / mL and 500 pg / mL using sample dilution buffer. Add 100 μL of sample and standard to each well, then add 50 μL of biotin-labeled antibody to each well. Cover with sealing film and incubate at 37°C for 90 min. b. Washing the plate. Remove the liquid from the wells, add 300 μL of washing buffer per well, remove the washing buffer and blot dry on filter paper. Repeat washing 4 times. c. Add enzyme. Add 100 μL of HRP-labeled streptavidin-HRP to each well, cover with a sealing film, and incubate at 37°C for 30 min. d. Wash the plate. Repeat step 2, washing 4 times. e. Color development. Add 100 μL of TMB color development solution to each well and develop the color at 37℃ for 5 min to 30 min. Based on the color, add 100 μL of stop solution per well to terminate the reaction. f. Plate reading. Immediately after termination, use an ELISA reader to read the absorbance of each well at a wavelength of 450 nm, and calculate the concentrations of cytokines (IFN-γ, IL-4, TNF-α, and IL-2) in each group according to the standard curve.

[0062] 4. Detection of blocking antibody titer in mouse serum (1) Coating. Add 100 μL / well of the coating working solution to a high-adsorption 96-well plate and let it stand overnight at 2℃~8℃.

[0063] (2) Blocking. Take out the overnight coated high-adsorption 96-well plate, wash the plate 3 times with 300 μL / well washing solution, add 250 μL / well blocking solution, and block at 25℃ for 110 min to 190 min.

[0064] (3) VLP pretreatment. Prepare GII.3 containing 100 ng / mL trypsin and GII.6 containing 100 ng / mL trypsin, and incubate at 37℃ for 30 min.

[0065] (4) Sample and VLP pre-incubation. Prepare the test serum and VLPs, mix the test serum and VLPs in equal volumes for pretreatment and incubation, seal with sealing film, and incubate at 37℃ for 50 min to 70 min.

[0066] (5) Sample incubation. Wash the plate 3 times, add 100 μL of the test serum and VLPs pre-incubated for 1 h to each well, seal the plate with sealing film, and incubate at 25℃ for 80 min to 100 min.

[0067] (6) Rabbit polyclonal antibody incubation. Wash the plate 4 times, add 100 μL of freshly prepared rabbit polyclonal antibody working solution to each well, seal the plate with sealing film, and incubate at 25°C for 55 min to 65 min.

[0068] (7) Enzyme-labeled secondary antibody incubation. Wash the plate 4 times, add 100 μL of goat anti-rabbit IgG-HRP working solution to each well, seal the plate with sealing film, and incubate at 25℃ for 55 min to 65 min.

[0069] (8) Color development. Wash the plate 5 times, add 100 μL of TMB color development solution to each well, and incubate in the dark for 5 min to 30 min.

[0070] (9) Termination. After adding 100 μL of termination solution to each well, the absorbance was measured at 450 nm within 30 min.

[0071] 5. Experimental Results (5.1) Specific antibody detection results like Figure 1 Under the coating of GⅡ.3 antigen, at 21d, 28d, and 35d, the specific antibody IgG produced by the body stimulated by the combined adjuvant LNP-A+CpG+QS-21 group was significantly higher than that in the aluminum adjuvant group (P<0.05); Figure 2 As shown, at IgG1 levels, the aluminum adjuvant group was significantly higher than the combined adjuvant LNP-A+CpG+QS-21 group at 28d, 35d, and 56d (P<0.05); Figure 3As shown, at the IgG2a level, the combined adjuvant LNP-A+CpG+QS-21 group was significantly higher than the aluminum adjuvant group at 21d, 28d, 35d, 56d, and 120d (P<0.001). It can be seen that there were no significant differences between the combined adjuvant LNP-A+CpG+QS-21 group and the combined adjuvant LNP-A+CpG2006+QS-21 group in terms of IgG, IgG1, and IgG2a (P>0.05).

