Novel GSPT1 degradation agent and application thereof
By modifying the benzenesulfonamide ring of the IMiD compound with specific substituents, the compound structure was optimized, solving the problems of unsustainable degradation and pH instability of GSPT1 in the prior art, and achieving effective treatment for neuroendocrine phenotype cancer.
Patent Information
- Application Number
- CN202480025398.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-04-13
- Filing Date
- 2024-04-12
- Publication Date
- 2025-11-21
AI Technical Summary
Existing IMiD-based compounds suffer from insufficient persistence and pH stability when degrading GSPT1, resulting in short-lived anticancer effects and insufficient safety, especially poor therapeutic effects on neuroendocrine phenotype cancers.
By modifying the benzenesulfonamide ring of IMiD compounds with specific substituents, the compound structure was optimized to improve pH stability and selective GSPT1 degradation activity. Compounds of Formula I and their derivatives, including stereoisomers, hydrates, solvates or pharmaceutically acceptable salts, were designed.
It achieved high selectivity and sustained degradation activity against GSPT1, improved the pH stability of the compound and its safety to normal cells, and significantly enhanced its anticancer activity against neuroendocrine phenotype cancers such as small cell lung cancer, pulmonary neuroendocrine carcinoma and neuroendocrine prostate cancer.
Smart Images

Figure CN121002006A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a novel GSPT1 degrader and its uses. Specifically, this invention relates to compounds of formula I, their stereoisomers, hydrates, solvates, or pharmaceutically acceptable salts; pharmaceutical compositions comprising the compound for treating uncontrolled cell proliferation diseases; and methods for treating uncontrolled cell proliferation diseases by administering the compound to mammals. Background Technology
[0002] Traditional drug development strategies involve directly regulating protein activity by binding drugs to specific active sites of disease-related proteins such as enzymes, receptors, neurotransmitters, and membrane proteins. Therefore, due to the lack of docking pocket structures, nucleus transcription factors, scaffold proteins, and aggregates remain unsuitable targets for drug development. According to the Human Protein Atlas database, only about 15% of the approximately 4,500 known disease-related proteins have FDA-approved drugs.
[0003] To overcome these limitations of traditional drug development strategies, research has been actively conducted on targeted protein degradation technologies for targets that are difficult to develop drugs.
[0004] Targeted protein degradation technology aims to treat diseases by utilizing the body's existing protein degradation systems to remove disease-related proteins. Intracellular protein degradation is accomplished by lysosomes and proteasomes, with approximately 80% of cellular proteins being ubiquitinated via the ubiquitin-proteasome system (UPS) before being degraded by the proteasome.
[0005] Ubiquitin is a protein composed of 76 amino acids. E1, E2, and E3 ubiquitin ligases participate in the UPS-mediated protein ubiquitination labeling process. The labeled protein is degraded by the 26S proteasome, which is an ATP-dependent protein-degrading enzyme complex. The E3 ubiquitin ligase binds to the E2 ligase and the substrate protein, and is responsible for recognizing ubiquitin-labeled substrate proteins.
[0006] Drugs based on the TPD strategy can be categorized into PROTACs (protein degradation-targeting chimeras) and molecular glues according to their compound structures. PROTACs are heterobifunctional compounds in which the ligand of the E3 ligase, a component of the UPS (protein ligase-targeting complex), is linked to the ligand of the target protein via a linker. On the other hand, molecular glues utilize the property of small molecule compounds to induce the formation of specific protein complexes, promoting the interaction between the target protein and the E3 ligase involved in protein degradation, thereby achieving target protein degradation. The molecular weight of molecular glues is much lower than that of PROTACs, thus facilitating the development of therapeutic agents with excellent pharmacokinetic properties.
[0007] Previous studies have shown that immunomodulatory imides (IMiDs), including thalidomide, lenalidomide, and pomalidomide, can bind to cereblon (CRBN), the substrate receptor of CRL4 E3 ubiquitin ligase (Ito et al., Science 327: 1345-1350 (2010)). It has been reported that IMiD binding to CRBN forms a new interface, leading to novel interactions between CRBN and Ikaros (IKZF1) and Aiolos (IKZF3), thereby inducing CRBN-dependent ubiquitination by IMiD drugs, which in turn leads to protein degradation of Ikaros and Aiolos (Kronke et al., Science 343: 301-305 (2014); Lu et al., Science 343: 305-309 (2014)).
[0008] Meanwhile, international publication WO2022 / 066835 discloses an IMiD-based compound that selectively degrades GSPT1 compared to Ikaros and Aiolos. However, this literature lacks research on the properties necessary for the successful development of anticancer drugs, such as the compound's persistence, safety, and stability in degrading GSPT1. Summary of the Invention
[0009] Technical issues
[0010] Therefore, through extensive characterization studies of IMiD-based compounds, the inventors discovered that when specific substituents are present at various positions of the benzenesulfonamide ring bound to the pomalidomide structure, the persistence of GSPT1 degradation, pH stability, anticancer efficacy, and safety are significantly improved, and excellent anticancer efficacy can be achieved against cancers with a neuroendocrine phenotype.
[0011] Solution to the problem
[0012] In one aspect of the invention, compounds of formula I, stereoisomers thereof, hydrates, solvates or pharmaceutically acceptable salts thereof are provided:
[0013] [Formula I]
[0014]
[0015] In equation I,
[0016] R 1 It is a halogen, a C1-C6 alkyl, a C1-C6 alkoxy, a C1-C6 haloalkyl, or a C1-C6 haloalkoxy;
[0017] R 2 For optional use by R2a Substituted C1-C6 alkyl groups;
[0018] R 2a It can be hydroxyl, halogen, C1-C6 alkoxy, C1-C6 haloalkoxy or -NR'R'';
[0019] R' and R'' are each hydrogen or C1-C6 alkyl, or R' and R'' may form a 3- to 8-membered heterocycle, optionally containing an additional heteroatom selected from N, O, and S, together with the nitrogen atom to which they are attached; and
[0020] R 3 It is hydrogen or halogen.
[0021] In another aspect of the invention, a pharmaceutical composition for treating uncontrolled cell proliferation diseases in mammals is provided, comprising a compound of formula I, its stereoisomers, hydrates, solvates, or pharmaceutically acceptable salts.
[0022] In another aspect of the invention, a method for modulating cereblon activity or GSPT1 activity in at least one cell is provided, comprising contacting the at least one cell in vitro with a compound of formula I, its stereoisomers, hydrates, solvates or pharmaceutically acceptable salts.
[0023] In another aspect of the invention, a method for treating uncontrolled cell proliferation diseases in mammals is provided, comprising administering to a mammal a compound of formula I, a stereoisomer thereof, a hydrate, a solvate, or a pharmaceutically acceptable salt thereof.
[0024] Invention Effects
[0025] The compounds of this invention exhibit high selectivity and sustained degradation activity against GSPT1, excellent pH stability, and low cytotoxicity to normal cells, thus demonstrating excellent anticancer efficacy and a high therapeutic index. Furthermore, the compounds of this invention show excellent anticancer activity against cancers with a neuroendocrine phenotype, such as small cell lung cancer (SCLC), pulmonary neuroendocrine carcinoma (NEC), and neuroendocrine prostate cancer (NEPC). Attached Figure Description
[0026] Figure 1 The results show the GSPT1 degradation activity of reference compound 1 and example compounds against various new substrates by concentration determination.
[0027] Figure 2 The results show the changes in GSPT1 expression levels over time after treatment with reference compound 1 and the example compound (100 nM).
[0028] Figure 3The results of real-time measurement of cancer cell (NCI-H1155 cells) proliferation after treatment with reference compound 1 and the compound of example are shown.
[0029] Figure 4 The results of TMT-labeled proteomics analysis after treating the HL60 cell line with the compounds of the examples are shown.
[0030] Figure 5 The results show the changes in GSPT1 expression level and protein translation rate over time after treating NCI-H1155 cells with 1 μM compound 3.
[0031] Figure 6 The results of treating NCI-H1155 cells with 1 μM compound 3 and observing the changes in GSPT1 expression level, N-MYC expression level and protein translation rate over time are shown (left panel); and the results of measuring the changes in GSPT1, N-MYC and ATF-4 expression levels and caspase 3 activation over time are shown (right panel).
[0032] Figure 7 The results show the changes over time in GSPT1 expression level, ATF-4 expression level, and caspase 3 activation after treatment of HL60 cells with 0.3 μM compound 3.
[0033] Figure 8 The results show the changes in GSPT1 expression level and protein translation rate over time after treating NCI-H2023 cells with 1 μM reference compound 1 and compound 3.
[0034] Figure 9a The results of cell viability measurements after treating various small cell lung cancer (SCLC) and lung adenocarcinoma (LUAD) cell lines with compounds 3 and 4 are shown.
[0035] Figure 9b Compounds 3 and 4 were shown to inhibit the activity of EC in lung adenocarcinoma (LUAD), small cell lung cancer (SCLC), pulmonary neuroendocrine carcinoma (NEC), and neuroendocrine prostate cancer (NEPC) cell lines. 50 Calculation results.
[0036] Figure 10 The therapeutic index (TI) of each compound is shown, calculated based on the cell viability of reference compounds 1, 3, and 4 as measured in NCI-H1155, HL60, and HeKa cells.
[0037] Figure 11 shows the bioluminescence intensity after administration of compound 3 in the HL-60-Luc AML animal model ( Figure 11a ) and weight ( Figure 11b The result of changes over time.
[0038] Figure 12a The results show the expression levels of GSPT1 and N-MYC observed at 6 and 24 hours after administration of compound 4 in the NCI-H1155 lung cancer animal model. Figure 12a ); and the results of measuring tumor volume changes over time after administration of compound 4 ( Figure 12b ).
[0039] Figure 13 shows the tumor volume after administration of compound 3 at different dosages and administration cycles. Figure 13a ) and weight ( Figure 13b Measurement results that change over time. Detailed Implementation
[0040] The present invention will be described in more detail below.
[0041] The descriptions and embodiments disclosed herein are also applicable to other descriptions and embodiments. That is, all combinations of the various elements disclosed herein fall within the scope of this application. Furthermore, the scope of this application should not be construed as limited by the specific descriptions below.
[0042] In one aspect of the invention, compounds of formula I, stereoisomers thereof, hydrates, solvates or pharmaceutically acceptable salts thereof are provided:
[0043] [Formula I]
[0044]
[0045] In equation I,
[0046] R 1 It is a halogen, a C1-C6 alkyl, a C1-C6 alkoxy, a C1-C6 haloalkyl, or a C1-C6 haloalkoxy;
[0047] R 2 For optional use by R 2a Substituted C1-C6 alkyl groups;
[0048] R 2a It can be hydroxyl, halogen, C1-C6 alkoxy, C1-C6 haloalkoxy or -NR'R'';
[0049] R' and R'' are each hydrogen or C1-C6 alkyl, or R' and R'' may form a 3- to 8-membered heterocycle, optionally containing an additional heteroatom selected from N, O, and S, together with the nitrogen atom to which they are attached; and
[0050] R 3 It is hydrogen or halogen.
[0051] In equation I above, R 1 It is a halogen, a C1-C6 alkyl, a C1-C6 alkoxy, a C1-C6 haloalkyl, or a C1-C6 haloalkoxy. In one embodiment, R... 1 It is a halogen, a C1-C3 alkyl, a C1-C3 alkoxy, a C1-C3 haloalkyl, or a C1-C3 haloalkoxy. In one embodiment, R... 1 It can be halogen, C1-C6 alkyl, C1-C6 haloalkyl, or C1-C6 haloalkoxy. In one embodiment, R 1 It can be halogen, C1-C3 alkyl, C1-C3 haloalkyl, or C1-C3 haloalkoxy. In one embodiment, R 1 It can be halogenated or C1-C6 alkyl. In one embodiment, R 1 It can be halogenated or C1-C3 alkyl. In one embodiment, R 1 It can be a halogen (F, Cl, Br, or I). For example, R 1 Including, but not limited to, F, Cl, Br, I, -OCH2F, -OCHF2, -OCF3, -CH2F, -CHF2, -CF3 or -CH3.
[0052] In equation I above, R 2 It is a C1-C6 alkyl group or composed of R 2a Substituted C1-C6 alkyl group. In one embodiment, R 2 It can be a C1-C6 alkyl group. In one embodiment, R 2 It can be a C1-C3 alkyl group. In one embodiment, R 2 It can be made by R 2a Substituted C1-C6 alkyl group. In one embodiment, R 2 It can be made by R 2a Substituted C1-C3 alkyl groups. In this case, R 2a It can be hydroxyl, halogen, C1-C6 alkoxy, or C1-C6 haloalkoxy. In one embodiment, R 2a It can be hydroxyl, halogen, C1-C3 alkoxy, or C1-C3 haloalkoxy. In one embodiment, R 2a It can be a hydroxyl or C1-C6 haloalkoxy group. In one embodiment, R 2a It can be a hydroxyl or C1-C3 haloalkoxy group. For example, R 2 Including, but not limited to, -CH3, -CH2CH3, -CH2OCF3, -CH2OCHF2, -CH2OCH2F, -CH2OH or -CH2CH2OH.
[0053] Or, R 2 It can be made by R2a Substituted C1-C6 alkyl groups, and R 2a It can be -NR'R''. In one implementation, R 2 It can be made by R 2a Substituted C1-C3 alkyl groups. R' and R'' may each be hydrogen or C1-C6 alkyl. In one embodiment, R' and R'' may each be hydrogen or C1-C3 alkyl.
[0054] Furthermore, the R' and R'' may form a 3- to 8-membered heterocycle, optionally containing an additional heteroatom selected from N, O, and S, together with the nitrogen atom to which they are attached. In one embodiment, the R' and R'' may form a morpholine ring, a thiomorpholine ring, a piperazine ring, or a piperidine ring together with the nitrogen atom to which they are attached.
[0055] For example, R 2 It includes, but is not limited to, -CH2-morpholino, -CH2-CH2-morpholino, -CH2-NH2, -CH2-NH(CH3), -CH2-N(CH3)2, -CH2CH2-NH2, -CH2-CH2NH(CH3) or -CH2-CH2-N(CH3)2.
[0056] In equation I above, R 3 It is hydrogen or halogen. In one embodiment, R... 3 It is hydrogen. In one implementation, R 3 It is a halogen. For example, R 3 It can be F, Cl, Br, or I. For example, R 3 It can be F.
[0057] The inventors have discovered that the compounds disclosed in prior art literature (WO2022 / 066835) fail to exhibit sustained GSPT1 degradation efficacy. Within a short period after treatment, such as 48 hours, GSPT1 expression levels recover, and previously suppressed tumor cells regrow. Without being bound by theoretical limitations, the inventors have found that the compounds disclosed in the prior art literature are unstable at physiological pH (pH 7), and they believe that this pH instability is one of the reasons why the GSPT1 degradation and tumor-suppressive activities of the aforementioned compounds are only transient.
[0058] Therefore, in order to obtain compounds with improved pH stability, exhibiting sustained and selective GSPT1 degradation activity and excellent tumor proliferation inhibitory activity, the inventors conducted extensive studies on the properties of compounds combining benzenesulfonamide and pomalidomide structures through structural modification. The results showed that, based on the binding position of the sulfonamide group, compounds having an alkyl group at the meta position or an alkyl group substituted with a specific substituent exhibited excellent pH stability, sustained and selective GSPT1 degradation activity, and excellent tumor proliferation inhibitory activity. In particular, the inventors found that, in addition to the aforementioned meta-substitution, compounds having a halogen or optionally halogen-substituted alkyl or alkoxy group at the adjacent ortho position, and being unsubstituted or halogen-substituted (preferably F) at the adjacent para position, exhibited significantly improved properties in terms of pH stability, GSPT1 degradation activity, and tumor proliferation inhibitory activity.
[0059] In one embodiment, the compound of formula I of the present invention may have the following combination of substituents:
[0060] R 1 It is a halogen, a C1-C6 alkyl, a C1-C6 haloalkyl, or a C1-C6 haloalkoxy.
[0061] R 2 For optional use by R 2a Substituted C1-C6 alkyl groups;
[0062] R 2a It is a hydroxyl or C1-C6 haloalkoxy group; and
[0063] R 3 It is hydrogen or halogen.
[0064] In one embodiment, the compound of formula I of the present invention may have the following combination of substituents:
[0065] R 1 It is a halogen or a C1-C6 alkyl group;
[0066] R 2 It is a C1-C6 alkyl group; and
[0067] R 3 It is hydrogen or halogen.
[0068] For example, in equation I above, R 1 It can be halogen or C1-C3 alkyl; R 2 It can be a C1-C3 alkyl group; and R 3 It can be hydrogen or halogen. For example, in formula I above, R 1 It can be F, Cl, Br, I, -CH3 or -CH2CH3; R 2 It can be -CH3 or -CH2CH3; and R 3 It can be hydrogen or F.
[0069] In one embodiment, the compound of formula I of the present invention may have the following combination of substituents:
[0070] R 1 It is a C1-C6 haloalkyl or C1-C6 haloalkoxy;
[0071] R 2 It is a C1-C6 alkyl group; and
[0072] R 3 It is hydrogen or halogen.
[0073] For example, in equation I above, R 1 It can be a C1-C3 haloalkyl or C1-C3 haloalkoxy; R 2 It can be a C1-C3 alkyl group; and R 3 It can be hydrogen or halogen. For example, in formula I above, R 1 It can be -OCH2F, -OCHF2, -OCF3, -CH2F, -CHF2, or -CF3; R 2 It can be -CH3 or -CH2CH3; and R 3 It can be hydrogen or F.
[0074] In one embodiment, the compound of formula I of the present invention may have the following combination of substituents:
[0075] R 1 It is a halogen;
[0076] R 2 For optional use by R 2a Substituted C1-C6 alkyl groups;
[0077] R 2a It is a hydroxyl or C1-C6 haloalkoxy group; and
[0078] R 3 It is hydrogen.
