A hemoglobin-resistant Taq DNA polymerase mutant and its construction method
By site-directed mutagenesis of Taq DNA polymerase, particularly amino acid mutations at positions 623 and/or 721, hemoglobin-resistant mutants were prepared, solving the problem of hemoglobin's inhibition of PCR amplification and significantly improving amplification capacity and accuracy in high-concentration hemoglobin environments.
Patent Information
- Application Number
- CN202511108423.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-08
- Publication Date
- 2026-08-04
- Estimated Expiration
- 2045-08-08
AI Technical Summary
Taq DNA polymerase is inhibited in clinical samples due to the presence of hemoglobin, resulting in decreased PCR amplification efficiency. Current technologies are unable to effectively solve this problem.
Hemoglobin-resistant mutants, including S623D, E721A, or S623D/E721A mutants, were prepared by site-directed mutagenesis of the amino acid sequence of Taq DNA polymerase, particularly at positions 623 and/or 721, thereby improving its tolerance to hemoglobin.
The mutant Taq DNA polymerase maintains high amplification activity in a high-concentration hemoglobin environment. The mutant S623D has a 4-fold amplification capacity of wild type at 3.2 mg/mL hemoglobin, 4-fold of E721A, and 8-fold of S623D/E721A, which improves the accuracy and applicability of PCR amplification.
Smart Images

Figure CN120989035B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biology, and more specifically, to a hemoglobin-resistant Taq DNA polymerase mutant and a method for constructing the same. Background Technology
[0002] Hemoglobin (HGB) is a specialized protein in red blood cells that transports oxygen and gives blood its red color. It is composed of globin and heme. The globin portion is a tetramer composed of two pairs of different globin chains (α and β chains). Heme is an iron porphyrin compound and a cofactor of hemoglobin. Each heme group consists of a ring composed of four pyrrole subunits, with a ferrous ion at the center of the ring. In clinical PCR testing using blood as a template, hemoglobin in the blood is released into the PCR system and interacts with Taq DNA polymerase, thereby inhibiting the formation of amplicon.
[0003] Taq DNA polymerase, the first thermostable DNA polymerase discovered, has a molecular weight of 94 kDa. It was initially extracted by Saiki et al. from a strain of thermophilic bacterium *Thermus aquaticus* isolated from hot springs. This enzyme is heat-resistant; after 2 hours at 70°C, its residual activity is greater than 90% of the original activity; after 2 hours at 93°C, its residual activity is 60% of the original activity; and after 2 hours at 95°C, its residual activity is 40% of the original activity. In molecular cloning, Taq DNA polymerase can be used for DNA sequencing and for in vitro amplification of specific DNA fragments using polymerase chain reaction (PCR). During PCR, because Taq DNA polymerase is not inactivated during the denaturation step (approximately 94°C), it can directly enter the second cycle, eliminating the need to add fresh enzyme at each cycle. This makes Taq DNA polymerase a unique enzyme in PCR reactions.
[0004] PCR technology is a cornerstone of modern molecular biology, and Taq DNA polymerase is the classic mainstay of PCR technology. Based on the inherent function and characteristics of Taq DNA polymerase, it has been modified through techniques such as site-directed mutagenesis, domain recombination, and directed evolution. This has resulted in many mutants of Taq polymerase exhibiting improved catalytic performance or new functions, which are widely used in molecular biology fields, such as direct PCR, allele detection, Sanger sequencing, quantitative real-time PCR, and Taq cloning. However, because commonly used clinical samples contain many substances, especially hemoglobin, that significantly inhibit PCR amplification, there is a problem of Taq DNA polymerase's low tolerance to hemoglobin. Summary of the Invention
[0005] The purpose of this invention is to provide a hemoglobin-resistant Taq DNA polymerase mutant and its construction method in order to solve the above-mentioned problems. It is obtained by mutating the amino acid sequence of Taq DNA polymerase as shown in SEQ ID NO.1 at positions 623 and / or 721.
[0006] The above-mentioned technical objective of the present invention is achieved through the following technical solution: a hemoglobin-resistant Taq DNA polymerase mutant, wherein the amino acid sequence encoded by the Taq DNA polymerase as shown in SEQ ID NO. 1 is mutated, and the mutant contains at least one or all of the mutations selected from the S623D and E721A sites.