[0072] like Figure 4 As shown, under the coating of GⅡ.6 antigen, at 21d, 28d, 35d, and 56d, the specific antibody IgG produced by the body stimulated by the combined adjuvant LNP-A+CpG+QS-21 group was significantly higher than that in the aluminum adjuvant group (P<0.05). Furthermore, at 28d and 56d, the specific antibody IgG produced by the body stimulated by the combined adjuvant LNP-A+CpG+QS-21 group was significantly higher than that in the combined adjuvant LNP-A+CpG2006+QS-21 group (P<0.05). Figure 5 As shown, at IgG1 levels, the aluminum adjuvant group was significantly higher than the combined adjuvant LNP-A+CpG+QS-21 group at 35, 56, and 120 days (P<0.05), but at 28 days, the IgG1 level in the combined adjuvant LNP-A+CpG+QS-21 group was significantly higher than that in both the aluminum adjuvant group and the combined adjuvant LNP-A+CpG2006+QS-21 group (P<0.05). Figure 6 As shown, at the IgG2a level, the combined adjuvant LNP-A+CpG+QS-21 group was significantly higher than the aluminum adjuvant group at 21d, 28d, 35d, 56d, and 120d (P<0.001). Furthermore, at 28d, 35d, and 56d, the combined adjuvant LNP-A+CpG+QS-21 group was significantly higher than the combined adjuvant LNP-A+CpG2006+QS-21 group (P<0.05). At 28d, the combined adjuvant LNP-A+CpG+QS-21 group was extremely significantly higher than the combined adjuvant LNP-A+CpG2006+QS-21 group (P<0.0001).

[0073] (5.2) Cytokine detection results like Figure 7 As shown, at the IFN-γ level, regardless of whether it was 28 days or 120 days after the initial immunization, the combined adjuvant LNP-A+CpG+QS-21 group was significantly higher than the aluminum adjuvant group (P<0.001). Figure 8 As shown, at TNF-α levels, regardless of whether it was 28 days or 120 days after the initial immunization, the combined adjuvant LNP-A+CpG+QS-21 group was significantly higher than the aluminum adjuvant group (P<0.05). Figure 9As shown, at IL-2 levels, the combined adjuvant LNP-A+CpG+QS-21 group was significantly higher than the aluminum adjuvant group at 28 days and 120 days (P<0.05). Figure 10 As shown, there were no significant differences in IL-4 levels between the groups, whether at 28 days or 120 days after the first immunization (P>0.05).

[0074] (5.3) Results of blocking antibody detection like Figure 11 As shown, under the coating of GⅡ.3 antigen, regardless of whether it was 28 days or 120 days after the first immunization, the combined adjuvant LNP-A+CpG+QS-21 group had significantly higher efficacy than the aluminum adjuvant group (P<0.01). Figure 12 As shown, under the coating of GⅡ.6 antigen, at 28 days, the combined adjuvant LNP-A+CpG+QS-21 group was significantly higher than the aluminum adjuvant group (P<0.0001).

[0075] (5.4) Experimental Results The above experimental results demonstrate that the composite adjuvant LNP-A+CpG+QS-21 group designed in this application exhibits excellent immunostimulatory effects. This composite adjuvant is significantly superior to aluminum adjuvant not only in inducing specific antibody levels of IgG, but also in inducing antibody subtype IgG2a. This indicates that the composite adjuvant composition can induce both high levels of humoral and cellular immunity, resulting in higher serum blocking antibody titers. In conclusion, for the development of antiviral vaccines, the long-acting antibody and memory T cell maintenance capabilities of this composite adjuvant composition may reduce the frequency of booster immunizations; therefore, this composite adjuvant composition has potential clinical application value.

[0076] In summary, the composite adjuvant composition of this application has at least the following advantages: (1) The compound adjuvant of this application not only has a significant immune-enhancing effect on vaccines that require simultaneous induction of humoral immunity and cellular immunity to produce effective immune protection, but can also comprehensively improve the breadth and intensity of the immune response. At the same time, the long-acting antibody maintenance ability and the continuous existence of memory T cells of the compound adjuvant are expected to reduce the frequency of booster immunization of vaccines, thereby solving the problem of vaccination burden caused by insufficient immune persistence of traditional adjuvants.