[0079] For example, in equation I above, R 1 It can be halogen; R 2 It may be a C1-C3 alkyl group optionally substituted with a hydroxyl group or a C1-C3 haloalkoxy group; and R 3 It can be hydrogen. For example, in equation I above, R 1 It can be Cl, Br, or I; and R 2 It can be -CH2OCHF2, -CH2OCH2F, -CH2OH or -CH2CH2OH.
[0080] In one embodiment, in the compound of formula I of the present invention, R 1 It can be halogen, R 2It can be a C1-C6 alkyl group, and R 3 It can be hydrogen. For example, in equation I above, R 1 It can be Cl, Br, or I; R 2 It can be a C1-C3 alkyl group, such as methyl or ethyl; and R 3 It can be hydrogen.
[0081] In one embodiment, the compound of formula I of the present invention has the following combination of substituents:
[0082] R 1 It is a halogen;
[0083] R 2 It is a C1-C6 alkyl group substituted by NR'R'';
[0084] R' and R'' are each hydrogen, C1-C6 alkyl, or C1-C3 alkyl; and
[0085] R 3 It is hydrogen.
[0086] For example, in the compound of formula I of the present invention, R 1 It can be a halogen (e.g., Cl); R 2 It can be methylaminomethyl; and R 3 It can be hydrogen.
[0087] In one embodiment, the compound of formula I of the present invention may have the following combination of substituents:
[0088] R 1 It is a halogen;
[0089] R 2 It is a C1-C6 alkyl group substituted by NR'R'';
[0090] R' and R'' can form, together with the nitrogen atom to which they are attached, 3 to 8-membered heterocycles optionally containing an additional heteroatom selected from N, O, and S; and
[0091] R 3 It is hydrogen.
[0092] In one embodiment, the compound of formula I of the present invention may have the following combination of substituents:
[0093] R 1 It is a halogen;
[0094] R 2 It is a C1-C6 alkyl group substituted by NR'R'';
[0095] R' and R'' can form morpholine, thiomorpholine, piperazine, or piperidine rings together with the nitrogen atoms they are attached to; and
[0096] R 3 It is hydrogen.
[0097] For example, in the compound of formula I of the present invention, R 1 It can be a halogen (e.g., Cl); R 2 It can be morpholinomethyl; and R 3 It can be hydrogen.
[0098] For the above R 1 R 2 and R 3 The combination, previously targeted at R 1 R 2 and R 3 The specific examples described for each of them also apply.
[0099] Compound of formula I may be any of the compounds represented by the following formulas:
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109] .
[0110] In one embodiment, the compound of formula I of the present invention may be a compound having any of the following structures:
[0111]
[0112]
[0113] .
[0114] definition
[0115] All technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art, unless otherwise stated. They are based on conventional techniques such as pharmacology, medicinal chemistry, mass spectrometry, NMR, HPLC, and biochemistry, using conventional measurement methods, manufacturing methods, and conventional ingredients or substances.
[0116] Without departing from the scope or spirit of the invention, the individual features and components of the various embodiments described and illustrated herein may be combined with the features and components of any other embodiment.
[0117] Unless otherwise stated, in this specification and the appended claims, "or" and "and" mean "and / or". The terms "comprising" and "including" are open-ended terms, meaning that a compound, composition, or method may include other features or components in addition to the specific features or components listed.
[0118] In this specification, the numerical range referred to by the term "to" means the range consisting of the values mentioned before and after the term "to" as the lower limit and upper limit, respectively.
[0119] As used herein, the terms “optional” or “optionally” mean that an event or situation described below may or may not occur, and the description includes instances where the event or situation occurs and instances where it does not occur. For example, the term “optional substitution” means either no substitution or substitution by a specified substituent.
[0120] compound
[0121] As used herein, unless otherwise stated, the term "alkyl" whether used alone or as part of a substituent refers to a saturated straight-chain or branched carbon chain having 1 to 6 carbon atoms, 1 to 4 carbon atoms, or 1 to 3 carbon atoms. Non-limiting examples of alkyl groups include methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, etc.
[0122] The term "alkoxy" refers to -O-alkyl. Non-limiting examples of alkoxy groups include methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, sec-butoxy, isobutoxy, tert-butoxy, etc.
[0123] The term "heteroatom" refers to nitrogen, oxygen, or sulfur, including any oxidized form of nitrogen, such as N(O)(N). + -O -); any oxidized form of sulfur, such as S(O) and S(O)2; and any basic quaternized form of nitrogen.
[0124] The terms "heterocyclic alkyl," "heterocycle," or "heterocyclic group" refer to a saturated or partially unsaturated cyclic group containing one or more heteroatoms and whose remaining ring atoms are carbon. Heterocyclic alkyl groups may contain, for example, one or two heteroatoms. They may contain 3 to 8 ring atoms, 5 to 7 ring atoms, or 5 or 6 ring atoms. Heterocyclic alkyl groups include, but are not limited to, morpholino, thiomorpholino, piperazine, piperidinyl, pyrrolidinyl, and azacyclic butyl.
[0125] The term "oxo" refers to the (=O) group.
[0126] As used in this article, the term "halogen" refers to an atom belonging to Group 17 of the periodic table. Halogen atoms include fluorine, chlorine, bromine, iodine, etc., and are used interchangeably with the term "halogenated," which refers to a monovalent functional group composed of halogens.
[0127] As used in this article, the term "hydroxyl group" refers to the -OH functional group (hydroxyl group).
[0128] As used in this article, the term "amino" refers to -NH2.
[0129] As used herein, the term "alkylamino" refers to an amino group in which one of the two hydrogen atoms is replaced by an alkyl group. Examples of alkylamino groups include, but are not limited to, methylamino, ethylamino, and propylamino.
[0130] As used herein, the term "dialkylamino" refers to -N(alkyl)2. In this case, the two alkyl groups may be the same as or different from each other. Examples of dialkylamino substituents include, but are not limited to, dimethylamino, diethylamino, ethylmethylamino, and dipropylamino.
[0131] As used herein, the term "haloalkyl" refers to an alkyl group substituted with one or more halogen atoms. The halogens may be the same (e.g., CHF2, -CF3) or different (e.g., CF2Cl). When specifically described, a haloalkyl group may optionally be substituted with one or more substituents other than a halogen. Examples of haloalkyl groups may include, but are not limited to, fluoromethyl, dichloroethyl, trifluoromethyl, trichloromethyl, pentafluoroethyl, and pentachloroethyl.
[0132] As used herein, the term "haloalkoxy" refers to an alkoxy group substituted with one or more halogen atoms, wherein the alkoxy group is as defined above. Non-limiting examples of haloalkoxy groups may include fluoromethoxy, dichloroethoxy, trifluoromethoxy, trichloromethoxy, etc.
[0133] As used herein, the term "hydroxyalkyl" refers to an alkyl group substituted with one or more -OH groups, wherein the alkyl group is as defined above.
[0134] In this specification, " The symbols “,”, “*,” or “-” are used to indicate the position where a substituent is bonded to the remainder of the compound. For example, if a substituent is marked with a “-” at the end, it indicates that the end is attached to the remainder of the compound. Furthermore, when two or more substituents are connected by a “-”, it indicates that the substituent immediately preceding the “-” is bonded to the substituted atom of the substituent immediately following the “-.”
[0135] As used herein, the term "solvent" can refer to a compound of the present invention or a salt thereof comprising a stoichiometric or non-stoichiometric solvent bound by non-covalent intermolecular forces. Preferred solvents may be volatile, non-toxic, and / or suitable for human use. The solvent may be water, in which case the "solvent" is referred to as a "hydrate." Compounds of the present invention can exist as hydrates, which can be obtained, for example, by crystallization from a solvent or aqueous solution. In this respect, one, two, three, or any number of solvent or water molecules may combine with compounds of the present invention to form solvates and hydrates. Unless otherwise stated, the present invention includes all such possible solvates.
[0136] Furthermore, the compounds of the present invention can exist in different crystalline polymorphic forms, which makes some variants potentially metastable. Unless otherwise stated, the compounds of the present invention include all of these possible polymorphic forms.
[0137] As used herein, the term "stereoisomer" can refer to the compound of the present invention or its salt having the same chemical formula or molecular formula but different optically or spatially, specifically diastereomers, enantiomers or geometric isomers.
[0138] In some embodiments, the compounds of the present invention contain one or more asymmetric centers and may be in the form of racemic mixtures, single enantiomers, mixtures of enantiomers, single diastereomers, mixtures of diastereomers, etc. In one embodiment, due to the nature or rotational limitation of the asymmetric centers, the compounds of the present invention may exist in the form of enantiomers or diastereomers.
[0139] When the compounds of this invention contain two or more asymmetric centers, various diastereomers and enantiomers of the chemical structures disclosed herein may exist. Pure isomers, isolated isomers, partially pure isomers, or racemic mixtures are all intended to fall within the scope of this invention.
[0140] Purification of isomers and separation of mixtures of isomers can be achieved using standard techniques known in the art. For example, a mixture of diastereomers can be separated into their respective diastereomers by chromatography or crystallization, and racemic mixtures can be separated into their respective enantiomers by chromatography or chiral resolution.
[0141] The compounds of the present invention may be used in the form of pharmaceutically acceptable salts derived from acids or bases.
[0142] The term "pharmaceutically acceptable salt" refers to a salt of an active pharmaceutical ingredient prepared with an acid or base that is tolerated by the biological system or by the subject, or by both the biological system and the subject, when administered in a therapeutically effective amount. When the compounds of the present invention contain relatively acidic functional groups, a base addition salt can be obtained by contacting the neutral form of the compound with a sufficient amount of the desired base in a pure solvent or a suitable inert solvent. Examples of pharmaceutically acceptable base addition salts include, but are not limited to, sodium, potassium, calcium, ammonium, organic amine, magnesium, lithium, strontium, or similar salts.
[0143] When the compounds of the present invention contain relatively basic functional groups, acid addition salts can be obtained by contacting the neutral form of the compound with a sufficient amount of the desired acid in a pure solvent or a suitable inert solvent. Examples of pharmaceutically acceptable acid addition salts include, but are not limited to, salts derived from inorganic acids such as hydrochloric acid, hydrobromic acid, nitric acid, carbonic acid, monohydrocarbonic acid, phosphoric acid, monohydrophosphoric acid, dihydrophosphoric acid, sulfuric acid, monohydrosulfuric acid, hydroiodic acid, and phosphorous acid, as well as salts derived from relatively non-toxic organic acids such as acetic acid, propionic acid, isobutyric acid, maleic acid, malonic acid, benzoic acid, succinic acid, octanoic acid, fumaric acid, lactic acid, mandelic acid, phthalic acid, benzenesulfonic acid, p-toluenesulfonic acid, citric acid, tartaric acid, and methanesulfonic acid. Furthermore, amino acid salts, such as alginates, and organic acid salts, such as glucuronides or galacturonic acids, are also included.
[0144] Preparation methods of compounds
[0145] The compounds of the present invention can be readily prepared from commercially available starting materials, compounds known in the literature, or intermediates that are readily prepared therefrom, by standard synthetic methods and procedures in the relevant field.
[0146] The methods described herein can be monitored using any suitable method known in the art. For example, product formation can be monitored by spectroscopic means, such as nuclear magnetic resonance spectroscopy (e.g., 1 H or 13 C) Infrared spectroscopy, spectrophotometry (e.g., ultraviolet-visible), mass spectrometry, or chromatography, such as high performance liquid chromatography (HPLC), gas chromatography (GC), gel permeation chromatography (GPC), or thin-layer chromatography (TLC).
[0147] The following general reaction schemes summarize representative methods for preparing compounds of formula I. Based on the preparation methods specifically disclosed in the examples herein, those skilled in the art can easily prepare compounds of formula I by appropriately selecting starting materials, reaction temperatures, reaction conditions, catalysts, solvents, processing methods, etc., suitable for the target compound. In the following, unless otherwise specified, the names of the substituents in formula I in the reaction schemes are the same as the names of the substituents at the corresponding positions in formula I.
[0148] In one aspect, the compound of formula I of the present invention can be produced by making R 1 R 2 and R 3 It is prepared by reacting a substituted benzenesulfonyl chloride compound, as shown in reaction scheme A below:
[0149] [Reaction Scheme A]
[0150]
[0151]
[0152] Substituent R of compound of formula I 1 R 2 and R 3 The corresponding R 1 R 2 and R 3 The ultimate target benzenesulfonyl chloride compound to be substituted can be purchased as a commercially available compound or can be readily prepared based on known techniques in the field of medicinal chemistry and the examples described herein.
[0153] In step 1, the benzenesulfonyl chloride compound is reacted with dimethyl 4-aminobenzene-1,2-dicarboxylate in the presence of a suitable solvent (e.g., pyridine) at a suitable temperature (e.g., 20°C to 30°C, e.g., about 25°C) for a period of time (e.g., about 1 hour).
[0154] In step 2, the dicarboxylate compound obtained in step 1 is hydrolyzed with LiOH in a suitable solvent (e.g., a mixed solution of THF, MeOH, and water) to give the phthalic acid compound. This reaction can be carried out at a suitable temperature (e.g., from about 20°C to about 80°C, or about 50°C) for a suitable time (e.g., from about 8 hours to about 15 hours, or about 12 hours).
[0155] In step 3, the phthalic acid compound obtained in step 2 is reacted with 3-aminopiperidine-2,6-dione or a suitable salt thereof (e.g., an HCl salt) in the presence of a suitable solvent and reagent (e.g., acetic acid and sodium acetate) to give compound I. This reaction can be carried out at a suitable temperature (e.g., 80°C to 120°C, e.g., 100°C) for a certain time (e.g., about 8 hours to about 15 hours, e.g., about 12 hours).
[0156] Medical uses, pharmaceutical compositions and methods of administration
[0157] In another aspect of the invention, a pharmaceutical composition for treating uncontrolled cell proliferation diseases is provided, comprising a compound of formula I, its stereoisomer, hydrate, solvate, or pharmaceutically acceptable salt. The compound of formula I, its stereoisomer, hydrate, solvate, or pharmaceutically acceptable salt is as described above.
[0158] As used herein, the term “treating / treatment” refers to suppressing a disease, such as suppressing the disease, symptom, or disorder in a subject who has experienced or developed symptoms or signs of a disease, condition, or disorder, i.e., preventing the further development of symptoms and / or signs; or improving a disease, such as improving the disease, symptom, or disorder in a subject who has experienced or developed symptoms or signs of a disease, condition, or disorder, i.e., reversing symptoms and / or signs, such as reducing the severity of the disease.
[0159] In one implementation, uncontrolled cell proliferation disease is cancer.
[0160] In one implementation, the cancer may be a childhood cancer, such as childhood acute leukemia or medulloblastoma. In another implementation, the cancer may be selected from brain cancer, lung cancer, leukemia, bladder cancer, colon cancer, cervical cancer, endometrial cancer, ovarian cancer, squamous cell carcinoma, kidney cancer, peritoneal cancer, breast cancer, stomach cancer, colorectal cancer, prostate cancer, pancreatic cancer, genitourinary tract cancer, lymphoma, laryngeal cancer, skin cancer, malignant melanoma, colorectal cancer, endometrial cancer, thyroid cancer, rhabdomyosarcoma, liver cancer, and combinations thereof. For example, the cancer may be lung cancer, prostate cancer, breast cancer, ovarian cancer, endometrial cancer, bladder cancer, or skin cancer.
[0161] Lung cancer can be small cell lung cancer, non-small cell lung cancer, or neuroendocrine carcinoma of the lung. Prostate cancer can be androgen receptor-positive prostate cancer (AR-positive prostate cancer; ARPC), castration-resistant prostate cancer (CRPC), double-negative prostate cancer (DNPC) (not expressing androgen receptors and neuroendocrine markers), or neuroendocrine prostate cancer (NEPC). Brain cancer can be glioblastoma, medulloblastoma, glioma, or a combination thereof. Kidney cancer can be clear cell renal cell carcinoma. Bladder cancer can be urothelial carcinoma of the bladder. Blood cancers can be selected from chronic myeloid leukemia (CML), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), hairy cell leukemia, chronic myelomonocytic leukemia (CMML), juvenile myelomonocytic leukemia (JMML), large granular lymphocytic leukemia (LGL), acute lymphoblastic leukemia, acute lymphoblastic leukemia, B-cell lymphoma, T-cell lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma, hairy cell lymphoma, Burkitt lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma, and combinations thereof.
[0162] In one implementation, uncontrolled cell proliferation disorders may be associated with cereblon (CRBN) dysfunction.
[0163] As used herein, “cereblon” and “CRBN” are used interchangeably and refer to the protein encoded by the human CRBN gene, which is located at 3p26.2 on chromosome 3, with base pairs 3,148,489 to 3,179,716 (UCSC Human Genome Explorer, December 2013 (GRCh38 / hg38) assembly). CRBN is a substrate recognition element of the DCX (DDB1-CUL4-X-box) E3 protein ligase complex, mediating the ubiquitination of target proteins and subsequent proteasome degradation. The DCX (DDB1-CUL4-X-box) E3 protein ligase complex consists of at least CRBN, CUL4A, DDB1, and RBX1. The CRBN protein produces two isoforms via alternative splicing: isoform 1 contains 442 amino acids and has a molecular weight of 50,546 Da; isoform 2 contains 441 amino acids and has a molecular weight of 50,475 Da.
[0164] Uncontrolled cell proliferation disorders may be associated with GSPT1 dysfunction. These disorders can be GSPT1-related or GSPT1-induced. For example, uncontrolled cell proliferation disorders can be GSPT1-related cancers.
[0165] In this article, GSPT1 (G1 to S phase transition protein 1), also known as eRF3, is a translation termination factor that binds to eRF1 and mediates stop codon recognition and the release of nascent proteins from the ribosome. GSPT1 plays a crucial role in maintaining high-fidelity protein synthesis (Cell. 2011 Oct 14; 147(2): 396-408). It is known that ubiquitination and degradation of GSPT1 induce the suppression of the expression levels of oncogenes (translation-addictive oncoproteins, such as c-MYC, N-MYC, L-MYC, BCL-2, MCL-1, etc.), which are maintained at high expression levels in cancer cells in dependence on protein translation (Mullard, Nat Rev DrugDiscov. 2022, 21: 865-867). Furthermore, GSPT1 degradation is known to activate a cell death mechanism known as the “integrative stress response” (Surka et al., Blood 2021, 137(5): 661-677). This response is known to be mediated by ATF-4 and ultimately lead to cell death in a caspase 3-dependent manner.