[0007] SEQ ID NO.1: In one embodiment, the S623D mutation involves mutating serine at position 623 of the Taq DNA polymerase, as shown in SEQ ID NO.1, to aspartic acid, with the amino acid sequence shown in SEQ ID NO.2.
[0008] SEQ ID NO.2: In another embodiment, the E721A mutation is to mutate the glutamic acid at position 721 of the Taq DNA polymerase shown in SEQ ID NO.1 to alanine, with the amino acid sequence shown in SEQ ID NO.3.
[0009] SEQ ID NO.3: In another embodiment, the common mutation at the S623D site and the E721A site is to mutate serine at position 623 of the Taq DNA polymerase, as shown in SEQ ID NO.1, to aspartic acid, and simultaneously mutate glutamic acid at position 721 to alanine, as shown in SEQ ID NO.4.
[0010] SEQ ID NO.4: This invention provides a method for preparing the above-mentioned hemoglobin-resistant Taq DNA polymerase mutant, the specific steps of which are as follows: (1) Using the nucleotide sequence shown in SEQ ID NO.1 as a template, design site-directed mutagenesis primers according to the rationally designed sites, perform PCR amplification to obtain the gene containing the mutation site, and then construct a vector containing the gene encoding the mutant. (2) Transform the gene vector containing the coding mutant into the host cell; (3) Screen and verify the recombinant cells constructed in the previous step to obtain positive clones. Then, culture and ferment to produce enzymes, collect cells by centrifugation, break the cells using an ultrasonic cell disruptor, and centrifuge to obtain crude enzyme solution containing Taq DNA polymerase mutant.
[0011] The present invention also provides a gene encoding the above-mentioned Taq DNA polymerase mutant.
[0012] The present invention also provides a recombinant vector carrying the above-mentioned genes.
[0013] In one embodiment, the recombinant vector uses the pET-28a(+) vector as the expression vector.
[0014] The present invention also provides a recombinant cell carrying the above-mentioned gene or the above-mentioned recombinant vector.
[0015] In one embodiment, the recombinant cells are Escherichia coli (E. coli) Escherichia coli () is the expression host.
[0016] The present invention also provides a genetically engineered bacterium, which uses Escherichia coli as a host and expresses the above-mentioned Taq DNA polymerase mutant.
[0017] In one embodiment, the genetically engineered bacteria uses Escherichia coli BL21(DE3) as the expression host.
[0018] In another embodiment, the genetically engineered bacteria use the pET-28a(+) vector as the expression host.
[0019] This invention provides a method for constructing a hemoglobin-resistant Taq DNA polymerase mutant, which involves mutating amino acids at positions 623 and / or 721 of the Taq DNA polymerase as shown in SEQ ID NO.1.
[0020] The present invention provides the use of the above-mentioned recombinant vector, or the above-mentioned recombinant cells, in the preparation of Taq DNA polymerase.
[0021] The present invention provides the application of the above-mentioned Taq DNA polymerase mutant, or the gene encoding the above-mentioned mutant, or the above-mentioned recombinant vector, or the Taq DNA polymerase expressed by the above-mentioned recombinant cells in the PCR reaction of amplifying samples containing hemoglobin.
[0022] In summary, the present invention has the following beneficial effects: 1. Based on natural Taq DNA polymerase, this invention modifies the molecular structure of Taq DNA polymerase through rational design and site-directed mutagenesis biotechnology, analyzes the effect of mutated residues on the enzyme's ability to tolerate hemoglobin, and finally obtains two mutant strains, S623D and E721A, with improved stability due to single-point mutation.
[0023] 2. Natural Taq DNA polymerase can amplify in the presence of 0.8 mg / mL hemoglobin. The Taq DNA polymerase mutant S623D provided by this invention can amplify in the presence of 3.2 mg / mL hemoglobin, which is 4 times that of natural Taq DNA polymerase; the Taq DNA polymerase mutant E721A can amplify in the presence of 3.2 mg / mL hemoglobin, which is 4 times that of natural Taq DNA polymerase; S623D / E721A can amplify in the presence of 6.4 mg / mL hemoglobin, which is 8 times that of natural Taq DNA polymerase.
