Method for constructing vascularized liver organ and vascularized liver organ

Abstract

The invention provides a method for constructing a vascularized liver organ and the vascularized liver organ, and belongs to the technical field of tissue engineering. The method for constructing the vascularized liver organoid comprises the steps that a plurality of vectors in a transposition vector plasmid kit are transfected into pluripotent stem cells to obtain a stem cell line capable of regulating and controlling ETV2 gene expression, and the transposition vector plasmid kit can regulate and control ETV2 gene expression through non-natural amino acid; adding non-natural amino acid and a liver induction culture medium, inducing stem cell line differentiation and regulating ETV2122 * full-length protein expression, so as to obtain the vascularized liver organ. According to the application, reading-through of ETV2 gene full-length protein is realized by utilizing a gene codon extension technology, conditional expression of a vascular development key factor ETV2 is accurately controlled, efficient vascularization of liver organs is realized, and a new platform is provided for in-vitro liver development research, disease simulation, drug screening, toxicity detection and the like.

Description

Technical Field

[0001] This application relates to the field of tissue engineering, and more particularly to methods for constructing vascularized liver organoids and vascularized liver organoids. Background Technology

[0002] Organoids are multicellular, three-dimensional structures grown in vitro with the potential to mimic the main functional units and inter-organ connections of human organs. While they cannot perfectly replicate human organs, organoids are multicellular organ-like tissues with a three-dimensional structure, enabling spatial interactions among various cells. Compared to animal models, organoids allow for experiments using human-derived tissues, resulting in results closer to those of human organs. Liver organoids, generated from the self-organization and differentiation of stem cells in vitro, possess three-dimensional tissues with structures and functions similar to the human liver, and hold immense potential in developmental research, disease simulation, and drug testing.

[0003] However, research on liver organoids still faces certain limitations. One of the main challenges is the lack of vascular structures and an immune system in existing liver organoids. The liver contains a rich vascular network and various cell types, such as hepatocytes, bile duct cells, hepatic stellate cells, Kupffer cells, and sinusoidal endothelial cells. These cells coordinate and support liver homeostasis and function in multiple ways, including energy metabolism, bile production and detoxification, drug metabolism, albumin synthesis, and immune regulation. Furthermore, the vascular network provides sufficient oxygen and nutrients to liver tissue, influencing the proliferation and differentiation of hepatocytes and is closely related to liver development. Currently, there are several methods to achieve vascularization of liver organoids, such as 3D printing technology, transplanting liver organoids into mice for vascular integration, co-culturing with endothelial cells, and adding endothelial cell differentiation factors during organoid development. However, the combination of gene codon amplification technology and organoid technology to generate and manipulate vascularized liver organoids remains a gap in the field. Summary of the Invention

[0004] In view of this, in order to at least partially solve at least one of the aforementioned technical problems, this application provides a method for constructing vascularized liver organoids and vascularized liver organoids.

[0005] According to one embodiment of this application, a method for constructing vascularized liver organoids is provided, comprising:

[0006] Multiple vectors from the transposon vector plasmid kit were transfected into pluripotent stem cells to obtain stem cell lines capable of regulating ETV2 gene expression. The transposon vector plasmid kit can regulate ETV2 gene expression using non-natural amino acids. The addition of non-natural amino acids and liver induction medium induced stem cell differentiation and regulated ETV2 expression. 122* Full-length protein expression yielded vascularized liver organoids.

[0007] According to another embodiment of this application, a vascularized liver organoid is provided, which is obtained by the above-described method for constructing a vascularized liver organoid.

[0008] According to embodiments of this application, the non-natural amino acid NAEK is inserted at position 122 of ETV2 using a bioorthogonal translation system, achieving sporadic overexpression of ETV2 controlled by NAEK. This regulates the differentiation of stem cells into endothelial cells, thereby constructing a dynamically regulated vascular endothelial cell differentiation system based on gene codon expansion technology. This system enables the construction of functional vascularized liver organoids and allows for the continuous long-term culture and functional maintenance of liver organoids. This application utilizes gene codon expansion technology to regulate the formation of functional vascularized liver organoids, which is simple to operate, highly reproducible, and a near-physiological protein translation regulation method. It provides highly biomimetic organoid in vitro models for developmental biology, disease simulation, new drug development, and regenerative medicine. Attached Figure Description

[0009] The above and other objects, features and advantages of this application will become clearer from the following description of embodiments with reference to the accompanying drawings, in which:

[0010] Figure 1 This is a flowchart of the method for constructing vascularized liver organoids according to an embodiment of this application;

[0011] Figure 2 This is a map of the PiggyBac plasmid from an embodiment of this application. A represents PiggyBac-MmPylRS / tRNA. pyl Plasmid B is PiggyBac-ETV2 122 *Plasmid;

[0012] Figure 3 A schematic diagram illustrating the process of constructing an orthogonal translation system for stem cell lines for the implementation of this application.