[0166] The compound of Formula I of the present invention can be used to treat MYC-driven cancers, such as cancers driven by oncogenic proteins like c-MYC, N-MYC, and L-MYC, which maintain high expression levels dependent on protein translation. MYC-driven cancers include, for example, prostate cancer, breast cancer, liver cancer, and colorectal cancer, but are not limited thereto. In one embodiment, the compound of Formula I of the present invention can be used to treat cancers exhibiting high N-MYC expression levels.
[0167] Furthermore, the compounds of Formula I of the present invention can be used to treat cancers sensitive to integrated stress responses, such as leukemia. Leukemia includes, but is not limited to, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), and acute lymphoblastic leukemia (ALL). For example, leukemia is acute myeloid leukemia.
[0168] The compound of formula I of this invention is a molecular gel based on the structure of pomalidomide, an immunomodulatory imide drug, which can bind to CRBN protein and induce selective degradation of GSPT1. Compared with various novel substrates such as IKAROS, AIOLOS, and CK1α, the compound of formula I with a specific combination of substituents exhibits excellent selectivity, especially against GSPT1. Compared with the compounds disclosed in prior art document WO2022 / 066835, the compound of formula I of this invention has excellent selectivity and degradation activity against GSPT1. In particular, the compounds disclosed in the aforementioned prior art document only exhibit temporary degradation activity against GSPT1, after which GSPT1 expression levels recover and tumor cell re-proliferation occurs, while the compound of formula I of this invention exhibits sustained and stable GSPT1 degradation activity and excellent tumor cell proliferation inhibition activity.
[0169] Furthermore, the compound of Formula I of the present invention has excellent tumor cell proliferation inhibitory activity and significantly reduced cytotoxicity to normal cells, thus its therapeutic index is much greater than that of the compounds disclosed in the prior art literature.
[0170] In one embodiment, the cancer is a cancer with a neuroendocrine phenotype. The inventors have found that compounds of Formula I exhibit particularly excellent anticancer activity, especially against cancers with a neuroendocrine phenotype, such as lung cancer or prostate cancer.
[0171] Cancers with a neuroendocrine phenotype have been reported to share common morphological and histological markers, such as a high nucleocytoplasmic ratio, frequent mitotic features, and granular chromatin (Am. Soc. Clin. Oncol. Educ. Book. 2015; 35: 92-103). Furthermore, cancers with a neuroendocrine phenotype have been reported to commonly exhibit TP53 and RB1 deletions and / or inactivation mutations at the molecular level, and express common neuroendocrine markers such as chromogranin A (CHGA) and synaptophysin (SYP) (Nat. Med. 2016; 22: 298-305; Lancet Oncol. 2015; 16: e435-e446).
[0172] In one implementation, cancers with a neuroendocrine phenotype include, but are not limited to, neuroendocrine prostate cancer (NEPC), castration-resistant prostate cancer, and pulmonary neuroendocrine tumors.
[0173] In one embodiment, the pharmaceutical composition may comprise conventionally pharmaceutically acceptable carriers, excipients, or additives. Pharmaceutically acceptable carriers, excipients, or additives may include, but are not limited to, one or more pharmaceutically acceptable diluents, preservatives, antioxidants, solubilizers, emulsifiers, colorants, release agents, coating agents, sweeteners, flavoring agents, and adjuvants. The disclosed pharmaceutical compositions may be readily available in unit dosage forms and may be prepared by any method well known in the fields of pharmaceutical science and pharmaceutical science.
[0174] Pharmaceutical compositions can be formulated using conventional methods and can be prepared into various oral formulations such as tablets, pills, powders, capsules, syrups, emulsions, and microemulsions; parenteral formulations such as those for intramuscular, intravenous, or subcutaneous injection; or formulations for topical application to the skin. Pharmaceutical compositions can be single compositions or multi-component compositions. A pharmaceutical composition contains a compound, stereoisomer, hydrate, solvate, or pharmaceutically acceptable salt according to one aspect as its active ingredient.
[0175] Formulating the above-described pharmaceutical compositions into unit dosage forms may be particularly advantageous for ease of administration and uniform dosage. As used herein, the term "unit dosage form" refers to a physically discrete unit suitable as a unit dose, wherein each unit contains a predetermined amount of the active ingredient, which is calculated to produce the desired therapeutic effect relative to the desired drug carrier. Typical examples of unit dosage forms include tablets (including split tablets or coated tablets), capsules, or pills for oral administration; single-dose vials of solutions or suspensions for injection; suppositories for rectal administration; powder packets; tablets; and multiple separate batches thereof.
[0176] When preparing the pharmaceutical composition in the form of an oral dosage form, examples of additives or carriers used may include cellulose, calcium silicate, corn starch, lactose, sucrose, glucose, calcium phosphate, stearic acid, magnesium stearate, calcium stearate, gelatin, talc, surfactants, suspending agents, emulsifiers, diluents, etc. When preparing the pharmaceutical composition of the present invention in the form of an injectable dosage form, additives or carriers may include water, physiological saline, glucose aqueous solution, sugar-like aqueous solution, alcohol, glycol, ether (e.g., polyethylene glycol 400), oil, fatty acids, fatty acid esters, glycerides, surfactants, suspending agents, emulsifiers, etc.
[0177] In one embodiment, the pharmaceutical compositions of the present invention can be prepared as a liquid dosage form, wherein the liquid dosage form may include preservatives, stabilizers, buffers, flavor modifiers, sweeteners, colorants, antioxidants, complexing agents, etc. For example, complexing agents may include chelating agents such as ethylenediaminetetraacetic acid, hypozinotriacetic acid, diethylenetriaminepentaacetic acid, and their salts. Optionally, it may be necessary to stabilize the pH of the liquid dosage form to about 9 or lower with a physiologically acceptable base or buffer solution. To the extent possible, it is desirable to prepare stable dosage forms at neutral or weakly alkaline pH (pH 8 or lower). In this respect, the compounds of the present invention exhibit excellent stability at neutral pH and may also have advantages in terms of formulation stability. To enhance the solubility and / or stability of the disclosed compounds in liquid, parenteral, or intravenous dosage forms, the use of α-, β-, or γ-cyclodextrins or their derivatives (especially hydroxyalkyl-substituted cyclodextrins, such as 2-hydroxypropyl-β-cyclodextrin or sulfobutyl-β-cyclodextrin) may be advantageous, if necessary. Furthermore, co-solvents such as alcohols can improve the solubility and / or stability of the compounds of the present invention in pharmaceutical compositions.
[0178] The dosage of the pharmaceutical composition is an amount that has a therapeutic effect on the subject or patient, and may be administered orally or parenterally as needed. It can be administered in single or multiple doses. When administered orally, the dosage is 0.01 to 1000 mg (more specifically 0.1 to 300 mg) per kilogram of body weight per day, based on the active ingredient. When administered parenterally, the dosage is 0.01 to 100 mg (more specifically 0.1 to 50 mg) per kilogram of body weight per day, based on the active ingredient. The dosage for a specific subject or patient should be determined based on several relevant factors such as the patient's weight, age, sex, health status, diet, time of administration, route of administration, and severity of disease, and it should be understood that the dosage may be increased or decreased at the discretion of a specialist physician. The above dosages do not limit the scope of the invention in any way. Those skilled in the art (physicians or veterinarians) can readily determine and prescribe the desired effective amount of the pharmaceutical composition. For example, a physician or veterinarian may start with a dosage of the compound of the invention used in the pharmaceutical composition below the level required to achieve the desired therapeutic effect and may gradually increase the dosage until the desired effect is achieved.
[0179] In one embodiment, the pharmaceutical composition includes, within its scope, a pharmaceutical composition comprising a therapeutically effective amount of at least one disclosed compound as an active ingredient, which may be used alone or in combination with a pharmaceutically acceptable carrier. The terms "therapeutically effective amount" or "effective amount" refer to an amount sufficient to produce a beneficial or anticipated clinical effect, such as an amount sufficient to alleviate, improve, stabilize, reverse, slow, or delay disease progression.
[0180] Depending on the route of administration, the pharmaceutical composition comprises 0.05 to 99% by weight, preferably 0.1 to 70% by weight, more preferably 0.1 to 50% by weight, of an active ingredient, and 1 to 99.95% by weight, preferably 30 to 99.9% by weight, more preferably 50 to 99.9% by weight, of a pharmaceutically acceptable carrier, all percentages being based on the total weight of the composition.
[0181] In one embodiment, the pharmaceutical composition may also comprise at least one agent known for treating cancer.
[0182] At least one agent may be selected from uracil mustard, chlormethine, cyclophosphamide, ifosfamide, melphalan, chlorambucil, pipebroman, triethylenemelamine, triethylenethiophosphoramine, busulfan, carmustine, lomustine, streptozocin, dacarbazin, etc. Dacarbazine, temozolomide, thiotepa, altretamine, methotrexate, 5-fluorouracil, fluorouridine, cytarabine, 6-mercaptopurine, 6-thioguanine, fludarabine phosphate, pentostatin, bortezomib, vinblastine, vincristine, vinorelbine Bine, vindesine, bleomycin, dactinomycin D, daunorubicin, doxorubicin, epirubicin, dexamethasone, clofarabine, cladribine, pemetrexed, idarubicin, paclitaxel, docetaxel, ixaspirin xabepilone, mithramycin, topotecan, irinotecan, deoxycoformycin, mitomycin C, L-asparaginase, interferon, etoposide, teniposide, 17α-ethinylestradiol, diethylstilbestrol, testosterone, prednisone, fluoxymesterone, drostanolonepropionate, testolactone, megestrolacetate, tamoxifen, methylprednisolone, methyltestosterone, prednisolone, triamcinolone, chlorotrianisene, hydroxyprogesterone, aminoglutethimide, estramustine, medroxyprogesterone acetate acetate, leuprolide, flutamide, toremifene, goserelin, cisplatin, carboplatin, hydroxyurea, amsacrine, procarbazine, mitotane, mitoxantrone, levamisole, navelbine, anastrozole, letrozole, capecitabine ( Capecitabine, raloxifene, droloxifene, hexamethylmelamine, oxaliplatin, gefitinib, capecitabine, erlotinib, azacitidine, temozolomide, gemcitabine, vasostatin, and combinations thereof.
[0183] In addition, at least one agent may be selected from DNA methyltransferase inhibitors, HDAC inhibitors, glucocorticoids, mTOR inhibitors, cytotoxic agents, or combinations thereof.
[0184] DNA methyltransferase inhibitors may be 5-aza-2'-deoxycytidine, 5-azacytidine, zebularine, epigallocatechin-3-gallate, procaine, or combinations thereof.
[0185] HDAC inhibitors may be vorinostat, entinostat, panobinostat, trichostatin A, mocetinostat, belinostat, dacinostat, givinostat, tubastatin A, pracinostat, droxinostat, quisinostat, romidepsin, valproic acid, AR-42 (OSU-HDAC42), tacedinaline, ricolinostat, apicidin, or combinations thereof.
[0186] Glucocorticoids may be dexamethasone, prednisolone, methylprednisolone, betamethasone, triamcinolone, fludrocortisone, beclomethasone, or combinations thereof.
[0187] mTOR inhibitors may be BEZ235, everolimus, sirolimus, temsirolimus, rapamycin, AZD8055, or combinations thereof.
[0188] Cytotoxic agents can be selected from alkylating agents, antimetabolites, antitumor antibiotics, mitotic inhibitors, or chemotherapeutic agents selected from anthracyclines, cytarabine, purine analogs, sorafenib, gemtuzumab, rituximab, or combinations thereof.
[0189] Alkylating agents can be selected from carboplatin, cisplatin, cyclophosphamide, chlorambucil, melphalan, carmustine, busulfan, lomustine, dacarbazine, oxaliplatin, ifosfamide, nitrogen mustard, temozolomide, thiotepa, bendamustine, and streptozotocin.
[0190] Antimetabolites can be selected from gemcitabine, 5-fluorouracil, capecitabine, hydroxyurea, mercaptopurine, pemetrexed, fludarabine, nelarabine, cladribine, clofarabine, cytarabine, decitabine, pralatrexate, fluorouridine, methotrexate, and thioguanine.
[0191] Antitumor antibiotics can be selected from doxorubicin, mitoxantrone, bleomycin, daunorubicin, actinomycin D, epirubicin, idarubicin, procainomic acid, mitomycin, pentostatin, and valrubicin.
[0192] Mitosis inhibitors can be selected from irinotecan, topotecan, rubitecan, cabazitaxel, docetaxel, paclitaxel, etoposide, vincristine, ixaprilone, vinorelbine, vinblastine, and teniposide.
[0193] At least one agent may be a BCL2 inhibitor, an FLT3 inhibitor, an IDH 1 / 2 inhibitor, a CDK (cyclin-dependent kinase) inhibitor, a transcription inhibitor, an HSP inhibitor, or a combination thereof.
[0194] BCL2 (B-cell lymphoma 2) inhibitors may include venetoclax, navitoclax, obatoclax mesylate, sabutoclax, lisaftoclax, etc.
[0195] FLT3 (FMS-like tyrosine kinase 3) inhibitors may include midostaurin, quizartinib, gilteritinib, sorafenib, crenolanib, pexidartinib, etc.
[0196] IDH (isocitrate dehydrogenase) 1 / 2 inhibitors may include ivosidenib, enasidenib, vorasidenib, olutasidenib, AGI-6780, AGI-5198, GSK321, etc.
[0197] CDK inhibitors can include CDK7 inhibitors, CDK9 inhibitors, CDK12 inhibitors, etc., and may include, for example, samuraciclib, alvocidib, fadraciclib, seliciclib, zotiraciclib, atuveciclib, enitociclib, voruciclib, SY5609, XL201, Q-901, KRLS-017, GTAEXS-617, TGN-1062, THZ1, THZ2, SY-136 5. YKL-5-124, ICEC0942, LY3405105, LDC4297, BS-181, SNS-32, AT-7519, AZD-4573, KB-0742, AU-07, BTXA-51, GFH-009 , JS-101, PRT-2527, QHRD-107, TP-1287, SYHX-1903, CTX-439, KIN-004, SY-12882, THZ-531, CT-7439, AU-003, AU-004, etc.
[0198] Transcription inhibitors include any agent capable of inhibiting the transcription of oncogenic proteins. The compounds of this invention, based on GSPT1 degradation activity, exert their anticancer effects by inhibiting the translation process from RNA to protein. Therefore, combined use with transcription inhibitors that inhibit the transcription process from DNA to RNA can produce enhanced anticancer effects. Such transcription inhibitors may include, for example, lurbinectedin, which is known to inhibit transcription by covalently binding to residues present in the minor groove of DNA.
[0199] HSP (heat shock protein) inhibitors include HSP70 inhibitors, HSP90 inhibitors, etc., and may include, for example, pimitespib, luminespib, tanespimycin, alvespimycin, ganetespib, onalespib, geldanamycin, rocaglamide, etc.
[0200] In one embodiment, at least one pharmaceutical agent may be co-packaged, co-formulated, and / or co-delivered with the Formula I compound of the present invention, its stereoisomers, hydrates, solvates, or pharmaceutically acceptable salts.
[0201] In one embodiment, at least one pharmaceutical agent may be provided in the form of a kit comprising a compound of formula I of the present invention, its stereoisomer, hydrate, solvate, or pharmaceutically acceptable salt. The kit provides two or more components (which may be active or inactive ingredients, carriers, diluents, etc.) and instructions for preparing the actual dosage form by a patient or an individual administering the drug to a patient.
[0202] In another aspect, a method is provided for modulating cereblon activity or GSPT1 activity in at least one cell, comprising contacting said at least one cell in vitro with a compound of formula I, its stereoisomers, hydrates, solvates, or pharmaceutically acceptable salts. In the description of the method, the same terms or elements as those mentioned above shall have the same meaning as described herein.
[0203] As used herein, the term "contact" means a manner in which the disclosed compound or pharmaceutical composition can directly affect the activity of cells, target proteins, or other biological entities by bringing the disclosed compound or pharmaceutical composition into close proximity with the cells, target proteins, or other biological entities; that is, through interaction with the cells, target proteins, or other biological entities themselves; or a manner in which the disclosed compound or pharmaceutical composition can indirectly affect the activity of the cells, target proteins, or other biological entities; that is, through interaction with other molecules, cofactors, factors, or proteins on which the activity of the cells, target proteins, or other biological entities depends.
[0204] The compound of formula I of the present invention, or a pharmaceutical composition comprising the compound, exhibits activity as a cereblon protein regulator. Furthermore, the compound of formula I of the present invention, or a pharmaceutical composition comprising the compound, exhibits activity as a GSPT1 expression and / or activity regulator. Additionally, the compound of formula I of the present invention, or a pharmaceutical composition comprising the compound, exhibits activity as a cell proliferation inhibitor. Therefore, the compound of formula I of the present invention can be used to evaluate novel compounds. For example, the test compound can be evaluated by comparing the analytical values obtained from biological analyses of the test compound and the compound of the present invention, respectively. Biological analyses include, but are not limited to, cereblon binding assays, GSPT1 degradation activity assays, cell proliferation assays, etc.
[0205] On the other hand, a method for treating uncontrolled cell proliferation disorders is provided, comprising administering to a subject a compound of formula I, its stereoisomers, hydrates, solvates, or pharmaceutically acceptable salts.
[0206] In the description of methods, the same terms or elements mentioned above have the same meaning as those mentioned above. As used herein, the term "subject" refers to an individual in need of treatment for a disease, and more specifically to mammals such as humans or non-human primates, mice, dogs, cats, horses, and cattle.
[0207] On the other hand, the use of a compound of formula I, its stereoisomers, hydrates, or solvates for the treatment of uncontrolled cell proliferation diseases (e.g., cancer) is provided; or the use of a compound of formula I, its stereoisomers, hydrates, or solvates in the preparation of a medicament for the treatment of uncontrolled cell proliferation diseases (e.g., cancer). Terms or elements mentioned in the description of use are as described above.