[0024] 3. The Taq DNA polymerase mutant obtained by this invention is more suitable for PCR amplification of samples containing hemoglobin than the wild type, and is more conducive to the accuracy of result evaluation for samples containing hemoglobin inhibitors. Attached Figure Description
[0025] Figure 1 This is a graph showing the sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) analysis of the washing buffer during the purification of Taq DNA polymerase. Figure 2 A standard curve for Taq DNA polymerase activity assay; Figure 3 Agarose gel electrophoresis results for Taq-wt (1-6), Taq-S623D (7-14), and Taq-E721A (15-22) at hemoglobin gradients of 0.1 mg / mL, 0.2 mg / mL, 0.4 mg / mL, 0.8 mg / mL, 1.6 mg / mL, 3.2 mg / mL, and 6.4 mg / mL. Figure 4The image shows the agarose gel image of Taq-S623D / E721A at hemoglobin gradients of 0.1 mg / mL, 0.2 mg / mL, 0.4 mg / mL, 0.8 mg / mL, 1.6 mg / mL, 3.2 mg / mL, and 6.4 mg / mL. Detailed Implementation
[0026] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0027] The pET-28a(+) vectors used in the following examples were purchased from Invitrogen.
[0028] The culture media involved in the following examples are as follows: (1) LB liquid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L.
[0029] (2) LB solid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 15 g / L.
[0030] The detection methods involved in the following embodiments are as follows: Taq DNA polymerase activity assay uses a fluorescence method. This method utilizes the fact that Taq DNA polymerase can amplify double-stranded DNA using long-chain oligonucleotides as templates and a short single-stranded oligonucleotide complementary to the long-chain oligonucleotide at the 5' end as a primer. The fluorescent dye SYBR Green binds to the minor groove of the double-stranded DNA and emits fluorescence; the more DNA double strands synthesized, the stronger the fluorescence signal. The real-time fluorescence signal collected by the DNA polymerase amplification is analyzed, and the initial slope of the real-time fluorescence signal curve can be used to determine the enzyme activity units at the beginning of the reaction. The method for determining enzyme activity mainly consists of two steps: (1) plotting a standard curve of known commercial Taq DNA polymerase activity units; (2) determining the activity units of unknown enzymes.
[0031] In the PCR detection system, a 236 bp amplicon from the human genome was used to investigate the tolerance of Taq DNA polymerase to hemoglobin. The 25 μL PCR reaction mixture consisted of: 1×PCRbufer, 2.5 mM MgCl2, 0.2 μM upstream primer, 0.02 μM downstream primer, 200 μM dNTPs, 0.4×SYBR Green, 1 U of enzyme, and a template concentration of 1 ng / μL. 2 μL of the mixture was loaded. The hemoglobin concentration in the system was increased in a gradient, and the PCR products were analyzed by nucleic acid electrophoresis.
[0032] Example 1: Construction of recombinant plasmid containing Taq DNA polymerase mutant The specific steps are as follows: (1) Construction of recombinant plasmids containing wild-type Taq DNA polymerase The wild-type Taq DNA polymerase gene polA, with a chemically synthesized nucleotide sequence as shown in SEQ ID NO. 1, was ligated to the pET-28a(+) vector after digestion with NdeI and MluI enzymes to prepare the recombinant vector pET-28a(+)-polA.
[0033] (2) Obtaining recombinant vectors containing mutants: Using whole plasmid PCR technology, the recombinant vector pET-28a(+)-polA prepared in step (1) was used as a template for site-directed mutagenesis to obtain recombinant plasmids pET-28a(+)-S623D, pET-28a(+)-E721A, and pET-28a(+)-S623D / E721A containing mutant genes.
[0034] The designed primer sequences are as follows: S623D-F: GGCGCATCTGGATGGCGATGAAAAC S623D-R:GTTTCATCGCCATCCAGATGCGCC E721A-F: GGCTATGTGGCGACCCTGTTTGGC E721A-R: GCCAAACAGGGTCGCCACATAGCC The PCR amplification program was set as follows: first, pre-denaturation at 95℃ for 5 min; then 30 cycles; denaturation at 95℃ for 30 s, annealing at 72℃ for 30 s, extension at 58℃ for 3.5 min, and incubation at 4℃. PCR products were detected by 0.8% agarose gel electrophoresis.