[0013] Figure 4 This is a diagram showing the results of RT-qPCR detection of gene expression in germ layer cells on day 3 of differentiation, as described in this application.

[0014] Figure 5 This is a diagram showing the results of RT-qPCR detection of gene expression in foregut cells on day 6 of differentiation, as described in this application.

[0015] Figure 6 This is a diagram showing the developmental and differentiation results of a vascularized liver organoid that has been developing for 30 days in an embodiment of this application.

[0016] Figure 7 This is a diagram showing the distribution of vascular structures in a vascularized liver organoid on day 30 in this embodiment of the application.

[0017] Figure 8 This is a diagram showing the differentiation of hepatic stellate cells and Kupffer cells in vascularized liver organoids and the control group on day 30 in the embodiments of this application.

[0018] Figure 9 This is a graph showing the results of RT-qPCR detection of gene expression in vascularized liver organoids on day 30, as described in this application. Detailed Implementation

[0019] The embodiments of this application will now be described with reference to the accompanying drawings. However, it should be understood that these descriptions are exemplary only and are not intended to limit the scope of this application. In the following detailed description, numerous specific details are set forth to provide a thorough understanding of the embodiments of this application for ease of explanation. However, it will be apparent that one or more embodiments may be implemented without these specific details. Furthermore, descriptions of well-known structures and technologies are omitted in the following description to avoid unnecessarily obscuring the concepts of this application.

[0020] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of this application. The term "comprising" as used herein indicates the presence of features, steps, or operations, but does not exclude the presence or addition of one or more other features.

[0021] When using expressions such as "at least one of A, B, and C," the expression should generally be interpreted in accordance with the meaning commonly understood by a person skilled in the art (e.g., "a system having at least one of A, B, and C" should include, but is not limited to, systems having A alone, having B alone, having C alone, having A and B, having A and C, having B and C, and / or having A, B, and C, etc.). When using expressions such as "at least one of A, B, or C," the expression should generally be interpreted in accordance with the meaning commonly understood by a person skilled in the art (e.g., "a system having at least one of A, B, or C" should include, but is not limited to, systems having A alone, having B alone, having C alone, having A and B, having A and C, having B and C, and / or having A, B, and C, etc.).

[0022] The term "homology" refers to the level of similarity or percentage identity between polynucleotide sequences in terms of percentage nucleotide positional similarity (i.e., sequence similarity or identity). As used here, homology also refers to the concept of similar functional properties between different polynucleotide molecules; for example, promoters with similar functions may have homologous cis elements. Polynucleotide molecules are homologous when they specifically hybridize under certain conditions to form a double-stranded molecule. Under these conditions (called stringent hybridization conditions), one polynucleotide molecule can be used as a probe or primer to identify another polynucleotide molecule sharing homology.

[0023] The term "promoter" refers to a polynucleotide molecule that, in its native state, is located upstream of or 5' of the translation start codon in the reading frame (or protein-coding region) and participates in the recognition and binding of RNA polymerase II and other proteins (trans-acting transcription factors) to initiate transcription.

[0024] The term "operably linked" refers to the linkage of a first polynucleotide molecule (e.g., a promoter) to a second transcribed polynucleotide molecule (e.g., a target gene), wherein the polynucleotide molecules are arranged such that the first polynucleotide molecule influences the function of the second polynucleotide molecule. Preferably, the two polynucleotide molecules are portions of a single, consecutive polynucleotide molecule, and more preferably, they are adjacent. For example, if a promoter regulates or mediates the transcription of a target gene within the cell, then the promoter is operably linked to the target gene.

[0025] The term "conversion" refers to the method of introducing a heterologous DNA sequence into a host cell or organism.

[0026] The term "expression" refers to the transcription and / or translation of endogenous genes or transgenes in plant cells.