[0208] The present invention will be described in detail below through embodiments. However, the following embodiments are for illustrative purposes only, and the scope of the present invention is not limited to the following embodiments.
[0209] [Preparation Examples]
[0210] Preparation Example 1: ((3-bromo-2-chlorobenzyl)oxy)(tert-butyl)diphenylsilane (Intermediate A1)
[0211] Step 1: (3-Bromo-2-chloro-phenyl)methanol
[0212]
[0213] BH3·THF (1 M, 42.47 mL) was slowly added dropwise to a solution of 3-bromo-2-chloro-benzoic acid (5 g, 21.23 mmol) in THF (50 mL) at 0 °C under a nitrogen atmosphere. The resulting mixture was stirred at 25 °C for 12 h under a nitrogen atmosphere. Water (20 mL) and K2CO3 were slowly added at 0 °C under a nitrogen atmosphere to neutralize the mixture. Subsequently, the mixture was extracted with EtOAc (50 mL * 3). The organic layer was washed with brine (100 mL * 3), dried over anhydrous Na2SO4, filtered, and then concentrated under reduced pressure to give (3-bromo-2-chloro-phenyl)methanol (4.4 g, 94% yield) as a yellow solid. 1 H NMR (400 MHz, CDCl3) δ ppm 4.80 (2H, s), 7.16 (1H, t, J = 8.0 Hz), 7.47 (1H, dd, J = 7.6, 0.8 Hz), 7.57 (1H, dd, J = 8.0,1.2 Hz).
[0214] Step 2: ((3-bromo-2-chlorobenzyl)oxy)(tert-butyl)diphenylsilane
[0215]
[0216] At 0 °C, tert-butylchlorodiphenylsilane (TBDPCl; 6.55 g, 23.84 mmol) was added to a DCM (20 mL) solution of (3-bromo-2-chloro-phenyl)methanol (4.4 g, 19.87 mmol) and imidazole (1.62 g, 23.84 mmol). The resulting mixture was stirred at 25 °C for 12 hours. The mixture was concentrated under reduced pressure, diluted with water (300 mL), and extracted with EtOAc (200 mL * 3). The organic layer was washed with brine (400 mL), dried over anhydrous Na2SO4, filtered, and then concentrated under reduced pressure to give the residue. The residue was purified by silica gel column chromatography (PE: EtOAc = 100:0 to 100:1) to give intermediate A1 (8.8 g, 96% yield) as a colorless oil. 1 H NMR (400 MHz, CDCl3) δ ppm 1.13 (9H, s), 4.83 (2H, s), 7.22 (1H, t, J = 8.0 Hz), 7.37-7.46 (6H, m), 7.52-7.58 (1H, m), 7.69 (4H, dd,J = 8.0, 1.6 Hz), 7.74 (1H, dd, J = 7.6, 1.2 Hz).
[0217] Preparation Example 2: 1-Bromo-2-(difluoromethoxy)-4-fluoro-3-methylbenzene (Intermediate A2)
[0218]
[0219] At 25 °C, 6-bromo-3-fluoro-2-methylphenol (1 g, 4.88 mmol) was added to a solution of KOH (5.47 g, 97.55 mmol) in water (20 mL) and ACN (20 mL). Subsequently, 1-[[bromo(difluoro)methyl]-ethoxy-phosphoryl]oxyethane (2.60 g, 9.75 mmol) was added at -78 °C. The resulting mixture was stirred at -78 °C for 0.3 h, then at 25 °C for 1.7 h. The mixture was diluted with DCM (50 mL) and water (50 mL). It was then extracted with DCM (50 mL * 3). The organic layer was washed with brine (100 mL * 3), dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure to give intermediate A2 (1.2 g, 96% yield) as a yellow oil. 1H NMR (400 MHz, CDCl3) δ ppm 2.30 (3H, d, J = 2.0 Hz), 6.22-6.76 (1H, m), 6.91 (1H, t, J = 8.8 Hz), 7.43 (1H, dd, J = 8.8, 5.6 Hz).
[0220] Preparation Example 3: 1-Bromo-2-(difluoromethoxy)-3-methylbenzene (Intermediate A3)
[0221]
[0222] At 25 °C, 2-bromo-6-methylphenol (4 g, 21.39 mmol) was added to a solution of KOH (24 g, 427.73 mmol) in water (15 mL) and ACN (15 mL). Subsequently, 1-[[bromo(difluoro)methyl]-ethoxy-phosphoryl]oxyethane (11.42 g, 42.77 mmol) was added at -78 °C. The resulting mixture was stirred at -78 °C for 0.3 h, then at 25 °C for 1.7 h. The mixture was diluted with water (100 mL). It was then extracted with DCM (50 mL * 3). The organic layer was washed with brine (50 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure to give intermediate A3 (4 g, 79% yield) as a yellow oil. 1 H NMR (400 MHz, CDCl3) δ ppm 2.38 (3H, s), 6.31-6.75 (1H, m), 7.00-7.08 (1H,m), 7.20 (1H, d, J = 7.6 Hz), 7.45 (1H, d, J = 8.0 Hz).
[0223] Preparation Example 4: 1-Bromo-2-(difluoromethoxy)-3-ethylbenzene (Intermediate A4)
[0224]
[0225] At 25 °C, 2-bromo-6-ethylphenol (2 g, 9.95 mmol) was added to a solution of KOH (11.16 g, 198.95 mmol) in water (8 mL) and ACN (8 mL). Subsequently, 1-[[bromo(difluoro)methyl]-ethoxy-phosphoryl]oxyethane (5.31 g, 19.90 mmol) was added at -78 °C. The resulting mixture was stirred at -78 °C for 0.3 h, then at 25 °C for 0.5 h. The mixture was diluted with water (20 mL). It was then extracted with DCM (20 mL * 3). The organic layer was washed with brine (30 mL * 3), dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure to give intermediate A4 (1.6 g, 64% yield) as a yellow oil. 1 H NMR (400 MHz, CDCl3) δ ppm 1.24-1.26 (3H, m), 2.75-2.82 (2H, m), 6.31-6.75 (1H, m), 7.03-7.12 (1H, m), 7.22-7.28 (1H, m), 7.43-7.48 (1H, m).
[0226] Preparation Example 5: 1-Bromo-2-chloro-3-ethylbenzene (Intermediate A5)
[0227] Step 1: 1-Bromo-2-chloro-3-vinylbenzene
[0228]
[0229] A mixture of 1-bromo-2-chloro-3-iodobenzene (450 mg, 1.42 mmol), 4,4,5,5-tetramethyl-2-vinyl-1,3,2-dioxaborhexacyclopentane (225 mg, 1.46 mmol), Cs₂CO₃ (1.16 g, 3.54 mmol), and Pd(dppf)Cl₂ (104 mg, 142.04 μmol) in water (1 mL) and dioxane (10 mL) was degassed, purged three times with N₂, and then stirred at 70 °C for 4 hours under N₂ atmosphere. The mixture was diluted with water (30 mL) and extracted with EtOAc (15 mL * 3). The organic layer was washed with brine (50 mL), dried over anhydrous Na₂SO₄, filtered, and then concentrated under reduced pressure to obtain the residue. The residue was purified by silica gel column chromatography (PE: EtOAc = 100:0 to 99:1) to give 1-bromo-2-chloro-3-vinylbenzene (0.2 g, 65% yield) as a colorless oil. 1H NMR (400 MHz, CDCl3) δ ppm 5.42 (1H, d, J = 11.2 Hz), 5.72 (1H, d,J = 17.2 Hz), 7.07-7.19 (2H, m), 7.49-7.58 (2H, m).
[0230] Step 2: 1-Bromo-2-chloro-3-ethylbenzene
[0231]
[0232] Under a nitrogen atmosphere, Pt / C (773 mg, 183.95 μmol, 5% purity) and ZnBr2 (42 mg, 186.50 μmol) were added to a solution of 1-bromo-2-chloro-3-vinylbenzene (0.2 g, 919.58 μmol) in EtOAc (5 mL). The mixture was degassed, purged three times with H2 (15 psi), and then stirred at 25 °C for 12 hours under a H2 (15 psi) atmosphere. The mixture was filtered and then concentrated under reduced pressure to give intermediate A5 (220 mg, crude product) as a yellow oil. 1 H NMR (400 MHz, CDCl3) δ ppm1.24 (3H, t, J = 7.6 Hz), 2.76-2.87 (2H, m) 7.01-7.10 (1H, m), 7.18 (1H, dd,J = 7.6, 1.2 Hz), 7.48 (1H, dd, J = 8.0, 1.6 Hz).
[0233] Preparation Example 6: 1-Bromo-2-chloro-3-ethyl-4-fluorobenzene (Intermediate A6)
[0234] Step 1: 1-Bromo-2-chloro-4-fluoro-3-vinylbenzene
[0235]
[0236] DBU (1.42 g, 9.36 mmol) was added to a 20 mL solution of methyl(triphenyl)phosphine bromide (3 g, 8.40 mmol) in DCM. The reaction mixture was stirred at 50 °C for 30 min. Subsequently, a 10 mL solution of 3-bromo-2-chloro-6-fluorobenzaldehyde (1 g, 4.21 mmol) in DCM was added to the reaction mixture. The resulting mixture was stirred at 50 °C for 3 h. The mixture was diluted with 50 mL of DCM and washed with HCl solution (0.1 M, 50 mL * 2). The organic layer was dried over anhydrous Na₂SO₄ and concentrated under reduced pressure to give a yellow residue. The residue was purified by silica gel column chromatography (PE: EtOAc = 99:1) to give 1-bromo-2-chloro-4-fluoro-3-vinylbenzene (160 mg, 16% yield) as a white liquid. 1 H NMR (400 MHz, CDCl3) δ ppm 5.69(1H, d, J = 12.0 Hz), 5.94 (1H, d, J = 18.0 Hz), 6.79 (1H, dd, J = 18.0, 12.0Hz), 6.93 (1H, t, J = 9.6 Hz), 7.49 (1H, dd, J = 8.8, 5.2 Hz).
[0237] Step 2: 1-Bromo-2-chloro-3-ethyl-4-fluorobenzene
[0238]
[0239] Under a nitrogen atmosphere, ZnBr2 (102 mg, 453 μmol) and Pt / C (2.04 g, 971 μmol, 10% purity) were added to a solution of 1-bromo-2-chloro-4-fluoro-3-vinylbenzene (510 mg, 2.17 mmol) in EtOAc (5 mL). The reaction mixture was degassed, purged three times with H2 (15 psi), and then stirred at 25 °C for 12 hours under a H2 (15 psi) atmosphere. The mixture was filtered and then concentrated under reduced pressure to give intermediate A6 (500 mg, crude product) as a white oil. 1 H NMR (400 MHz, CDCl3)δ ppm 1.19 (3H, t, J = 7.6 Hz), 2.87 (2H, d, J = 7.6, 2.4 Hz), 6.88 (1H, t, J= 8.8 Hz), 7.45 (1H, dd, J = 8.8, 5.6 Hz).
[0240] Preparation Example 7: 1-Bromo-4-fluoro-3-methyl-2-(trifluoromethoxy)benzene (Intermediate A7)
[0241] Step 1: 1-Bromo-2-[bromo(difluoro)methoxy]-4-fluoro-3-methylbenzene
[0242]
[0243] NaH (595 mg, 14.88 mmol, 60% purity) was added to a DMF (10 mL) solution of 6-bromo-3-fluoro-2-methylphenol (1 g, 4.88 mmol) at 0 °C under a nitrogen atmosphere. The resulting mixture was stirred at 0 °C for 10 min. Subsequently, t-BuOK (606 mg, 5.40 mmol) and dibromo(difluoro)methane (18.96 mmol, 1.75 mL) were added. The reaction mixture was stirred at 70 °C for 12 h 50 min under a nitrogen atmosphere. The mixture was slowly poured into water (30 mL) and extracted with DCM (15 mL * 3). The organic layer was washed with brine (30 mL * 3), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by silica gel column chromatography (PE: EtOAc = 1:0 to 100:1) to give 1-bromo-2-[bromo(difluoro)methoxy]-4-fluoro-3-methylbenzene (690 mg, crude product), which was a colorless oil. 1 H NMR (400 MHz, CDCl3) δ ppm 2.30 (3H, s), 6.95 (1H, t, J = 8.8 Hz), 7.46 (1H, dd, J = 8.8, 5.6 Hz).
[0244] Step 2: 1-Bromo-4-fluoro-3-methyl-2-(trifluoromethoxy)benzene
[0245]
[0246] AgBF4 (402 mg, 2.07 mmol) was added to an 8 mL solution of 1-bromo-2-[bromo(difluoro)methoxy]-4-fluoro-3-methylbenzene (690 mg, 2.07 mmol) in DCM at -78 °C. The resulting mixture was stirred at 25 °C for 12 hours. The mixture was filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE: EtOAc = 1:0) to give intermediate A7 (300 mg, 53% yield) as a colorless oil. 1H NMR (400 MHz, CDCl3) δ ppm 2.30 (3H, d, J =1.6 Hz), 6.95 (1H, t, J = 8.8 Hz), 7.46 (1H, dd, J = 8.82, 6.0 Hz).
[0247] Preparation Example 8: 1-Iodo-3-methyl-2-(trifluoromethoxy)benzene (Intermediate A8)
[0248]
[0249] In a nitrogen atmosphere at -78 °C, tert-butyllithium (1.3 M, 14.00 mL) was added to a THF (10 mL) solution of 1-methyl-2-(trifluoromethoxy)benzene (2.0 g, 11.35 mmol) and N,N,N',N'-tetramethylethylenediamine (1.32 g, 11.36 mmol, 1.71 mL) and stirred for 30 min. I2 (3.44 g, 13.55 mmol, 2.73 mL) was added to the mixture, and the mixture was stirred at -78 °C for 2 h. The resulting mixture was quenched with saturated NH4Cl (30 mL) and extracted with DCM (20 mL × 3). The organic layer was washed with brine (20 mL × 2) and concentrated to give a yellow residue. The residue was purified by silica gel column chromatography (PE: EtOAc = 100:0) and purified twice by preparative HPLC (PE: EtOAc = 1:0). However, the two compounds were not separated, so preparative HPLC (column: Waters Xbridge C18 150 × 50 mm × 10 mm; mobile phase: [water (NH4HCO3)-acetonitrile]; gradient: 64%-94% B, 10 min) was used for further purification. The obtained compound was extracted with PE (30 mL * 3), dried over anhydrous Na2SO4, and then concentrated under reduced pressure to give intermediate A8 (0.2 g, 662.18 μmol, 6% yield) as a colorless oil. 1 H NMR (400 MHz, CDCl3) δ ppm 2.30 (3H, s), 6.84 (1H, t, J = 7.6Hz), 7.14 (1H, d, J = 7.6 Hz), 7.63 (1H, d, J = 7.6 Hz).
[0250] Preparation Example 9: 2-Bromo-3-ethylaniline (Intermediate B1)
[0251] Step 1: 2-Bromo-1-nitro-3-vinylbenzene
[0252]
[0253] DBU (2.5 g, 16.42 mmol, 2.48 mL) was added to a DCM (50 mL) solution of methyl(triphenyl)phosphine bromide (5.3 g, 14.84 mmol). The reaction mixture was stirred at 50 °C for 30 min. Subsequently, a DCM (30 mL) solution of 2-bromo-3-nitro-benzaldehyde (1.7 g, 7.39 mmol) was added to the reaction mixture. The resulting mixture was stirred at 50 °C for 3 h. The mixture was diluted with DCM (100 mL) and washed with HCl solution (0.1 M, 50 mL * 2). The organic layer was dried over anhydrous Na₂SO₄ and concentrated under reduced pressure to give a yellow residue. The residue was purified by silica gel column chromatography (PE: EtOAc = 50:1 to 20:1) to give 2-bromo-1-nitro-3-vinylbenzene (0.8 g, 3.51 mmol, 47% yield) as a yellow solid. 1 H NMR (400MHz, CDCl3) δ ppm 5.39-5.51 (1H, m), 5.65-5.76 (1H, m), 6.97-7.08 (1H, m), 7.32-7.38 (1H, m), 7.47-7.54 (1H, m), 7.62-7.67 (1H, m).
[0254] Step 2: 2-Bromo-3-ethylaniline
[0255]
[0256] Under a nitrogen atmosphere, Pt / C (50 mg, 11.90 μmol, 5% purity) and ZnBr2 (20 mg, 88.81 μmol, 4.44 μL) were added to a solution of 2-bromo-1-nitro-3-vinylbenzene (0.1 g, 438.51 μmol) in 10 mL of EtOAc. The mixture was degassed, purged several times with H2 (15 psi), and then stirred at 25 °C for 16 h under a H2 (15 psi) atmosphere. The mixture was filtered through diatomaceous earth and washed with EtOAc (20 mL * 3). The filtrate was washed with water (15 mL * 2), the organic layer was dried over anhydrous Na2SO4, filtered, and then concentrated to give intermediate B1 (0.16 g, 799.70 μmol, 91% yield) as a yellow oil. The final compound could be used for the next reaction without further purification. 1H NMR (400 MHz, CDCl3) δ ppm1.24 (3H, t, J = 7.6 Hz), 2.75 (2H, q, J = 7.2 Hz), 4.1 (2H, s), 6.64-6.67(2H, m), 7.06 (1H, t, J = 8.0 Hz).