[0035] The final amplified fragment was treated with Dpn I enzyme in a 37°C water bath for 1 h to remove the template. Then, the PCR mixture was chemically transformed into E. coli JM109 competent cells. The transformation solution was plated on LB solid medium containing kanamycin (50 μg / mL), and the plasmid was extracted and sequenced. The sequencing was performed by Genewiz Suzhou.
[0036] Example 2: Construction of recombinant Escherichia coli engineered strain with Taq DNA polymerase mutant and expression, isolation, and purification of Taq DNA polymerase. The specific steps are as follows: (1) The recombinant plasmids pET-28a(+)-S623D, pET-28a(+)-E721A, and pET-28a(+)-S623D / E721A obtained in Example 1 were transformed into E. coli BL21 competent cells to prepare the following genetically engineered bacteria: E. coli BL21 / pET-28a(+)-pulA, E. coli BL21 / pET-28a(+)-S623D, E. coli BL21 / pET-28a(+)-E721A, and E. coli BL21 / pET-28a(+)-S623D / E721A.
[0037] (2) The genetically engineered bacteria prepared in step (1) were inoculated into 10 mL of LB liquid medium containing 50 µg / mL kanamycin sulfate and cultured overnight at 37 °C and 200 rpm to prepare seed culture. The prepared seed culture was transferred to 100 mL of LB liquid medium containing 50 µg / mL kanamycin sulfate at an inoculation rate of 2% (v / v) and cultured at 30 °C for 20 h to obtain the fermentation broth. The fermentation broth was centrifuged at 8000 × g at 4 °C for 5 min to obtain cell cells. After washing the cells three times, they were resuspended in 10 mL of disodium hydrogen phosphate-sodium dihydrogen phosphate buffer (pH 7.0).
[0038] The resuspended cells were treated with an ultrasonic disruptor under ice bath conditions for 30 min, centrifuged for 30 min (8000×g, 4℃), and the supernatant was discarded to obtain the crude enzyme solution. The supernatant was filtered through a 0.22 µm filter and then loaded onto a 1 mL Ni affinity column, which was pre-equilibrated with 50 mM wash buffer (20 mM Tris and 500 mM NaCl, pH 7.4). Unbound protein and Taq DNA polymerase were then eluted with elution buffer (20 mM Tris, 500 mM NaCl and 500 mM imidazole, pH 7.4) using a linear gradient. Pure enzyme solutions containing wild-type Taq DNA polymerase, S623D, E721A, and S623D / E721A were prepared. The purified enzyme solutions were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The results are as follows: Figure 1 As shown in the figure, the results indicate that there is a clear band at 94 kDa, proving that Taq DNA polymerase is expressed.
[0039] (3) Perform enzyme activity assay on the pure enzyme solution prepared in step (2). The pure enzyme solution containing wild-type Taq DNA polymerase, the pure enzyme solution containing S623D, the pure enzyme solution containing E721A, and the pure enzyme solution containing S623D / E721A were tested respectively in step (2).
[0040] The designed primer sequences are as follows: 236bp-F: TGGGCTTGAATAGTTAGATGCT 236bp-R: GCCTTCGCCTGTCCTCAT Plot a standard curve for known Taq DNA polymerase activity units (e.g.) Figure 2 As shown in Table 1, the curves from the real-time fluorescence PCR instrument were exported, and the initial slopes of each curve were analyzed using Origin software. Table 1 Initial slope of DNA polymerase activity quantification curve Example 3: Hemoglobin resistance test of Taq DNA polymerase mutants This test used quantitative real-time PCR to detect the antihemoglobin inhibition ability of Taq-wt, Taq-S623D, Taq-E721A, and Taq-S623D / E721A. Using 5 ng of Human cDNA as a template, 525 bp fragments were amplified using wild-type Taq DNA polymerase and each Taq DNA polymerase mutant, respectively. The 25 μL PCR reaction system consisted of: 1×PCRbufer, 2.5 mM MgCl2, 0.2 μM upstream primer, 0.02 μM downstream primer, 200 μM dNTPs, 0.4×SYBR Green, and 1 U of enzyme. The template concentration was 1 ng / μL, and 2 μL was loaded. The hemoglobin gradient was 0.1 mg / mL, 0.2 mg / mL, 0.4 mg / mL, 0.8 mg / mL, 1.6 mg / mL, 3.2 mg / mL, and 6.4 mg / mL. The reaction program was: 95℃ for 30s; 95℃ for 5s, 60℃ for 30s / cycle, for a total of 45 cycles. After the reaction, the amplification curves were analyzed, and the reaction products were detected by electrophoresis using a 3% agarose gel. The nucleotide sequences of the primers used are as follows: 525bp-F:TTGGTGGAGGTATGTTTAGATTT 525bp-R:TCGCCTGTCCTCATGTATTG Experimental results are as follows Figure 3 , Figure 4 As shown.