[0027] In this document, pluripotent stem cells include induced pluripotent stem cells (iPS) or embryonic stem cells (ESC). The pluripotent stem cells are commercially obtained iPS, preferably cells from any of the following NIH-numbered cell lines: (Coriell Institute, cat#GM25256); or, the embryonic stem cells may be human embryonic stem cells, which can be stem cells isolated or obtained from human embryos that have not undergone in vivo development and are within 14 days of fertilization.

[0028] Analysis during the conceptualization process of this application revealed a lack of understanding regarding the construction and manipulation of vascularized liver organoids using gene codon amplification technology. This application provides a method for constructing vascularized liver organoids by constructing a biological orthogonal translation system, PiggyBac-(7sk-tRNA). Pyl )x4-EF1a-MmPylRS and PiggyBac-ETV2 122* The transposase plasmid, along with the transposase plasmid, was transfected into human pluripotent stem cells (iPS or ESC cells), and engineered stem cell lines stably expressing the aforementioned orthogonal translation system were screened. The obtained stem cell lines were then cultured to differentiate into liver organoids, with NAEK added during the culture process to induce differentiation, resulting in vascularized liver organoids. This application utilizes gene codon expansion technology to achieve full-length reading of the ETV2 gene protein, precisely controlling the conditional expression of the key angiogenesis factor ETV2, and achieving highly efficient vascularization of liver organoids. This provides a new platform for in vitro liver development research, disease simulation, drug screening, and toxicity testing.

[0029] Specifically, according to one embodiment of this application, a method for constructing vascularized liver organoids is provided, comprising steps S1 to S2:

[0030] Step S1: Transfect multiple vectors from the transposon vector plasmid kit into pluripotent stem cells to obtain stem cell lines that can regulate ETV2 gene expression;

[0031] Step S2: Add non-natural amino acids and liver-inducing medium to induce cell line differentiation and regulate ETV2. 122* Full-length protein expression yielded vascularized liver organoids.

[0032] According to the implementation scheme of this application, the non-natural amino acid NAEK is inserted into position 122 of ETV2 using a biological orthogonal translation system, thereby enabling read-through of the full-length ETV2 gene protein controlled by NAEK in a time-varying manner. This regulates cell differentiation into endothelial cells, thus constructing a dynamically regulated vascular endothelial cell differentiation system based on gene codon expansion technology. This system can realize the construction of functional vascularized liver organoids and perform non-passage continuous long-term culture and functional maintenance of liver organoids.

[0033] According to the implementation scheme of this application, in step S1, the transposon vector plasmid kit can regulate the expression of the ETV2 gene through non-natural amino acids. Specifically, the non-natural amino acids can be bound to tRNA by aminoacyl-tRNA synthetase, reading through the stop codon (TAG) at position 122 of the ETV2 mutant to generate a full-length functional ETV2 protein. The full-length protein-expressed ETV2 gene can significantly promote angiogenesis, hematopoietic differentiation, and cell reprogramming, which is of great significance for constructing vascularized liver organoids. Furthermore, by regulating the timing and dosage of adding the non-natural amino acid NAEK, the initiation timing of angiogenesis can be precisely controlled. The non-natural amino acid NAEK is obtained by attaching a 2-azidoethoxycarbonyl group to the ε-amino group of lysine.

[0034] According to the embodiments of this application, in step S1, the transposon vector plasmid kit includes: a tRNA nucleotide sequence, an aminoacyl-tRNA synthetase nucleotide sequence, and an ETV2 gene mutant. The ETV2 gene mutant has the following mutation compared to the wild-type ETV2 gene: the codon at amino acid position 122 of the ETV2 gene is mutated to a stop codon. The aminoacyl-tRNA synthetase can bind non-natural amino acids to tRNA, and the tRNA bound with non-natural amino acids can pair with the stop codon of the ETV2 gene mutant, achieving full-length protein expression of the ETV2 gene.

[0035] According to the embodiments of this application, in step S1, the tRNA nucleotide sequence and the aminoacyl-tRNA synthetase nucleotide sequence are located on the same or different vectors, and the ETV2 gene mutant is located on a different vector from the tRNA nucleotide sequence and / or the aminoacyl-tRNA synthetase nucleotide sequence.