[0257] Preparation Example 10: 2-Bromo-4-fluoro-5-methylaniline (Intermediate B2)
[0258]
[0259] At -78 °C, a DCM solution of 20 mL containing Br2 (2.58 g, 16.14 mmol, 832.12 μL) was slowly added dropwise to a DCM solution of 40 mL containing tert-butylamine (2.37 g, 32.35 mmol, 3.40 mL). The resulting mixture was stirred at -78 °C for 1 hour. At -78 °C, a DCM solution of 20 mL containing 4-fluoro-3-methylaniline (2.0 g, 15.98 mmol, 205.76 μL) was added dropwise to the reaction mixture, the temperature was slowly raised to 25 °C, and the mixture was stirred for 12 hours. The mixture was diluted with DCM (200 mL) and washed with saturated Na2SO3 solution (100 mL * 2) and brine (100 mL * 1). The organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to give a yellow residue. The residue was purified by preparative HPLC (column: Phenomenex Luna C18 150 * 40 mm * 15 μm; mobile phase: [water (TFA)-ACN]; B%: 35%-65%, 10 min) to give intermediate B2 (4.0 g, 9.80 mmol, 61% yield) as a purple solid. The ratio of 2-bromo-4-fluoro-3-methylaniline to 2-bromo-4-fluoro-5-methylaniline was approximately 1:2. 1 H NMR (400 MHz, CDCl3) δ ppm 2.33-2.36 (3H, m), 6.61-6.64 (1H, m), 6.86 (1H, t, J = 8.8 Hz); LC / MS (ESI) m / z = 204.0 [M+2] + LC / MS t R = 0.75 min.
[0260] Reaction Scheme 1: Synthesis of 2-chloro-N-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)-3-(morpholinomethyl)benzenesulfonamide
[0261]
[0262] Step 1: tert-butyl((2-chloro-3-((4-methoxybenzyl)thio)benzyl)oxy)diphenylsilane
[0263] Xantphos (1.12 g, 1.93 mmol), Et3N (2.94 g, 29.05 mmol), and Pd2(dba)3 (1.76 g, 1.92 mmol) were added to a DMF (100 mL) solution of intermediate A1 (8.8 g, 19.14 mmol) under a nitrogen atmosphere at 25 °C. The resulting mixture was then stirred at 130 °C for 12 hours. The mixture was diluted with water (300 mL) and extracted with EtOAc (200 mL * 3). The organic layer was washed with brine (200 mL * 3), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by silica gel column chromatography (PE: EtOAc = 100:0 to 19:1) to give tert-butyl((2-chloro-3-((4-methoxybenzyl)thio)benzyl)oxy)diphenylsilane (8.2 g, 80% yield) as a white solid. 1 H NMR(400 MHz, CDCl3) δ ppm 1.12 (9H, s), 3.78 (3H, s), 4.09 (2H, s), 4.83 (2H,s), 6.83 (2H, d, J = 8.4 Hz), 7.15-7.21 (1H, m), 7.22-7.30 (3H, m), 7.35-7.46(6H, m), 7.61 (1H, d, J = 7.2 Hz), 7.70 (4H, dd, J = 7.6, 1.2 Hz).
[0264] Step 2: 3-(((tert-butyldiphenylsilyl)oxy)methyl)-2-chlorobenzenesulfonyl chloride (intermediate C1)
[0265] At 0 °C, 1,3-dichloro-5,5-dimethylimidazolidine-2,4-dione (1.47 g, 7.45 mmol) was added to a solution of tert-butyl((2-chloro-3-((4-methoxybenzyl)thio)benzyl)oxy)diphenylsilane (2 g, 3.75 mmol) in ACN (30 mL), AcOH (1.3 mL), and water (0.8 mL). The resulting mixture was stirred at 0 °C for 5 min. The reaction mixture was neutralized to pH 7 with saturated NaHCO3. The mixture was concentrated under reduced pressure, diluted with water (200 mL), and extracted with DCM (150 mL * 3). The organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by silica gel column chromatography (PE:EtOAc = 100:0 to 19:1) to give intermediate C1 (1.7 g, 95% yield) as a yellow oil. 1 H NMR (400MHz, CDCl3) δ ppm 1.15 (9H, s), 4.91 (2H, s), 7.42 (4H, d, J = 7.2 Hz), 7.45-7.49 (2H, m), 7.57 (1H, t, J = 8.0 Hz), 7.69 (4H, dd, J = 8.0, 2.0 Hz), 8.10(1H, d, J = 7.6 Hz), 8.17 (1H, d, J = 7.6 Hz).
[0266] Step 3: 4-((3-(((tert-butyldimethylsilyl)oxo)methyl)-2-chlorophenyl)sulfinamide)phthalic acid dimethyl formate
[0267] Intermediate C1 (1.7 g, 3.55 mmol) was added to a pyridine (20 mL) solution of dimethyl 4-aminophenyl-1,2-dicarboxylate (0.5 g, 2.39 mmol). The resulting mixture was stirred at 25 °C for 1 hour. The mixture was concentrated under reduced pressure, diluted with water (200 mL), and extracted with EtOAc (300 mL * 3). The organic layer was washed with brine (300 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by silica gel column chromatography (PE: EtOAc = 10:1 to 4:1) to give dimethyl 4-((3-(((tert-butyldimethylsilyl)oxo)methyl)-2-chlorophenyl)sulfinamide)phthalate (1.2 g, 44% yield, 57% purity) as a white solid. LC / MS (ESI) m / z = 652.3 [M + H] + LC / MS t R =0.753 min.
[0268] Step 4: Dimethyl 4-((2-chloro-3-(hydroxymethyl)phenyl)sulfonamide)phthalate (intermediate D1)
[0269] At 0 °C, TBAF (1 M, 4.19 mL) was added to a THF (10 mL) solution of dimethyl 4-((3-(((tert-butyldimethylsilyl)oxo)methyl)-2-chlorophenyl)sulfinamido)phthalate (1.2 g, 1.05 mmol). The resulting mixture was stirred at 25 °C for 12 hours. The mixture was filtered under reduced pressure, diluted with water (50 mL), and then extracted with EtOAc (30 mL * 3). The organic layer was washed with HCl (1 M, 50 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by preparative HPLC (column: Phenomenex Luna C18 150 * 40 mm * 15 μm; mobile phase: [water (TFA)-ACN]; gradient: 30%-60% B, 10 min) to give intermediate D1 (0.35 g, 81% yield) as a white solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm 3.76 (6H, d, J = 14.0 Hz), 4.57 (2H, s), 7.27-7.34 (2H, m), 7.58 (1H, s), 7.67 (1H, d, J = 9.2 Hz), 7.78-7.86 (1H, m),8.04 (1H, dd, J = 8.0, 2.0 Hz), 11.36 (1H, s); LC / MS (ESI) m / z = 382.1 [M - 32+ H] + LC / MS t R = 0.533 min.
[0270] Step 5: Dimethyl 4-[(2-chloro-3-formylphenyl)sulfonamido]phenyl-1,2-dicarboxylate
[0271] MnO2 (1.47 g, 16.92 mmol) was added to a solution of intermediate D1 (0.35 g, 845.76 μmol). The resulting mixture was stirred at 25 °C for 72 h. The mixture was filtered and then concentrated under reduced pressure to give dimethyl 4-[(2-chloro-3-formylphenyl)sulfonamido]phenyl-1,2-dicarboxylate (0.44 g, crude product) as a white solid. LC / MS (ESI) m / z = 434.1 [M + Na] + LC / MS t R = 0.558 min.
[0272] Step 6: Dimethyl 4-((2-chloro-3-(morpholinomethyl)phenyl)sulfinamido)phthalate
[0273] To a solution of 4-[(2-chloro-3-formylphenyl)sulfonamido]benzene-1,2-dicarboxylate (100 mg, 242.83 μmol) in MeOH (1 mL) and DCM (1 mL), 2-methylpyridinium borane (50 mg, 467.46 μmol) and AcOH (1 mg, 24.28 μmol) were added. The resulting mixture was stirred at 25 °C for 12 h. The mixture was concentrated under reduced pressure, and the residue was purified by preparative TLC (PE: EtOAc = 1:2) to give 4-((2-chloro-3-(morpholinomethyl)phenyl)sulfinamido)phthalate (70 mg, 58% yield, 97% purity) as a yellow solid. LC / MS (ESI) m / z = 483.2 [M + H] + LC / MS t R = 0.479 min.
[0274] Step 7: 4-((2-chloro-3-(morpholinomethyl)phenyl)sulfinamido)phthalic acid
[0275] LiOH·H2O (27 mg, 643.47 μmol) was added to a solution of dimethyl 4-((2-chloro-3-(morpholinomethyl)phenyl)sulfinamido)phthalate (70 mg, 140.60 μmol) in THF (1 mL), MeOH (1 mL), and H2O (1 mL). The resulting mixture was stirred at 50 °C for 12 hours. The reaction mixture was filtered and then concentrated under reduced pressure to give 4-((2-chloro-3-(morpholinomethyl)phenyl)sulfinamido)phthalic acid (80 mg, crude product) as a white solid. LC / MS (ESI) m / z = 455.1 [M + H] + LC / MS t R = 0.417 min.
[0276] Step 8: 2-Chloro-N-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)-3-(morpholine) (Linylmethyl)benzenesulfonamide (compound 1)
[0277] To a solution of 3-aminopiperidin-2,6-dione (43 mg, 261.26 μmol, HCl salt) and 4-((2-chloro-3-(morpholinomethyl)phenyl)sulfinamido)phthalic acid (80 mg, 175.87 μmol) in AcOH (2 mL), NaOAc (32 mg, 390.10 μmol) was added. The resulting mixture was stirred at 100 °C for 12 h. The mixture was filtered and concentrated under reduced pressure to obtain a residue. The residue was purified by preparative HPLC (column: Phenomenex Luna C18 150 * 25 mm * 10 μm; mobile phase: [water (FA)-ACN]; gradient: 6%-36% B, 10 min) to give compound 1 (35.84 mg, 37% yield, 99.01% purity) as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm 1.88-2.06 (1H, m), 2.35(4H, br s), 2.57-2.69 (2H, m), 2.77-2.91 (1H, m), 3.49-3.62 (6H, m), 5.07(1H, dd, J = 13.2, 5.2 Hz), 7.47 (2H, s), 7.56 (1H, s), 7.79 (2H, s), 8.07-8.16 (1H, m), 11.11 (1H, s), 11.46-11.89 (1H, m); LC / MS (ESI) m / z = 547.2 [M +H] + LC / MS t R = 1.528 min.
[0278] Reaction Scheme 2: 2-(difluoromethoxy)-N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-4-fluoro-3-methylbenzenesulfonamide
[0279]
[0280] Step 1: 3-(difluoromethoxy)-1-fluoro-4-[(4-methoxyphenyl)methylthio]-2-methylbenzene
[0281] A mixture of intermediates A2 (400 mg, 1.57 mmol), (4-methoxyphenyl)methanethiol (242 mg, 1.57 mmol), Pd2(dba)3 (144 mg, 0.157 mmol), Xantphos (182 mg, 0.314 mmol), and DIEA (608 mg, 4.71 mmol) in 1,4-dioxane (6 mL) was degassed, purged three times with N2, and then stirred at 90 °C for 16 hours under N2 atmosphere. The reaction mixture was poured into water (20 mL) and extracted with EtOAc (30 mL × 3). The organic layer was washed with brine (20 mL × 2), dried over anhydrous Na2SO4, and concentrated under reduced pressure to obtain the residue. The residue was purified by silica gel column chromatography (0 to 10% EtOAc / PE gradient) to give 3-(difluoromethoxy)-1-fluoro-4-[(4-methoxyphenyl)methylthio]-2-methylbenzene (350 mg, 68.0% yield) as a colorless oil. 1 H NMR (400 MHz, DMSO-d6) δ ppm 2.16 (d, J =2.0 Hz, 3H), 3.74-3.71 (m, 3H), 4.14 (s, 2H), 6.72 (s, 1H), 6.89-6.83 (m,2H), 6.91 (s, 1H), 7.20-7.14 (m, 1H), 7.27-7.21 (m, 2H), 7.36-7.33 (m, 1H), 7.37 (s, 1H).
[0282] Step 2: 2-(difluoromethoxy)-4-fluoro-3-methylbenzenesulfonyl chloride (intermediate C2)
[0283] NCS (325 mg, 2.44 mmol) was added to a solution of 3-(difluoromethoxy)-1-fluoro-4-[(4-methoxyphenyl)methylthio]-2-methylbenzene (200 mg, 0.001 mmol) in AcOH (3 mL) and H₂O (1 mL). The resulting mixture was stirred at 35 °C for 1.5 h. The reaction mixture was poured into water (20 mL) and extracted with EtOAc (20 mL × 3). The organic layer was washed with brine (10 mL × 2), dried over anhydrous Na₂SO₄, and concentrated under reduced pressure to give the residue. The residue was purified by silica gel column chromatography (0 to 10% EtOAc / PE gradient) to give intermediate C2 (100 mg, 59.8% yield) as a colorless oil. 1H NMR (400 MHz, CDCl3) δ ppm 2.39 (3H, s), 6.52-6.90 (1H, m), 7.20 (1H, t, J = 8.4Hz), 7.98 (1H, dd, J = 8.8, 5.6 Hz).
[0284] Step 3: 2-(difluoromethoxy)-N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5- [4-Fluoro-3-methylbenzenesulfonamide (Compound 2)]
[0285] DMAP (4.45 mg, 0.0364 mmol) was added to a pyridine (2 mL) solution of intermediate C2 (100 mg, 0.364 mmol) and 5-amino-2-(2,6-dioxo-3-piperidinyl)isoindoline-1,3-dione (99.5 mg, 0.364 mmol). The resulting mixture was stirred at 35 °C for 1.5 h. The reaction mixture was concentrated under reduced pressure and purified by preparative HPLC (Welch Ultimate C18 150 * 40 mm * 10 μm; mobile phase: [water (FA)-ACN]; gradient: 24%-64% B, 25 min). Concentration under reduced pressure removed most of the ACN, and the residual solvent was removed by lyophilization to give compound 2 (16.0 mg, 8.59% yield) as a white solid. 1 H NMR (400 MHz, DMSO-d6) δ 2.05-1.99 (m, 1H), 2.20 (s,3H), 2.63-2.54 (m, 2H), 5.09 (dd, J = 5.6, 12.8 Hz, 1H), 7.29-6.92 (m, 1H),7.41 LC / MS (ESI) m / z =512.0 [M + H] + .
[0286] Reaction scheme 3: 2-chloro-N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-3-methylbenzenesulfonamide
[0287] [Method 1]
[0288]
[0289] Step 1: 2-Chloro-3-methylbenzenesulfonyl chloride (intermediate C3)
[0290] At 0 °C, HCl (12 M, 36 mL) and NaNO2 (2.92 g, 42.29 mmol) were added sequentially to an aqueous (50 mL) solution of 2-chloro-3-methylaniline (5 g, 35.31 mmol). The resulting mixture was stirred at 0 °C for 1 hour to obtain mixture 1. Simultaneously, SO2 (50 psi) was injected into AcOH (35 mL) at 0 °C for 20 minutes to obtain mixture 2. Mixture 2 was added to mixture 1 at 0 °C. The reaction mixture was stirred at 0 °C for 10 minutes, and then CuCl2 (3.06 g, 22.77 mmol) was added. The mixture was diluted with water (200 mL) and extracted with EtOAc (200 mL * 3). The organic layer was washed with saturated NaHCO3 (300 mL) and brine (300 mL) and dried over anhydrous Na2SO4. The product was concentrated under reduced pressure and purified by silica gel column chromatography (PE:EtOAc = 50:0 to 40:1) to give intermediate C3 (6.0 g, 75% yield), which was a yellow oil. 1 H NMR (400MHz, CDCl3) δ ppm 2.53 (3H, s), 7.40 (1H, t, J = 7.6 Hz), 7.62 (1H, dd, J =7.6, 0.8 Hz), 8.03 (1H, dd, J = 8.0, 0.8 Hz).
[0291] Step 2: 2-Chloro-N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-3-methyl Benzenesulfonamide (compound 3)
[0292] A mixture of intermediate C3 (4.1 g, 18.21 mmol) and 5-amino-2-(2,6-dioxo-3-piperidinyl)isoindoline-1,3-dione (4 g, 14.64 mmol) in pyridine (50 mL) was stirred at 25 °C for 12 hours. The reaction mixture was concentrated under reduced pressure and diluted with water (200 mL), HCl (1 M, 100 mL), and DCM (300 mL). The mixture was filtered, and the solid was concentrated under reduced pressure to give a crude product. The crude product was placed in water (18 mL) to give compound 3 (5.8 g, 84% yield, 98% purity) as a gray solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 1.92-2.09 (1H, m), 2.36 (3H, s), 2.40-2.49 (1H, m), 2.54-2.62 (1H, m), 2.76-2.95 (1H, m), 5.08 (1H, dd, J = 13.2,5.6 Hz), 7.44-7.55 (3H, m), 7.63-7.72 (1H, m), 7.79-7.84 (1H, m), 8.05 (1H,dd, J = 8.0, 1.2 Hz), 11.09 (1H, s), 11.61 (1H, s); LC / MS (ESI) m / z = 462.1 [M+ H] + .
[0293] [Method 2]
[0294]
[0295] Step 1: 4-[(2-chloro-3-methylphenyl)sulfonamido]benzene-1,2-dicarboxylic acid
[0296] To a solution of intermediate C3 (5.00 g, 22.23 mmol) in pyridine (50 mL), dimethyl 4-aminophenyl-1,2-dicarboxylate (3.1 g, 14.82 mmol) was added. The resulting mixture was stirred at 25 °C for 12 h. The reaction mixture was concentrated under reduced pressure, diluted with water (300 mL), and extracted with EtOAc (200 mL * 3). The organic layer was washed with brine (400 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by silica gel column chromatography (PE: EtOAc = 100:1 to 2:1) to give 4-[(2-chloro-3-methylphenyl)sulfonamido]phenyl-1,2-dicarboxylic acid (5.3 g, 75% yield, 83% purity) as a yellow solid. LC / MS (ESI) m / z = 398.1 [M + H] + .
[0297] Step 2: 4-[(2-chloro-3-methylphenyl)sulfonamido]phthalic acid
[0298] LiOH·H2O (1.96 g, 46.59 mmol) was added to a solution of 4-[(2-chloro-3-methylphenyl)sulfonamido]phenyl-1,2-dicarboxylic acid (5.3 g, 11.06 mmol) in THF (20 mL), MeOH (20 mL), and H2O (20 mL). The resulting mixture was stirred at 50 °C for 12 h. The reaction mixture was adjusted to pH 4 to 5 with 2 M HCl. The mixture was diluted with water (120 mL) and extracted with EtOAc (100 mL). The organic layer was washed with brine (200 mL * 3), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to give 4-[(2-chloro-3-methylphenyl)sulfonamido]phthalic acid (5.8 g, crude product) as a yellow solid. LC / MS (ESI) m / z = 369.0 [M + H] + .