[0077] (2) The compound adjuvant of this application is significantly superior to aluminum adjuvant in inducing specific antibody IgG levels, and also shows a significant advantage in inducing antibody subtype IgG2a. Since IgG represents an important indicator of humoral immunity, and IgG2a is related to Th1 immune response and is one of the key markers of cellular immunity, this result directly indicates that the compound adjuvant can effectively induce the body to produce high levels of both humoral and cellular immunity, and promote the production of higher serum blocking antibody titers. Combined with the potential of the compound adjuvant in maintaining long-acting antibodies and preserving memory T cells, it can not only meet the requirements of antiviral vaccines for a comprehensive immune response, but also reduce the frequency of booster immunizations, thereby further highlighting its potential clinical application value in antiviral vaccine development.

[0078] While specific embodiments of this application have been described in detail, this should not be construed as limiting the scope of protection of this application. Various modifications and variations that can be made by those skilled in the art without inventive effort within the scope described in the claims still fall within the scope of protection of this application.

Claims

1. A compound adjuvant composition, characterized in that, The composite adjuvant composition includes neutral liposomes, CpG adjuvant, and QS-21.

2. The composite adjuvant composition according to claim 1, characterized in that, The CpG adjuvant includes at least one of CPG-KHS1, CPG-KHS2, CPG-KHS3, CPG-KHS4, CPG-KHS5, and CPG-KHS6.

3. The composite adjuvant composition according to claim 1, characterized in that, The neutral liposomes include dioleoyl lecithin and cholesterol. The neutral liposomes are nanovesicles composed of a phospholipid bilayer, and the particle size of the nanovesicles is 100nm~200nm.

4. The composite adjuvant composition according to claim 1, characterized in that, The neutral liposomes were prepared by the following method: Weigh out dioleoyl lecithin and cholesterol, add anhydrous ethanol and melt in a water bath to obtain a mixed solution; The mixed solution was used to prepare crude liposomes using microfluidic technology; The crude liposomes were subjected to dilution, concentration, and filtration sterilization processes in sequence to obtain the neutral liposomes.

5. The composite adjuvant composition according to claim 4, characterized in that, The ratio of dioleoyl lecithin, cholesterol, and anhydrous ethanol is (50mg~100mg):(50mg~100mg):(5mL~15mL), and the water bath melting temperature is 50℃~85℃.

6. The composite adjuvant composition according to claim 4, characterized in that, The process of sequentially diluting, concentrating, and filtration-sterilizing the crude liposomes includes the following steps: The crude liposomes were diluted 10-fold with PBS buffer containing 0.05 wt% Tween 80 to obtain a diluted solution; The diluted solution was added to a 100 kDa ultrafiltration tube and concentrated and filtered at 2000 g / 10 min until the volume of the remaining liquid was the same as the volume of the crude liposomes. The concentrated liquid was filtered through a 0.22 μm filter membrane to remove bacteria, thus obtaining the neutral liposomes.

7. The composite adjuvant composition according to claim 1, characterized in that, The neutral liposomes are in the form of 10 μL / dose to 50 μL / dose, the CpG adjuvant is in the form of 5 μg / dose to 100 μg / dose, and the QS-21 is in the form of 5 μg / dose to 100 μg / dose.

8. The use of a compound adjuvant composition according to any one of claims 1 to 7 in vaccine preparation.

9. The application according to claim 8, characterized in that, The vaccine also includes antigen norovirus-like particles and PBS buffer solution, wherein the subtypes of the antigen norovirus-like particles include VLP GII.3 and VLPGII.6 in a mass ratio of 1~5:1~5.

10. The application according to claim 9, characterized in that, The vaccine comprises the following components: neutral liposomes at a concentration of 10 μL / dose to 50 μL / dose, CpG adjuvant at a concentration of 5 μg / dose to 100 μg / dose, QS-21 at a concentration of 5 μg / dose to 100 μg / dose, antigen norovirus-like particles at a concentration of 0.5 μg / dose to 50 μg / dose, and PBS buffer solution at a concentration of 50 μL / dose to 100 μL / dose; wherein the concentration of the PBS buffer solution is 0.1 M.

Images