[0036] According to the implementation scheme of this application, the tRNA nucleotide sequence and the aminoacyl-tRNA synthetase nucleotide sequence can be located on the same vector or on different vectors. When located on the same vector, expression imbalances caused by vector-based transfection can be avoided, ensuring ETV2 readthrough efficiency. Single-vector transfection reduces cytotoxicity, especially suitable for cells that are difficult to transfect. Furthermore, in staged organoid culture, only one transfection is needed to establish an orthogonal system, avoiding errors introduced by multiple operations. When located on different vectors, the expression ratio of each component can be adjusted according to experimental needs. Vector separation reduces ETV2 interference with the orthogonal translation system, ensuring readthrough efficiency.

[0037] According to the embodiment of this application, in step S1, the tRNA is pyrrolidone tRNA. Pyl The sequence is shown in SEQ ID No. 1; the aminoacyl-tRNA synthetase is pyrrololysyl-tRNA synthetase MmPylRS from Methanococcus martensii, and the sequence is shown in SEQ ID No. 2.

[0038] SEQ ID No.1 (tRNA) Pyl ):

[0039] ggaaacctgatcatgtagatcgaatggactctaaatccgttcagccgggttagattcccggggtttccgccattttta.

[0040] SEQ ID No. 2 (MmPylRS):

[0041]

[0042] According to the implementation scheme of this application, in step S1, the vector is a PiggyBac transposon vector; the transposon vector plasmid kit specifically includes: PiggyBac-(7sk-tRNA) Pyl )×4-EF1a-MmPylR plasmid, and PiggyBac-ETV2 122* plasmid, of which ETV2 122* This indicates the ETV2 gene, where the amino acid at position 122 is mutated into a stop codon.

[0043] According to the implementation scheme of this application, in step S1, the PiggyBac transposon system precisely inserts the exogenous gene, namely the ETV2 gene mutant, into the TTAA site of the host genome through a "cut-and-paste" mechanism. Subsequently, the MmPylRS / tRNA system precisely inserts NAEK into the 122nd amino acid site, achieving full-length reading of the ETV2 protein. Compared with traditional plasmid transfection, this significantly improves transfection efficiency.

[0044] According to the implementation scheme of this application, in step S1, the stop codon for the mutation at amino acid position 122 is TAG, TAA, or TGA.

[0045] In some specific embodiments of this application, multiple ETV2 gene mutants are first obtained through point mutation. Through sequencing and screening, an ETV2 mutant with a mutation at position 122 to TAG, exhibiting higher expression efficiency, is obtained. 122* Gene mutants are then used as components for constructing vascularized organoids. Alternatively, gene mutants with a mutation at position 122 of TAA or TGA can be obtained and then recognized and bound using the corresponding tRNA anticodon recognition sequence.

[0046] According to the implementation scheme of this application, step S2 is further divided into sub-steps S21~S2:

[0047] Step S21: Pluripotent stem cells are cultured in a first differentiation medium to obtain a directed endoderm, wherein the directed endoderm expresses the markers SOX17 and FOXA2.

[0048] Step S22: The directional endoderm is cultured in a second differentiation medium to obtain foregut cells, which express ALB, PDX1 and CDX2 markers.

[0049] Step S23: Culture the foregut cells in the third differentiation medium to obtain foregut spheroids.

[0050] Step S24: The foregut spheroids are cultured in the fourth differentiation medium to obtain vascularized liver organoids, which express markers of vascular endothelial cells (CD31), hepatocytes (ALB), hepatic stellate cells (Vimentin), and Kupffer cells (CD68).

[0051] According to the implementation scheme of this application, in sub-step S21, a first differentiation medium containing ActivinA and BMP4 is added on days 0-3. Pluripotent stem cells are cultured in this first differentiation medium to obtain a oriented endoderm, which expresses the markers SOX17 and FOXA2. ActivinA can activate SMAD2 / 3 signaling, driving the formation of the oriented endoderm; BMP4 can synergize with ActivinA to form a high-purity oriented endoderm, laying the foundation for subsequent liver differentiation. SOX17 and FOXA2 are essential prerequisites for liver progenitor cell differentiation, confirming successful endoderm differentiation.

[0052] According to the implementation scheme of this application, NAEK is added on days 0 to 6 of liver organoid development, and the concentration of NAEK in the culture medium is maintained at 0.1 to 1 mM. Figure 5 The results showed that, compared with the H9 control group without NAEK, the experimental groups that received NAEK on days 4-6 or 0-6 exhibited significant expression of the vascular endothelial gene (CD31) in foregut cells on day 6 of differentiation; preferably, NAEK was added on days 4-6 of hepatic organoid development. Adding NAEK on days 4-6 can promote endothelial cell and hepatic-lineage-oriented differentiation through ETV2 readthrough. Specifically, ETV2 readthrough can directly activate endothelial cell differentiation-related genes, such as CD31.