[0299] Step 3: 2-Chloro-N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-3-methyl Benzenesulfonamide (compound 3)
[0300] To a solution of 4-[(2-chloro-3-methylphenyl)sulfonamido]phthalic acid (5 g, 35.31 mmol) and 3-aminopiperidin-2,6-dione (3.31 g, 20.14 mmol, HCl) in AcOH (100 mL), NaOAc (1.57 g, 19.19 mmol) was added. The resulting mixture was stirred at 100 °C for 12 h. The mixture was filtered and concentrated under reduced pressure to obtain a residue. The residue was purified by preparative HPLC (column: Phenomenex Luna C18 250 * 80 mm * 10 μm; mobile phase: [water (FA)-ACN]; gradient: 35%-65% B, 20 min) to give compound 3 (5320.28 mg, 72% yield, 99.18% purity) as a gray solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 1.95-2.04 (1H, m), 2.36 (3H, s), 2.40-2.48 (1H, m), 2.57 (1H, d, J = 18.4 Hz), 2.79-2.94 (1H, m), 5.07 (1H,dd, J = 12.8, 5.2 Hz), 7.44-7.54 (3H, m), 7.64-7.72 (1H, m), 7.78-7.86 (1H,m), 8.04 (1H, dd, J = 8.0, 1.2 Hz), 11.09 (1H, s), 11.61 (1H, s); LC / MS (ESI)m / z = 462.2 [M + H] + .
[0301] [Method 3]
[0302]
[0303] Step 1: 2-Chloro-N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-3-methyl Benzenesulfonamide
[0304] Xantphos (1.41 g, 2.43 mmol), TEA (3.64 g, 35.92 mmol), and Pd2(dba)3 (1.56 g, 1.70 mmol) were added to a DMF (100 mL) solution of 1-bromo-2-chloro-3-methylbenzene (5 g, 24.33 mmol) and (4-methoxyphenyl)methanethiol (3.94 g, 25.55 mmol) at 25 °C under a nitrogen atmosphere. The reaction mixture was then stirred at 130 °C for 15 hours. Water (300 mL) was added to the reaction mixture, and the mixture was extracted with EtOAc (250 mL × 3). The combined organic layers were washed with brine (300 mL × 3), dried over Na2SO4, filtered, and then concentrated under reduced pressure to give the crude product. The crude product was purified by silica gel column chromatography (SiO2, petroleum ether / ethyl acetate = 100 / 0 to 100 / 1) to give 2-chloro-1-[(4-methoxyphenyl)methylthio]-3-methylbenzene (5 g, 74% yield) as a white solid. 1 H NMR (400 MHz, CDCl3) δ ppm2.39 (3H, s), 3.80 (3H, s), 4.11 (2H, s), 6.78-6.91 (2H, m), 7.02-7.14 (3H,m), 7.29 (2H, d, J = 8.8 Hz).
[0305] Step 2: 2-Chloro-3-methylbenzenesulfonyl chloride (intermediate C3)
[0306] At 0 °C, 1,3-dichloro-5,5-dimethylimidazolium-2,4-dione (7.07 g, 35.88 mmol) was added to a solution of 2-chloro-1-[(4-methoxyphenyl)methylthio]-3-methylbenzene (5 g, 17.93 mmol), acetic acid (5 mL), and water (3 mL) in ACN (120 mL). The reaction mixture was stirred at 0 °C for 5 minutes. Subsequently, the reaction mixture was adjusted to pH 7 with an aqueous sodium bicarbonate solution. The reaction mixture was concentrated and then extracted with water (100 mL) using EtOAc (200 mL × 3). The combined organic layers were washed with brine (300 mL), dried over Na2SO4, filtered, and then concentrated under reduced pressure to give the crude product. The crude product was purified by silica gel column chromatography (SiO2, petroleum ether / ethyl acetate = 100 / 0 to 100 / 1) to give 2-chloro-3-methylbenzenesulfonyl chloride (3.2 g, 79% yield) as a colorless oil. 1 H NMR (400 MHz, CDCl3) δ ppm 2.53 (3H, s), 7.36-7.42 (1H, m), 7.62 (1H, dd, J = 7.6, 0.8 Hz), 8.04 (1H, dd, J = 8.4, 1.2Hz).
[0307] Steps 3 to 5: 2-chloro-N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-3- Toluenesulfonamide (compound 3)
[0308] 2-Chloro-3-methylbenzenesulfonyl chloride was reacted in the same manner as steps 1 to 3 of method 2 to give compound 3.
[0309] Reaction scheme 4: 2-bromo-N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-3-methylbenzenesulfonamide
[0310]
[0311] Step 1: 2-Bromo-3-methylbenzenesulfonyl chloride
[0312] A solution of 12 M, 1.71 mL hydrochloric acid in 3 mL of water was slowly added to a solution of 2-bromo-3-methylaniline (1 g, 5.37 mmol) in acetic acid (3 mL) and ACN (15 mL). After 10 minutes, a solution of 371 mg, 5.38 mmol, NaNO2 in 2 mL of water was slowly added at 0 °C. The reaction mixture was stirred at 25 °C for 2 hours to obtain solution 1. In a separate flask, SO2 (50 psi) was bubbled into 15 mL of acetic acid at 10 °C for 20 minutes. Subsequently, a solution of 723 mg, 5.38 mmol, CuCl2 in 3 mL of water was added to obtain solution 2. Solution 1 was slowly added to solution 2 at 0 °C. The reaction mixture was stirred at 25 °C for 6 hours. The reaction mixture was diluted with 30 mL of EtOAc, poured into an ice-cold aqueous solution of sodium bicarbonate (100 mL), and then extracted with 30 mL of EtOAc. The combined organic layers were washed with an aqueous solution of sodium bicarbonate (100 mL × 5) and brine (100 mL), dried over Na₂SO₄, filtered, and then concentrated under reduced pressure to obtain the crude product. The crude product was purified by silica gel column chromatography (SiO₂, petroleum ether:ethyl acetate = 100:0 to 20:1) to give 2-bromo-3-methylbenzenesulfonyl chloride (0.5 g, 35% yield) as a yellow solid. 1 H NMR (400 MHz, CDCl3) δ ppm 2.57 (3H, s), 7.37-7.49 (1H, m), 7.53-7.65 (1H, m), 8.06 (1 H, dd, J = 8.0, 0.8 Hz).
[0313] Step 2: Dimethyl 4-[(2-bromo-3-methylphenyl)sulfonamido]benzene-1,2-dicarboxylate (intermediate D2)
[0314] To a solution of 2-bromo-3-methylbenzenesulfonyl chloride (80 mg, 296.80 μmol) in pyridine (1 mL), dimethyl 4-aminophenyl-1,2-dicarboxylate (40 mg, 191.21 μmol) was added. The reaction mixture was then stirred at 25 °C for 1 hour. The reaction mixture was concentrated and then extracted with water (10 mL) using EtOAc (20 mL × 3). The combined organic layers were washed with brine (30 mL), dried over Na₂SO₄, filtered, and concentrated under reduced pressure to give the crude product. The crude product was purified by preparative TLC (SiO₂, petroleum ether:ethyl acetate = 2:1) to give intermediate D2 (80 mg, 92% yield, 97% purity) as a colorless oil. LC / MS (ESI) m / z = 442.2 [M + H] + .
[0315] Step 3: 4-[(2-bromo-3-methylphenyl)sulfonamido]phthalic acid
[0316] LiOH·H₂O (33 mg, 786.46 μmol) was added to a solution of intermediate D2 (80 mg, 175.45 μmol) in THF (1 mL), MeOH (1 mL), and water (1 mL). The reaction mixture was then stirred at 50 °C for 12 hours. The pH of the reaction mixture was then adjusted to 4-5 with hydrochloric acid (2 M). Water (20 mL) was added to the reaction mixture, and the mixture was extracted with EtOAc (30 mL × 3). The combined organic layers were washed with brine (30 mL × 3), dried over Na₂SO₄, filtered, and concentrated under reduced pressure to give 4-[(2-bromo-3-methylphenyl)sulfonamide]phthalic acid (60 mg, crude product) as a white solid. LC / MS (ESI) m / z = 396.2 [M - OH] + .
[0317] Step 4: 2-Bromo-N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-3-methyl Benzenesulfonamide (compound 4)
[0318] NaOAc (11 mg, 134.10 μmol) was added to a solution of 4-[(2-bromo-3-methylphenyl)sulfonamido]phthalic acid (50 mg, 120.71 μmol) and 3-aminopiperidin-2,6-dione (26 mg, 157.97 μmol) in acetic acid (1 mL). The reaction mixture was then stirred at 100 °C for 12 hours. The reaction mixture was concentrated under reduced pressure, and the crude product was purified by preparative HPLC (column: Phenomenex Luna C18 150 * 25 mm * 10 μm; mobile phase: [water (FA)-ACN]; B%: 30%–60%, 10 min) to give compound 4 (38.94 mg, 63% yield, 98.71% purity) as a gray solid. 1HNMR (400 MHz, DMSO-d6) δ ppm 1.94-2.07 (1H, m), 2.40 (3H, s), 2.45 (1H, s), 2.56 (1H, d, J = 19.2 Hz), 2.79-2.93 (1H, m), 5.07 (1H, dd, J = 12.8, 5.2Hz), 7.46-7.56 (3H, m), 7.65 (1H, d, J = 6.8 Hz), 7.81 (1H, d, J = 8.4 Hz), 8.05 (1H, d, J = 7.2 Hz), 11.09 (1H, s), 11.61 (1H, s); LC / MS (ESI) m / z =506.1 [M + H] + .
[0319] Reaction scheme 5: N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-2-iodo-3-methylbenzenesulfonamide
[0320]
[0321] Step 1: Dimethyl 4-[(2-iodo-3-methylphenyl)sulfonamido]benzene-1,2-dicarboxylate (intermediate D3)
[0322] Under a nitrogen atmosphere, N,N'-dimethylethane-1,2-diamine (31 mg, 351.67 μmol) was added to a solution of intermediate D2 (70 mg, 158.27 μmol), NaI (476 mg, 3.18 mmol), and CuI (35 mg, 183.78 μmol) in 1,4-dioxane (5 mL). The reaction mixture was then stirred at 120 °C for 24 h under a nitrogen atmosphere. The reaction mixture was diluted with EtOAc (20 mL), adjusted to pH 5 with hydrochloric acid (1 M), and extracted with EtOAc (20 mL × 3). The combined organic layers were washed with brine (40 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give the crude product. The crude product was purified by silica gel column chromatography (SiO2, petroleum ether:ethyl acetate = 4:1 to 3:1) to give intermediate D3 (50 mg, 65% yield) as a yellow solid. LC / MS (ESI) m / z = 490.0 [M + H] + .
[0323] Step 2: 4-[(2-iodo-3-methylphenyl)sulfonamido]phthalic acid
[0324] LiOH·H₂O (13 mg, 309.79 μmol) was added to a solution of intermediate D3 (50 mg, 102.19 μmol) in THF (3 mL), MeOH (1 mL), and water (1 mL). The reaction mixture was then stirred at 50 °C for 12 hours. The reaction mixture was subsequently diluted with water (20 mL), adjusted to pH 5 with hydrochloric acid (1 M), and extracted with EtOAc (15 mL × 3). The combined organic layers were washed with brine (20 mL), dried over Na₂SO₄, filtered, and concentrated under reduced pressure to give 4-[(2-iodo-3-methylphenyl)sulfonamide]phthalic acid (47 mg, crude product) as a yellow solid. LC / MS (ESI) m / z = 483.9 [M + Na] + .
[0325] Step 3: N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-2-iodo-3-methyl Benzenesulfonamide (compound 5)
[0326] NaOAc (11 mg, 134.10 μmol) was added to a solution of 4-[(2-iodo-3-methylphenyl)sulfonamido]phthalic acid (47 mg, 101.90 μmol) and 3-aminopiperidin-2,6-dione (25 mg, 151.89 μmol, hydrochloride) in acetic acid (3 mL). The reaction mixture was then stirred at 100 °C for 12 h. The reaction mixture was concentrated under reduced pressure, and the crude product was purified by preparative HPLC (formic acid added, column: Phenomenex Luna C18 150 * 25 mm * 10 μm; mobile phase: [water (FA)-ACN]; B%: 36%–56%, 10 min) to give compound 5 (35.46 mg, 62% yield, 98.40% purity) as a green solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm 1.92-2.05 (1H, m), 2.46 (3H,s), 2.53-2.62 (2H, m), 2.80-2.91 (1H, m), 5.06 (1H, dd, J = 12.8, 5.6 Hz), 7.44 LC / MS 7.48-7.54 (1H, m) (ESI) m / z =554.1 [M + H] + .
[0327] Reaction Scheme 6: 2-Chloro-N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-3-(methylaminomethyl)benzenesulfonamide
[0328]
[0329]
[0330] Step 1: Dimethyl 4-[(2-chloro-3-formylphenyl)sulfonamido]benzene-1,2-dicarboxylate
[0331] MnO2 (252 mg, 2.90 mmol) was added to an 8 mL solution of intermediate D1 (150 mg, 362.47 μmol) in DCM, and the reaction mixture was stirred at 20 °C for 40 hours. The reaction mixture was filtered, and the filtrate was concentrated to give dimethyl 4-[(2-chloro-3-formylphenyl)sulfonamide]benzene-1,2-dicarboxylate (150 mg, crude product), as a yellow oil. LC / MS (ESI) m / z = 412.0 [M + H] + .
[0332] Step 2: Dimethyl 4-[[2-chloro-3-(methylaminomethyl)phenyl]sulfonamide]benzene-1,2-dicarboxylate (intermediate) Body D4)
[0333] Et3N (36 mg, 355.77 μmol) was added to a solution of 4-[(2-chloro-3-formylphenyl)sulfonamido]benzene-1,2-dicarboxylate (75 mg, 182.12 μmol) and methylamine (25 mg, 370.27 μmol, hydrochloride) in DCM (3 mL) and MeOH (3 mL). Acetic acid (33 mg, 549.54 μmol) was then added. The reaction mixture was stirred at 20 °C for 5 hours, and then 2-methylpyridineborane (39 mg, 364.62 μmol) was added. The reaction mixture was then stirred at 20 °C for 12 hours. The reaction mixture was concentrated under reduced pressure, and the crude product was purified by preparative HPLC (formic acid added, column: Phenomenex Luna C18 150 * 25 mm * 10 μm; mobile phase: [water (FA)-ACN]; B%: 8%-38%, 2 min) to give intermediate D4 (40 mg, 51% yield) as a grayish-white solid. LC / MS (ESI) m / z = 427.1 [M + H] + .
[0334] Step 3: 4-[[3-[[tert-Butoxycarbonyl(methyl)amino]methyl]-2-chlorophenyl]sulfonamido]benzene-1,2-di dimethyl formate
[0335] Boc₂O (40 mg, 183.28 μmol) and Et₃N (30 mg, 296.47 μmol) were added to a DCM solution of intermediate D₄ (40 mg, 93.71 μmol) in 3 mL, and the mixture was stirred at 20 °C for 2 h. The reaction mixture was poured into water (10 mL) and extracted with DCM (10 mL × 3). The combined organic layers were washed with brine (20 mL), dried over Na₂SO₄, and concentrated under reduced pressure to give the crude product. The crude product was purified by preparative TLC (silica gel plate, petroleum ether:ethyl acetate = 1:1) to give dimethyl 4-[[3-[[tert-Butoxycarbonyl(methyl)amino]methyl]-2-chlorophenyl]sulfonamide]phenyl-1,2-dicarboxylic acid (45 mg, 91% yield) as a colorless oil. LC / MS (ESI) m / z = 549.1 [M + Na] + .
[0336] Step 4: 4-[[3-[[tert-Butoxycarbonyl(methyl)amino]methyl]-2-chlorophenyl]sulfonamido]phthalic acid
[0337] LiOH·H₂O (18 mg, 428.94 μmol) was added to a solution of 4-[[3-[[tert-Butoxycarbonyl(methyl)amino]methyl]-2-chlorophenyl]sulfonamide]phenyl-1,2-dicarboxylic acid dimethyl ester (45 mg, 85.39 μmol) in THF (1 mL), MeOH (1 mL), and water (1 mL). The reaction mixture was stirred at 50 °C for 12 hours. Subsequently, the reaction mixture was concentrated under reduced pressure, diluted with water (10 mL), adjusted to pH 5 with hydrochloric acid (1 M), and extracted with EtOAc (10 mL × 3). The combined organic layers were washed with brine (20 mL), dried over Na₂SO₄, filtered, and then concentrated under reduced pressure to give 4-[[3-[[tert-Butoxycarbonyl(methyl)amino]methyl]-2-chlorophenyl]sulfonamide]phthalic acid (43 mg, crude product) as a colorless oil. LC / MS(ESI) m / z = 521.1 [M + Na] + .
[0338] Step 5: N-[[2-chloro-3-[[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindololin-5-yl]amine] [Sulfoyl]phenyl]methyl]-N-methyl-carbamate tert-butyl ester
[0339] CDI (28 mg, 172.68 μmol) was added to a solution of 4-[[3-[[tert-Butoxycarbonyl(methyl)amino]methyl]-2-chlorophenyl]sulfonamido]phthalic acid (43 mg, 86.18 μmol) in ACN (2 mL), and the mixture was stirred at 20 °C for 30 min. Subsequently, 3-aminopiperidin-2,6-dione (18 mg, 109.36 μmol, hydrochloride) was added, and the mixture was stirred at 20 °C for 12.5 h. The reaction mixture was poured into water (20 mL) and extracted with EtOAc (10 mL × 3). The combined organic layers were washed with brine (20 mL), dried over Na₂SO₄, and concentrated under reduced pressure to give N-[[2-chloro-3-[[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]aminesulfonyl]phenyl]methyl]-N-methyl-carbamate tert-butyl ester (51 mg, crude product), a pale yellow oil. LC / MS (ESI) m / z = 613.2 [M + Na] + .