[0041] In summary, this invention, based on natural Taq DNA polymerase, rationally designed and combined with site-directed mutagenesis biotechnology to modify the molecular structure of Taq DNA polymerase, analyzed the effect of mutated residues on the enzyme's tolerance to hemoglobin, and ultimately obtained two mutant strains, S623D and E721A, with improved stability due to single-point mutation. The Taq DNA polymerase mutant S623D can amplify in the presence of 3.2 mg / mL hemoglobin, which is 4 times that of the natural Taq DNA polymerase; the Taq DNA polymerase mutant E721A can amplify in the presence of 3.2 mg / mL hemoglobin, which is 4 times that of the natural Taq DNA polymerase; S623D / E721A can amplify in the presence of 6.4 mg / mL hemoglobin, which is 8 times that of the natural Taq DNA polymerase. Therefore, the Taq DNA polymerase mutants are more suitable than the wild type for PCR amplification of samples containing hemoglobin, and are more conducive to the accurate evaluation of results for samples containing hemoglobin inhibitors.
[0042] The above description is merely a preferred embodiment of the present invention. The scope of protection of the present invention is not limited to the above embodiments. All technical solutions falling within the scope of the present invention's concept are within the scope of protection of the present invention. It should be noted that for those skilled in the art, any improvements and modifications made without departing from the principles of the present invention should also be considered within the scope of protection of the present invention.
Claims
1. A mutant of Taq DNA polymerase resistant to hemoglobin, characterized in that, The amino acid sequence encoded by Taq DNA polymerase, as shown in SEQ ID NO.1, is mutated at at least one of the S623D and E721A sites.
2. A method for preparing the hemoglobin-resistant Taq DNA polymerase mutant of claim 1, characterized in that, The specific steps are as follows: (1) Using the nucleotide sequence shown in SEQ ID NO.1 as a template, design site-directed mutagenesis primers according to the rationally designed sites, perform PCR amplification to obtain the gene containing the mutation site, and then construct a vector containing the gene encoding the mutant. (2) Transform the gene vector containing the coding mutant into the host cell; (3) Screen and verify the recombinant cells constructed in the previous step to obtain positive clones. Then, culture and ferment to produce enzymes, collect cells by centrifugation, break the cells using an ultrasonic cell disruptor, and centrifuge to obtain crude enzyme solution containing Taq DNA polymerase mutant.
3. A gene encoding the Taq DNA polymerase mutant of claim 1.
4. A recombinant vector carrying the gene of claim 3, characterized in that, The recombinant vector used was pET-28a(+) as the expression vector.
5. A recombinant cell carrying the gene of claim 3 or the recombinant vector of claim 4, characterized in that, The recombinant cells used Escherichia coli as the expression host.
6. A genetically engineered bacterium expressing the Taq DNA polymerase mutant of claim 1, characterized in that, The genetically engineered bacteria use Escherichia coli as a host.
7. The genetically engineered bacteria as described in claim 6, characterized in that, The genetically engineered bacteria used Escherichia coli BL21(DE3) as the expression host.
8. The use of the recombinant vector of claim 4 or the recombinant cell of claim 5 in the preparation of Taq DNA polymerase.
9. The application of the Taq DNA polymerase mutant of claim 1, the gene of claim 3, the recombinant vector of claim 4, or the recombinant cell of claim 5 expressing the Taq DNA polymerase in a PCR reaction for amplifying samples containing hemoglobin.