[0053] According to the implementation scheme of this application, in sub-step S22, a second differentiation medium containing FGF4 and CHIR99021 is added on days 4-6. Directed endoderm is cultured in the second differentiation medium to obtain foregut cells, which express ALB, PDX1, and CDX2 markers. FGF4 can activate the MAPK / ERK pathway, promoting foregut differentiation; CHIR99021 can activate the WNT / β-catenin pathway, enhancing foregut specialization.

[0054] According to the implementation scheme of this application, in sub-step S23, starting from day 6 of liver organoid development, NAEK is removed, and foregut cells are embedded in matrix gel. Then, from day 6 to 10, a third differentiation medium containing RA is added to form foregut spheroids. RA promotes the three-dimensional aggregation and assembly of the foregut endoderm into spheroids by activating RAR / RXR nuclear receptors and regulating cell adhesion molecules (such as E-cadherin).

[0055] According to the implementation scheme of this application, in sub-step S24, a fourth differentiation medium containing OSM, HGF, and DEX is added 10-20 days after the development of liver organoids to form vascularized liver organoids. These vascularized liver organoids express markers of vascular endothelial cells (CD31), hepatocytes (ALB), hepatic stellate cells (Vimentin), and Kupffer cells (CD68). OSM can drive hepatocyte maturation through the GP130 / JAK-STAT pathway, upregulate functional genes such as albumin and CYP450 enzymes (e.g., CYP3A4), and promote hepatocyte polarity formation. HGF can activate MET receptors, supporting hepatocyte survival, proliferation, and metabolic functions (e.g., glycogen storage), and inducing angiogenesis. DEX is a glucocorticoid receptor agonist that can enhance liver-specific gene expression and promote liver organoid maturation.

[0056] According to another embodiment of this application, a vascularized liver organoid prepared by the above steps S1 to S2 is also provided.

[0057] It should be noted that the preparation method and the vascularized liver organoids obtained by the present application can be used in the research and development process or experimental testing, and are not directly applied to the diagnosis and treatment of diseases.

[0058] Example 1: Construction of Vascularized Liver Organoids Based on Embryonic Stem Cells

[0059] Figure 1 This is a flowchart of the method for constructing vascularized liver organoids according to an embodiment of this application; Figure 2 This is a map of the PiggyBac plasmid from an embodiment of this application. A represents PiggyBac-(7sk-tRNA). Pyl )×4-EF1a-MmPylR plasmid, B is PiggyBac-ETV2 122 *Plasmid.

[0060] refer to Figures 1-2 Specifically, it includes the following steps:

[0061] Step 1: Construction of plasmids for biological orthogonal translation system

[0062] The MmPylRS / tRNA orthogonal pair derived from *Methanococcus martensii* includes an orthogonal tRNA and an aminoacyl-tRNA synthetase, MmPylRS. The tRNA is derived from prokaryotes, and the anticodon loop of the tRNA corresponds to a premature stop codon. The aminoacyl-tRNA synthetase can bind non-natural amino acids to the aforementioned tRNA. The tRNA and aminoacyl-tRNA synthetase are constructed onto the same vector.

[0063] The biological orthogonal translation system was constructed into the commercially available PiggyBac transposon plasmid (PiggyBac-CMV-MCS-EF1a-Puro, Miaoling Biotechnology), that is, PiggyBac-(7sk-tRNA) was constructed through homologous recombination. Pyl )x4-EF1a-MmPylRS (or PiggyBac-MmPylRS / tRNA) pyl plasmid) and PiggyBac-*ETV2 122TAG (or PiggyBac-ETV2) 122 *Plasmid) Transposon plasmid.

[0064] For detailed construction instructions, please refer to [link / details]. Figure 2 ,in Figure 2 The ETV2 gene sequence in B is the ETV2 gene sequence with the 122nd amino acid mutated into the stop codon TAG. The unmutated ETV2 gene sequence can be found on the NCBI website with accession number XM_047438404.1.

[0065] Step 2: Construction of human pluripotent stem cells (ESCs) stably expressing orthogonal translation systems.