[0340] Step 6: 2-Chloro-N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-3-(methyl) (Compound 6) (aminomethyl)benzenesulfonamide
[0341] Hydrochloric acid / dioxane (4 M, 0.5 mL) was added to a DCM solution of N-[[2-chloro-3-[[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]aminesulfonyl]phenyl]methyl]-N-methyl-carbamate tert-butyl (51 mg, 86.29 μmol) in 1.5 mL. The reaction mixture was stirred at 20 °C for 12 h. The reaction mixture was concentrated under reduced pressure and then purified by preparative HPLC (with hydrochloric acid, column: YMC Triart C18 150 * 25 mm * 5 μm; mobile phase: [water (hydrochloric acid)-ACN]; gradient: 13%-43% B, 10 min) to give compound 6 (39.07 mg, 85% yield, 99.44% purity, hydrochloride) as a grayish-white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 1.92-2.06 (1H, m),2.40-2.48 (2H, m), 2.58-2.62 (3H, m), 2.76-2.93 (1H, m), 4.22-4.38 (2H, m),5.08 (1H, dd, J = 12.8, 5.2 Hz), 7.47-7.59 (2H, m), 7.70 (1H, t, J = 8.0 Hz), 7.83 (1H, d, J = 8.0 Hz), 7.97 (1H, d, J = 7.2 Hz), 8.25 (1H, d, J = 6.8 Hz),9.16-9.49 (2H, m), 11.12 (1H, s), 11.83 (1H, s); LC / MS (ESI) m / z = 491.0 [M +H] + .
[0342] Reaction Scheme 7: 2-Chloro-N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-3-(trifluoromethoxymethyl)benzenesulfonamide
[0343]
[0344] Step 1: 4-[[2-chloro-3-(trifluoromethoxymethyl)phenyl]sulfonamido]benzene-1,2-dicarboxylic acid dimethyl ester
[0345] Under a nitrogen atmosphere, 2-fluoropyridine (141 mg, 1.45 mmol), and trimethyl(trifluoromethyl)silane (206 mg, 1.45 mmol) were added to a solution of AgOTf (373 mg, 1.45 mmol), 1-(chloromethyl)-4-fluoro-diazobicyclo[2.2.2]octanebis(tetrafluoroborate) (Selectfluor, 257 mg, 725.46 μmol), KF (112 mg, 1.93 mmol), and intermediate D1 (200 mg, 483.29 μmol) in EtOAc (2.5 mL). The reaction mixture was then stirred at 20 °C for 12 hours under a nitrogen atmosphere. The reaction mixture was filtered, the filtrate was concentrated under reduced pressure, and purified by preparative TLC (silica gel plate, petroleum ether:ethyl acetate = 1:1) to give dimethyl 4-[[2-chloro-3-(trifluoromethoxymethyl)phenyl]sulfonamide]phenyl-1,2-dicarboxylate (15 mg, 6% yield, 97% purity), as a yellow oil. LC / MS (ESI) m / z = 482.0 [M +H] + .
[0346] Step 2: 4-[[2-chloro-3-(trifluoromethoxymethyl)phenyl]sulfonamido]phthalic acid
[0347] LiOH·H₂O (7 mg, 166.81 μmol) was added to a solution of dimethyl 4-[[2-chloro-3-(trifluoromethoxymethyl)phenyl]sulfonamido]phenyl-1,2-dicarboxylate (15 mg, 30.20 μmol) in THF (1 mL), MeOH (1 mL), and water (1 mL). The reaction mixture was stirred at 50 °C for 12 hours. The reaction mixture was concentrated under reduced pressure to give 4-[[2-chloro-3-(trifluoromethoxymethyl)phenyl]sulfonamido]phthalic acid (14 mg, crude product) as a white solid. LC / MS (ESI) m / z = 436.0 [M - OH + H] + .
[0348] Step 3: 2-Chloro-N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-3-(tri... Fluoromethoxymethyl)benzenesulfonamide (compound 7)
[0349] NaOAc (3 mg, 36.57 μmol) was added to a solution of 4-[[2-chloro-3-(trifluoromethoxymethyl)phenyl]sulfonamido]phthalic acid (14 mg, 30.85 μmol) and 3-aminopiperidin-2,6-dione (8 mg, 48.61 μmol, hydrochloride) in acetic acid (3 mL). The reaction mixture was then stirred at 100 °C for 12 h. The reaction mixture was concentrated under reduced pressure, and the crude product was purified by preparative HPLC (formic acid addition, column: Phenomenex Luna C18 150 * 25 mm * 10 μm; mobile phase: [water (FA)-ACN]; gradient: 36%-66% B, 10 min) to give compound 7 (3.09 mg, 18% yield, 98.88% purity) as a green solid. 1 H NMR (400 MHz, CDCl3) δ ppm 2.08-2.20 (1H, m), 2.72-2.83 (2H, m), 2.87-2.97 (1H, m), 4.94 (1H, dd, J = 12.4, 5.6 Hz), 5.15 (2H,s), 7.46-7.50 (1H, m), 7.51-7.56 (2H, m), 7.60 (1H, s), 7.76 (2H, d, J = 8.0Hz), 7.90-8.04 (1H, m), 8.14-8.26 (1H, m); LC / MS (ESI) m / z = 546.0 [M + H] + .
[0350] Reaction Scheme 8: 2-(difluoromethoxy)-N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-3-methylbenzenesulfonamide
[0351]
[0352] Step 1: (2-(difluoromethoxy)-3-methylphenyl)(4-methoxybenzyl)thion
[0353] Pd2(dba)3 (773 mg, 843.74 μmol) was added to a DMF (30 mL) solution of intermediate A3 (4 g, 16.87 mmol), (4-methoxyphenyl)methanethiol (3.12 g, 20.25 mmol), Xantphos (1.46 g, 2.53 mmol), and TEA (3.42 g, 33.75 mmol). The reaction mixture was stirred at 130 °C for 12 h. Water (180 mL) was added to the reaction mixture, and the mixture was extracted with EtOAc (60 mL × 3). The combined organic layers were washed with brine (50 mL × 3), dried over Na2SO4, filtered, and then concentrated under reduced pressure to give the crude product. The crude product was purified by silica gel column chromatography (SiO2, petroleum ether: ethyl acetate = 1:0 to 10:1) to give (2-(difluoromethoxy)-3-methylphenyl)(4-methoxybenzyl)thione (4.1 g, 78% yield) as a yellow solid. 1 H NMR (400 MHz, CDCl3) δ ppm 2.34 (3H, s), 3.79 (3H, s), 4.08(2H, s), 6.33-6.74 (1H, m), 6.82 (2H, d, J = 8.4 Hz), 7.03-7.12 (2H, m),7.16-7.23 (3H, m).
[0354] Step 2: 2-(difluoromethoxy)-3-methylbenzenesulfonyl chloride (intermediate C4)
[0355] To a solution of (2-(difluoromethoxy)-3-methylphenyl)(4-methoxybenzyl)thion (4 g, 12.89 mmol) in ACN (30 mL), acetic acid (1.5 mL), and water (1.5 mL), 1,3-dichloro-5,5-dimethylimidazolidine-2,4-dione (5.08 g, 25.78 mmol) was added, and the reaction mixture was stirred at 10 °C for 30 min. Ice water (30 mL) was added to the reaction mixture, which was quenched with an aqueous sodium bicarbonate solution (20 mL), and then extracted with DCM (40 mL × 2). The combined organic layers were dried over Na₂SO₄, filtered, and concentrated under reduced pressure to give a crude product. The crude product was purified by silica gel column chromatography (SiO₂, petroleum ether:ethyl acetate = 1:0 to 20:1) to give intermediate C4 (2 g, 60% yield) as a colorless oil. 1 H NMR (400 MHz, CDCl3)δ ppm 2.49 (3H, s), 6.49-6.90 (1H, m), 7.36-7.45 (1H, m), 7.64-7.71 (1H, m), 7.94 (1H, dd, J = 8.0, 0.8 Hz).
[0356] Step 3: Dimethyl 4-((2-(difluoromethoxy)-3-methylphenyl)sulfonamide)phthalate (intermediate) D5)
[0357] The reaction mixture of intermediate C4 (1.96 g, 7.65 mmol) and dimethyl 4-aminophenyl-1,2-dicarboxylate (1.6 g, 7.65 mmol) in pyridine (15 mL) was stirred at 25 °C for 1 hour under a nitrogen atmosphere. The reaction mixture was concentrated and then extracted with EtOAc (20 mL × 3). The combined organic layers were washed with water (30 mL × 2) and brine (30 mL). The mixture was then dried over Na2SO4, filtered, concentrated under reduced pressure, and the crude product was purified by silica gel column chromatography (SiO2, petroleum ether:ethyl acetate = 20:1 to 3:1) to give intermediate D5 (3 g, 91% yield) as a yellow oil. 1H NMR (400 MHz, CDCl3) δppm 2.42 (3H, s), 3.88 (3H, s), 3.92 (3H, s), 6.50-6.91 (1H, m), 7.19 (1H,s), 7.28-7.32 (2H, m), 7.37 (1H, d, J = 2.4 Hz), 7.50 (1H, dd, J = 7.6, 0.8Hz), 7.66 (1H, d, J = 8.4 Hz), 7.83 (1H, dd, J = 7.6, 1.2 Hz); LC / MS (ESI) m / z= 430.1 [M + H] + .
[0358] Step 4: 4-[[2-(difluoromethoxy)-3-methylphenyl]sulfonamide]phthalic acid
[0359] At 25 °C, LiOH·H₂O (879 mg, 20.96 mmol) was added to a solution of intermediate D5 (3 g, 6.99 mmol) in THF (10 mL), MeOH (10 mL), and water (10 mL). The reaction mixture was stirred at 50 °C for 12 hours. The reaction mixture was diluted with water (100 mL) and then extracted with EtOAc (50 mL × 2). The pH of the reaction mixture was adjusted to 4 to 5 by adding hydrochloric acid (2 M) to the aqueous layer, and then extracted with EtOAc (50 mL × 3). The combined organic layers were washed with brine (30 mL × 2), dried over Na₂SO₄, filtered, and concentrated under reduced pressure to give 4-[[2-(difluoromethoxy)-3-methylphenyl]sulfonamide]phthalic acid (2.7 g, 96% yield) as a brown solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm2.30 (3H, s), 6.80-7.21 (1H, m), 7.24 (1H, dd, J = 8.4, 2.4 Hz), 7.32 (1H,s), 7.36-7.45 (1H, m), 7.57-7.69 (2H, m), 7.76 (1H, d, J = 6.8 Hz), 10.93(1H, s), 12.38-13.74 (2H, m); LC / MS (ESI) m / z = 424.1 [M + Na] + .
[0360] Step 5: 2-(difluoromethoxy)-N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5- [3-Methylbenzenesulfonamide (compound 8)]
[0361] To a solution of 4-[[2-(difluoromethoxy)-3-methylphenyl]sulfonamido]phthalic acid (1.5 g, 3.74 mmol) and NaOAc (613 mg, 7.47 mmol) in acetic acid (20 mL), 3-aminopiperidin-2,6-dione (720 mg, 4.37 mmol, hydrochloride) was added. The reaction mixture was then stirred at 100 °C for 12 h. The reaction mixture was filtered and concentrated under reduced pressure. The crude product was purified by preparative HPLC (column: Phenomenex Luna C18 150 * 40 mm * 15 μm; mobile phase: [water (FA)-ACN]; gradient: 33%-63% B, 15 min) to give compound 8 (1.26 g, 67% yield, 98.62% purity) as a pink solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm 1.96-2.06 (1H, m), 2.30(3H, s), 2.41-2.48 (1H, m), 2.59 (1H, d, J = 2.8 Hz), 2.79-2.93 (1H, m), 5.08(1H, dd, J = 12.8, 5.2 Hz), 6.84-7.27 (1H, m), 7.43 (1H, t, J = 8.0 Hz), 7.47-7.55 (2H, m), 7.65 (1H, d, J = 7.2 Hz), 7.78-7.87 (2H, m), 11.10 (1H,s), 11.36 (1H, s); LC / MS (ESI) m / z = 494.2 [M + H] + .
[0362] Reaction Scheme 9: 2-chloro-N-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)-3-(hydroxymethyl)benzenesulfonamide
[0363]
[0364] Step 1: 3-Bromo-2-chlorobenzenesulfonyl chloride
[0365] Hydrochloric acid (12 M, 10.00 mL) and NaNO2 (804 mg, 11.65 mmol) were added sequentially to a 20 mL aqueous solution of 3-bromo-2-chloroaniline (2 g, 9.69 mmol) under stirring. The reaction mixture was stirred at 0 °C for 1 hour to obtain solution 1. In a separate flask, SO2 (15 psi) was bubbled into 14 mL acetic acid at 0 °C for 20 minutes to obtain solution 2. Solution 2 was slowly added to solution 1 at 0 °C and stirred at the same temperature for 10 minutes. CuCl2 (848 mg, 6.31 mmol) was added, and the reaction mixture was stirred at 0 °C for 1 hour. Water (80 mL) was poured into the reaction mixture, and the mixture was extracted with EtOAc (50 mL × 3). The combined organic layers were washed with brine (50 mL × 3), dried over Na2SO4, filtered, and then concentrated under reduced pressure to obtain the crude product. The crude product was purified by silica gel column chromatography (SiO2, petroleum ether: ethyl acetate = 100:0 to 49:1) to give 3-bromo-2-chlorobenzenesulfonyl chloride (0.11 g, 4% yield) as a yellow oil. 1 H NMR (400 MHz, CDCl3) δ ppm 7.41 (1H,t, J = 8.0 Hz), 8.03 (1H, dd, J = 8.0, 1.6 Hz), 8.17 (1H, dd, J = 8.0, 1.2Hz).
[0366] Step 2: Dimethyl 4-[(3-bromo-2-chlorophenyl)sulfonamido]benzene-1,2-dicarboxylate (intermediate D6)
[0367] To a solution of 3-bromo-2-chlorobenzenesulfonyl chloride (110 mg, 379.36 μmol) in pyridine (2 mL), dimethyl 4-aminophenyl-1,2-dicarboxylate (55 mg, 262.91 μmol) was added. The reaction mixture was stirred at 25 °C for 1 hour. The reaction mixture was concentrated and then poured into water (20 mL), and extracted with EtOAc (30 mL × 3). The combined organic layers were washed with brine (10 mL), dried over Na₂SO₄, filtered, and concentrated under reduced pressure to give the crude product. The crude product was purified by silica gel column chromatography (SiO₂, petroleum ether:ethyl acetate = 10:1 to 4:1) to give intermediate D6 (60 mg, 46% yield, 93% purity) as a white solid. LC / MS (ESI) m / z = 431.9 [M - 32 + H] + .
[0368] Step 3: 4-[(3-bromo-2-chlorophenyl)sulfonamido]phthalic acid
[0369] LiOH·H₂O (11 mg, 266.38 μmol) was added to a solution of intermediate D6 (30 mg, 60.30 μmol) in THF (1 mL), MeOH (1 mL), and water (1 mL). The reaction mixture was stirred at 50 °C for 12 h. The pH of the reaction mixture was adjusted to 4 to 5 by adding hydrochloric acid (2 M), followed by the addition of water (20 mL) and extraction with EtOAc (10 mL × 3). The combined organic layers were washed with brine (20 mL × 3), dried over Na₂SO₄, filtered, and concentrated under reduced pressure to give 4-[(3-bromo-2-chlorophenyl)sulfonamide]phthalic acid (40 mg, crude product) as a yellow solid. LC / MS (ESI) m / z = 435.9 [M + H] + .
[0370] Step 4: 3-Bromo-2-chloro-N-[2-(2,6-dioxopiridin-3-yl)-1,3-dioxoisoindoline-5-yl]benzene sulfonamide
[0371] NaOAc (10 mg, 121.91 μmol) was added to a solution of 4-[(3-bromo-2-chlorophenyl)sulfonamido]phthalic acid (40 mg, 92.03 μmol) and 3-aminopiperidin-2,6-dione (20 mg, 121.51 μmol, hydrochloride) in acetic acid (1 mL). The reaction mixture was stirred at 100 °C for 12 hours. The reaction mixture was filtered and then concentrated under reduced pressure to give the crude product. The crude product was purified by preparative HPLC (column: Phenomenex Luna C18 150 * 25 mm * 10 μm; mobile phase: [water (FA)-ACN]; gradient: 30%-50% B, 10 min) to give 3-bromo-2-chloro-N-[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl]benzenesulfonamide (8 mg, 17% yield) as a yellow solid. LC / MS (ESI) m / z = 528.0 [M + H] + .
[0372] Step 5: 2-Chloro-N-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)-3-(hydroxy) Methylbenzenesulfonamide (compound 9)
[0373] Triphenylphosphine palladium (562 μg, 1.52 μmol) was added to a solution of tributyltin methanol (8 mg, 24.92 μmol) and 3-bromo-2-chloro-N-[2-(2,6-dioxopiridine-3-yl)-1,3-dioxoisoindoline-5-yl]benzenesulfonamide (8 mg, 15.19 μmol) in 1,4-dioxane (1 mL) at 25 °C under a nitrogen atmosphere. The reaction mixture was stirred at 100 °C for 12 h. The reaction mixture was concentrated under reduced pressure, and the crude product was purified by preparative HPLC (column: Phenomenex Luna C18150 * 25 mm * 10 μm; mobile phase: [water (TFA)-ACN]; gradient: 28%-48% B, 7 min) to give compound 9 (5.42 mg, 73% yield, 97.68% purity) as a grayish-white solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm1.93-2.07 (1H, m), 2.32-2.44 (1H, m), 2.55-2.69 (1H, m), 2.76-2.93 (1H, m),4.57 (2H, s), 5.07 (1H, dd, J = 12.8, 5.2 Hz), 5.42-5.65 (1H, m), 7.45-7.54(2H, m), 7.61 (1H, s), 7.82 (2H, t, J = 7.2 Hz), 8.10 (1H, d, J = 7.6 Hz), 11.10 (1H, s), 11.65 (1H, s); LC / MS (ESI) m / z = 478.2 [M + H] + .