[0066] The two plasmids constructed in step 1, along with the transposase plasmid (Super PiggyBac Transposase, from Yunbio), were transiently transfected into H9 ESC cells. Selection was performed by adding 200 μg / mL G418 and 2 μg / mL Puromycin antibiotic to obtain cells stably expressing the orthogonal translation system MmPylRS / tRNA and *ETV2. 122TAG H9 MmPylRS / *ETV2 And then carry out amplification culture, the process is as follows Figure 3 As shown.

[0067] Figure 3 A schematic diagram illustrating the process of constructing an orthogonal translation system for stem cell lines for the implementation of this application.

[0068] Step 3: Development and differentiation of vascularized liver organoids

[0069] Continue to refer to Figure 1 The process involves submitting data to the ESC on days 0-3. MmPyl / *ETV2 Cells were induced to differentiate into directed endoderm cells by adding a first differentiation medium containing Activin A and BMP4, expressing SOX17 and FOXA2 markers. From day 4 to 6, a second differentiation medium containing FGF4 and CHIR99021 was added to induce endoderm differentiation into foregut cells. Simultaneously, 1 mM of the small molecule switch NAEK was added to regulate ETV2. 122*Full-length protein expression was observed. During foregut cell differentiation, NAEK regulates the transdifferentiation of some cells into endothelial cells, thereby regulating the formation of vascularized liver organoids. On day 6, NAEK was removed, foregut cells were embedded in Matrigel, and a third differentiation medium containing RA was added. After 4 days of culture, foregut spheroids formed. From days 10 to 20, a fourth differentiation medium containing OSM, HGF, and DEX was added to induce the formation of vascularized liver organoids. Vascularized liver organoids could be cultured for more than 30 days.

[0070] Figure 4 This is a diagram showing the results of RT-qPCR detection of gene expression in germ layer cells on day 3 of differentiation, as described in this application. Figure 5 This is a diagram showing the results of RT-qPCR detection of gene expression in foregut cells on day 6 of differentiation, as described in this application.

[0071] RT-qPCR was used to detect the regulation of endoderm cell differentiation 3 days after NAEK addition, including the expression of stemness genes (NANOG, OCT4) and endoderm genes (SOX17, FOXA2). Figure 4 It can be seen that after adding NAEK for 3 days, the expression of NANOG and OCT4 decreased, while the expression of SOX17 and FOXA2 was significantly high, indicating the differentiation of the endoderm.

[0072] RT-qPCR was used to detect the expression of NAEK-regulated endoderm and foregut cell differentiation at different time points, including stemness genes (NANOG, OCT4), vascular endothelial genes (CD31), and foregut cell genes (ALB, PDX1, CDX2). Figure 5 It can be seen that, compared with the addition of NAEK on days 0-6, the addition of NAEK on days 4-6 can induce significantly high expression of CD31, CDX2 and ALB.

[0073] Example 2 Functional characterization of vascularized liver organoids

[0074] According to the method for constructing vascularized liver organoids in Example 1, liver organoids were identified at specific stages.

[0075] Frozen sections of vascularized liver organoids developed for 30 days were prepared and immunofluorescence assays were performed. The results are as follows: Figure 6-8 As shown.

[0076] Figure 6 This is a diagram showing the developmental and differentiation results of vascularized liver organoids after 30 days of development in this application embodiment. Figure 6 As can be seen, the vascularized liver organoids exhibit a distinct lumen-like epithelial structure and highly express CD31+ vascular endothelial cells and ALB. + Hepatocytes.

[0077] Figure 7 This is a vascular structure distribution map of the vascularized liver organoid on day 30 in this embodiment of the application. Figure 7 It can be seen that the liver organoids exhibit a continuous distribution of luminous vascular structures.

[0078] Figure 8 This is a diagram showing the differentiation results of hepatic stellate cells and Kupffer cells in vascularized liver organoids and the control group on day 30 in the embodiments of this application. Figure 8 It can be seen that vascularized liver organoids show high expression of CD68. + Kupffer cells, and hepatic stellate cells containing Vimentin+.

[0079] Figure 9 This image shows the results of RT-qPCR detection of gene expression in vascularized liver organoids on day 30, according to an embodiment of this application. The gene expression includes: vascular endothelial genes (A), hepatocyte genes (B), bile duct epithelial cell genes (C), Kupffer cell genes (D), and hepatic stellate cell genes (E). Figure 9 As can be seen from the RT-qPCR results, compared with the control group, vascularized liver organoids highly expressed vascular endothelial cell gene (CD31), hepatocyte gene (ALB), and Kupffer cell gene (CD68).

[0080] The method for constructing vascularized liver organoids provided in this application has the following advantages: 1) It expands the translation system of eukaryotes, realizing near-physiological level protein translation regulation; 2) Non-natural amino acids can be introduced into target proteins site-specifically, with minimal disturbance to protein structure; 3) It directly regulates protein expression at the translational level, with rapid regulation speed; 4) Compared with drug regulation (such as DOX), gene codon expansion technology can rapidly turn protein expression on / off; 5) Liver organoids regulated based on gene codon expansion technology have rich vascular networks and Kupffer cells, exhibiting mature liver function.

[0081] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of this application. It should be understood that the above descriptions are merely specific embodiments of this application and are not intended to limit this application. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A method for constructing vascularized liver organoids, comprising: Multiple vectors from the transposon vector plasmid kit were transfected into pluripotent stem cells to obtain stem cell lines that could regulate ETV2 gene expression. The transposon vector plasmid kit could regulate ETV2 gene expression through non-natural amino acids. The addition of the non-natural amino acids and liver-inducing culture medium induces the differentiation of the stem cell line and regulates ETV2. 122* Full-length protein expression yielded vascularized liver organoids.

2. The method according to claim 1, wherein, The non-natural amino acid is NAEK; NAEK was added on days 0-6 of liver organoid development, and the concentration of NAEK in the culture medium was maintained at 0.1-1 mM. The pluripotent stem cells are iPS cells or ESC cells.

3. The method according to claim 1, wherein, The liver induction medium includes a first differentiation medium containing ActivinA and BMP4, and a second differentiation medium containing FGF4 and CHIR99021; Pluripotent stem cells were cultured in a first differentiation medium to obtain a directed endoderm, wherein the directed endoderm expressed the biomarkers SOX17 and FOXA2; The oriented endoderm was cultured in a second differentiation medium to obtain foregut cells, wherein the foregut cells expressed ALB, PDX1 and CDX2 markers.

4. The method according to claim 1 or 3, wherein, The liver induction medium includes a third differentiation medium containing RA; The liver induction medium includes a fourth differentiation medium containing OSM, HGF and DEX; Foregut cells were cultured in a third differentiation medium to obtain foregut spheroids; Foregut spheroids were cultured in fourth differentiation medium to obtain vascularized liver organoids, wherein the vascularized liver organoids expressed markers of vascular endothelial cells (CD31), hepatocytes (ALB), hepatic stellate cells (Vimentin), and Kupffer cells (CD68).

5. The method according to claim 1, wherein, The transposable vector plasmid kit includes: The nucleotide sequence of tRNA and the nucleotide sequence of aminoacyl-tRNA synthetase, wherein the anticodon of tRNA is paired with a stop codon; and the ETV2 gene mutant, wherein the ETV2 gene mutant has the following mutation relative to the wild-type ETV2 gene: the codon at amino acid position 122 of the ETV2 gene is mutated to a stop codon. The aminoacyl-tRNA synthetase is capable of binding non-natural amino acids to tRNA.

6. The method according to claim 5, wherein, The tRNA nucleotide sequence and the aminoacyl-tRNA synthetase nucleotide sequence are located on the same or different vectors, and the ETV2 gene mutant is located on a different vector from the tRNA nucleotide sequence and / or the aminoacyl-tRNA synthetase nucleotide sequence.

7. The method according to claim 5 or 6, wherein, The tRNA is a pyrrolidone tRNA. Pyl The sequence is shown in SEQ ID No. 1; The aminoacyl-tRNA synthetase is pyrrololysyl-tRNA synthetase MmPylRS from Methanococcus martensii, with the sequence shown in SEQ ID No.

2.

8. The method according to claim 6, wherein, The carrier is a PiggyBac transposable carrier; The transposable vector plasmid kit specifically includes: PiggyBac-(7sk-tRNA Pyl )×4-EF1a-MmPylR plasmid, and PiggyBac-ETV2 122* plasmid, of which ETV2 122* This indicates the ETV2 gene, where the amino acid at position 122 is mutated into a stop codon.

9. The method according to claim 5, wherein, The stop codon for the mutation at amino acid position 122 is TAG, TAA, or TGA.

10. Vascularized liver organoids, obtained by the method described in any one of claims 1 to 9.

Images