[0374] Example 1: 2-(difluoromethoxy)-N-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)-3-ethylbenzenesulfonamide (Compound 10)
[0375]
[0376] Intermediate A4 was reacted in the same manner as steps 1 to 5 of reaction scheme 8 to give compound 10 (53.78 mg, 51% yield, 98.89% purity) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 1.08-1.16 (3H, m), 1.97-2.05 (1H, m), 2.42-2.47 (1H, m), 2.54-2.63 (1H, m), 2.65-2.75 (2H, m), 2.80-2.90 (1H, m), 5.03 (1H, dd, J = 12.8, 5.6 Hz), 6.83-7.27(1H, m), 7.42-7.54 (3H, m), 7.67-7.72 (1H, m), 7.78-7.82 (2H, m), 11.10 (1H,s), 11.32 (1H, s); LC / MS (ESI) m / z = 508.2 [M + H] + .
[0377] Example 2: 2-Chloro-N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-3-ethylbenzenesulfonamide (Compound 11)
[0378]
[0379] Intermediate A5 was reacted in the same manner as steps 1 to 5 of reaction scheme 8 to give compound 11 (7.8 mg, 65% yield, 98.96% purity) as a yellow solid. 1 H NMR (400 MHz, CD3OD) δ ppm 1.19 (3H,t, J = 7.6 Hz), 2.00-2.14 (1H, m), 2.62-2.86 (5H, m), 5.07 (1H, dd, J = 12.8,5.6 Hz), 7.38-7.46 (1H, m), 7.48-7.52 (1H, m), 7.56 (1H, dd, J = 7.6, 2.0Hz), 7.60 (1H, d, J = 1.6 Hz), 7.72 (1H, d, J = 8.4 Hz), 8.09 (1H, dd, J =8.0, 1.6 Hz); LC / MS (ESI) m / z = 476.1 [M + H] + .
[0380] Example 3: 2-Chloro-N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-3-ethyl-4-fluorobenzenesulfonamide (Compound 12)
[0381]
[0382] Intermediate A6 was reacted in the same manner as steps 1 to 5 of reaction scheme 8 to give compound 12 (69.93 mg, 47% yield, 99.9% purity) as a white solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm 1.07(3H, t, J = 7.2 Hz), 1.95-2.05 (1H, m), 2.31-2.46 (1H, m), 2.57-2.70 (1H, m),2.71-2.80 (2H, m), 2.80-2.91 (1H, m), 5.07 (1H, dd, J = 12.8, 5.6 Hz), 7.40-7.55 (3H, m), 7.75-7.87 (1H, m), 8.12 (1H, dd, J = 8.8, 5.6 Hz), 11.09 (1H, s), 11.66 (1H, s); LC / MS (ESI) m / z = 494.2 [M + H] + .
[0383] Example 4: N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-4-fluoro-3-methyl-2-(trifluoromethoxy)benzenesulfonamide (Compound 13)
[0384]
[0385] Intermediate A7 was reacted in the same manner as steps 1 to 5 of reaction scheme 8 to give compound 13 (13.58 mg, 26% yield, 98.87% purity) as a green solid. 1 H NMR (400 MHz, CDCl3) δ ppm 2.08-2.19 (1H, m), 2.31 (3H, s), 2.68-2.99 (3H, m), 4.94 (1H, dd, J = 12.0, 5.2Hz), 7.16 (1H, t, J = 8.0 Hz), 7.22 (1H, s), 7.44 (1H, d, J = 7.2 Hz), 7.56(1H, s), 7.76 (1H, d, J = 8.4 Hz), 7.89-8.02 (2H, m); LC / MS (ESI) m / z = 530.2[M + H] + .
[0386] Example 5: N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-3-methyl-2-(trifluoromethyl)benzenesulfonamide (Compound 14)
[0387]
[0388] Following the same procedure as steps 1 to 5 of reaction scheme 8, commercially available 1-bromo-3-methyl-2-(trifluoromethyl)benzene was reacted to give compound 14 (9.39 mg, 27% yield, 97.57% purity), which was a grayish-white solid. 1 H NMR (400MHz, CDCl3) δ ppm 2.11-2.17 (1H, m), 2.59 (3H, q, J = 3.2 Hz), 2.70-2.83 (2H,m), 2.87-2.97 (1H, m), 4.92-4.98 (1H, m), 7.47 (1H, dd, J = 8.0, 2.0 Hz), 7.55 (2H, d, J = 5.2 Hz), 7.63 (1H, d, J = 2.0 Hz), 7.77 (1H, d, J = 8.0 Hz), 8.14 (1H, t, J = 4.8 Hz); LC / MS (ESI) m / z = 496.2 [M + H] + .
[0389] Example 6: 2-chloro-N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-4-fluoro-3-methylbenzenesulfonamide (Compound 15)
[0390]
[0391] Following the same procedure as steps 1 to 5 of reaction scheme 8, commercially available 1-bromo-2-chloro-4-fluoro-3-methylbenzene was reacted to give compound 15 (15.26 mg, 41% yield, 99.84% purity), a white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 1.95-2.04 (1H, m), 2.26 (3H, s), 2.58-2.68 (2H, m), 2.80-2.90(1H, m), 5.07 (1H, m), 7.35-7.54 (3H, m), 7.81 (1H, d, J = 8.8 Hz), 8.12 (1H,m), 11.09 (1H, s), 11.47-11.86 (1H, m); LC / MS (ESI) m / z = 480.2 [M + H] + .
[0392] Example 7: N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-2,3-dimethylbenzenesulfonamide (Compound 16)
[0393]
[0394] Following the same procedure as steps 1 to 5 of reaction scheme 8, commercially available 1-iodo-2,3-dimethylbenzene was reacted to give compound 16 (74.33 mg, 39% yield, 98.92% purity), as a white solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm 1.96-2.04 (1H, m), 2.28 (3H, s), 2.35-2.47 (1H, m), 2.53 (3H, s), 2.57-2.69 (1H, m), 2.80-2.92 (1H, m), 5.07 (1 H, dd, J = 13.2, 5.6 Hz), 7.26-7.38 (1H, m), 7.43-7.50 (3H, m), 7.70-7.95 (2H, m), 11.10 (1H, s), 11.46(1H, s); LC / MS (ESI) m / z = 442.2 [M + H] + .
[0395] Example 8: N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-3-methyl-2-(trifluoromethoxy)benzenesulfonamide (Compound 17)
[0396]
[0397] Intermediate A8 was reacted in the same manner as steps 1 to 5 of reaction scheme 8 to give compound 17 (1.85 mg, 25% yield, 98.26% purity), a white solid. 1 H NMR (400 MHz, CD3OD) δ ppm 2.01-2.26 (1H, m), 2.39 (3H, s), 2.59-2.97 (3H, m), 5.06-5.13 (1H, m), 7.40-7.46(1H, m), 7.48-7.52 (1H, m), 7.58-7.64 (2H, m), 7.71-7.77 (1H, m), 7.91-7.98(1H, m); LC / MS (ESI) m / z = 512.2 [M + H] + LC / MS t R = 2.253 min.
[0398] Example 9: N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-4-fluoro-2,3-dimethylbenzenesulfonamide (Compound 18)
[0399]
[0400] Commercially available 4-fluoro-2,3-dimethylaniline was reacted in the same manner as steps 1 to 4 of reaction scheme 4 to give compound 18 (79.37 mg, 41% yield, 98.26% purity), which is a grayish-white solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm 1.94-2.04 (1H, m), 2.16 (3H, s), 2.51-2.60 (5H, m), 2.79-2.92(1H, m), 5.07 (1H, dd, J = 12.8, 5.2 Hz), 7.18-7.30 (1H, m), 7.40-7.50 (2H,m), 7.74-7.83 (1H, m), 7.93 (1H, dd, J = 8.8, 5.6 Hz), 11.09 (1H, s), 11.50(1H, br s); LC / MS (ESI) m / z = 460.1 [M + H] + .
[0401] Example 10: 2-Bromo-N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-3-ethylbenzenesulfonamide (Compound 19)
[0402]
[0403] Intermediate B1 was reacted in the same manner as steps 1 to 4 of reaction scheme 4 to give compound 19 (73.48 mg, 138.66 μmol, 50% yield, 98.19% purity) as a yellow solid. 1 H NMR (400 MHz, DMSO-d6)δ ppm 1.15 (3H, t, J = 7.6 Hz), 1.95-2.07 (1H, m), 2.40-2.49 (2H, m), 2.53-2.63 (1H, m), 2.75-2.93 (3H, m), 5.00-5.15 (1H, m), 7.45-7.55 (2H, m), 7.55-7.61 (1H, m), 7.63-7.65 (1H, m), 7.80-7.83 (1H, m), 8.06-8.08 (1H, m), 11.10(1H, s), 11.61 (1H, m); LC / MS (ESI) m / z = 522.2 [M + H] + .
[0404] Example 11: 2-Bromo-N-[2-(2,6-dioxo-3-piperidinyl)-1,3-dioxoisoindoline-5-yl]-4-fluoro-3-methylbenzenesulfonamide (Compound 20)
[0405]
[0406] Intermediate B2 was reacted in the same manner as steps 1 to 4 of reaction scheme 4. The resulting mixture of two products was separated to give compound 20 (22 mg, 39.94 μmol, 49% yield, 95.19% purity), a yellow solid. The structure of the compound was identified by NMR analysis. 1H NMR (400 MHz, DMSO-d6) δ ppm 1.97-2.01 (1H, m),2.28-2.33 (3H, m), 2.40-2.48 (1H, m), 2.57-2.71 (1H, m), 2.81-2.93 (1H, m),4.91-5.16 (1H, m), 7.39-7.66 (3H, m), 7.76-7.78 (1H, m), 8.11-8.15 (1H, m),11.09 (1H, s), 11.71 (1H, s); LC / MS (ESI) m / z = 524.1 [M + H] + .
[0407] [Experimental Example]
[0408] 1. Cell Culture and Materials
[0409] The NCI-H1155 cell line was purchased from the American Type Culture Collection (ATCC, Manassas, Virginia) and maintained in RPMI 1640 (Roswell Park Memorial Institute Medium 1640; Cytiva) supplemented with 10% FBS, 2 mM L-glutamine, and 100 units / mL streptomycin-penicillin. The HL-60 cell line was purchased from the Korean Cell Bank (KCLB, Seoul, South Korea) and maintained in RPMI 1640 supplemented with 10% FBS, 2 mM L-glutamine, and 100 units / mL streptomycin-penicillin. The NCI-H2023 cell line was purchased from ATCC and maintained in Duchenne modified Eagle medium (DMEM / F12 1:1 medium, Cytiva) mixed with F12 at a 1:1 ratio. This medium was supplemented with 5% FBS, 0.005 mg / mL insulin, 0.01 mg / mL transferrin, 30 nM sodium selenite, 10 nM hydrocortisone, 10 nM β-estradiol and 100 units / mL streptomycin-penicillin. HEKa cell lines were purchased from ATCC and cultured in an ATCC-supplemented keratinocyte growth kit (ATCC) containing 6 mM L-glutamine, 0.4% bovine pituitary extract, 0.5 ng / mL recombinant human TGF-α, 100 ng / mL hydrocortisone hemisuccinate, 5 mg / mL recombinant human insulin, 1 mM adrenaline, and 5 mg / mL deferferrin, as well as ATCC-supplemented dermal cell basal medium (ATCC) containing 100 units / mL streptomycin-penicillin. HEK-293 hGSPT1 HiBiT-tagged cell lines were purchased from Synthego (Redwood City, California) and cultured in DMEM medium supplemented with 10% FBS, 2 mM L-glutamine, and 100 units / mL streptomycin-penicillin.
[0410] 2. CRBN Binding Ability Analysis
[0411] CRBN binding affinity analysis was performed using the E3scan™ platform by Eurofins. The experimental methods employed are as follows: A CRBN-DDB1 protein complex was prepared using the HEK-293 cell line, and the DNA used for qPCR detection was then labeled. Streptavidin-coated magnetic beads were reacted with biotinylated small molecule ligands capable of binding CRBN for 30 minutes to prepare affinity beads immobilized with the small molecule ligands. The ligand-immobilized affinity beads were blocked with excess biotin and washed with blocking buffer (SeaBlock (Pierce), 1% BSA, 0.05% Tween 20, 1 mM DTT) to remove unbound ligands and prevent nonspecific binding. The binding reaction was initiated by mixing the CRBN-DDB1 ligase, affinity beads, and test compound in 1× binding buffer (20% SeaBlock, 0.17× PBS, 0.05% Tween 20, 6 mM DTT). The test compounds were prepared as 100% DMSO solutions at a concentration 111 times the final concentration. The test compound solutions were serially diluted 3-fold to 11 concentrations. The test compounds were dispensed using 100% DMSO via a non-contact dispensing method. Subsequently, the compounds were directly diluted into the experimental solutions to a final DMSO concentration of 0.9%. All reactions were performed in polypropylene 384-well plates. The final volume of each reaction solution was set to 0.02 mL. The plates were incubated at room temperature with shaking for approximately 1 hour, and the affinity beads were washed with washing buffer (1× PBS, 0.05% Tween 20). The beads were then resuspended in elution buffer (1× PBS, 0.05% Tween 20, 0.5 μM non-biotinylated affinity ligand) and incubated at room temperature with shaking for approximately 30 minutes. The concentration of CRBN-DDB1 in the elution buffer was determined by qPCR. Kd values were calculated by analyzing the 11 concentrations of the test compound solutions and the 3 control groups (DMSO).
[0412] Reference compound 1 and reference compound 2 are compounds having the following structures, and are referred to as "compound 1" and "compound 5" in international publication number WO2022 / 066835.
[0413] [Reference compound 1] [Reference compound 2]
[0414]
[0415] The results of the analysis of the binding ability of the CRBN-DDB1 complex in this experimental example are shown in Table 1 below.
[0416] [Table 1]
[0417]
[0418] Compared to Reference Compound 1 and Reference Compound 2, the Example Compounds exhibited the same or higher binding affinity (lower Kd values) to CRBN-DDB1. However, since binding affinity to CRBN-DDB1 does not necessarily lead to GSPT1 degradation activity, the GSPT1 degradation activity was also evaluated below.
[0419] 3. GSPT1 Degradation Capacity Assessment
[0420] Construction of HEK293 HiBiT-GSPT1 cell line
[0421] The HEK293 cell line expressing HiBiT-GSPT1 was constructed by Synthego (California, USA). The HiBiT protein fragment (VSGWRLFKKIS (SEQ ID NO: 1)) capable of expressing an 11-amino acid sequence was constructed. GTGAGCGGCTGG CGGCTGTTCAAGAAGATTAGCG A DNA donor (SEQ ID NO: 2, underlined portion is the HiBiT nucleotide sequence) was co-injected into HEK293 cells via electroporation using a CRISPR / Cas9 system that induces a double-strand break at the N-terminus of the GSPT1 gene. For cell lines induced to undergo gene editing, single clones were obtained through single-cell sorting. To verify the accuracy of gene editing, the edited GSPT1 gene sequence in the obtained single clones was amplified using the following two primers [forward (5'-3'): TTGGCGTTGACGTTGAGTTG (SEQ ID NO: 3), reverse (5'-3'): ACACGAGGAGGAGGGTTGAG (SEQ ID NO: 4)], and the edited HiBiT-GSPT1 gene sequence was determined using Sanger sequencing.
[0422] hGSPT1 HiBiT Analysis
[0423] HEK-293 hGSPT1 HiBiT-tagged cells were seeded at a density of 5000 cells per well in white 96-well analytical plates, with three replicates per group. After overnight incubation, cells were treated with culture medium containing a 3-fold concentration of the test compound, with final concentrations of the test compound being 1 nM, 3 nM, 10 nM, 30 nM, 100 nM, 1 μM, 3 μM, and 10 μM. After 72 hours of incubation, GSPT1 HiBiT-tagged protein levels were assessed using the Nano-Glo® HiBiT lysis detection system (Promega) according to the manufacturer's instructions. The luminescence signal was measured using a Varioskan LUX multimode microplate reader.
[0424] From EC 50 DC 50 and D max The degradation activity of GSPT1 was evaluated from three aspects. max (%) indicates the maximum value of the highest concentration decrease solution GSPT1. Furthermore, the relative EC was calculated using four-parameter logistic regression. 50 Value, assuming D is calculated in each experiment max The value represents the maximum effect. In this test system, DC 50 The EC was calculated using the concentration defined as the concentration required to cause 50% absolute degradation of GSPT1. 50 DC 50 and D max The values are shown in Table 2 below.
[0425] [Table 2]
[0426]
[0427] For reference compound 2, D max It is 42.8% and DC 50 Greater than 10 μM. Refer to the EC50 of compound 1. 50 198.3 nM, DC 50 454.5 nM, D max The GSPT1 degradation activity was 78.3%, demonstrating superior activity compared to reference compound 2. Furthermore, compared to reference compounds 1 and 2, the example compounds showed better EC50 degradation activity. 50 DC 50 and D max The results showed equivalent or enhanced effects in this aspect.
[0428] 4. Test method for determining GSPT1 degradation capacity by immunoblotting analysis
[0429] To determine the reproducibility of the GSPT1 HiBiT assay (an artificially created assay system for high-throughput screening of compounds) results in cancer cell lines and to determine the selectivity of the compounds of the present invention for degradation of a variety of novel substrates, the NCI-H1155 cell line (a lung cancer cell line) was treated with the example compounds, and then the expression levels of GSPT1 and other known novel substrates were determined by immunoblotting.
[0430] NCI-H1155 cells were seeded in 6-well plates (2 × 10⁶ cells per well). 6 (cells). After overnight incubation, cells were treated with reference compounds 1, 3, 4, and 5 at concentrations of 0 nM, 3 nM, 10 nM, 30 nM, 100 nM, 300 nM, and 1000 nM, respectively. Cells were harvested after 6 hours. Additionally, to confirm the change in GSPT1 degradation over time, cells were treated with reference compounds 1, 2, 3, 4, 8, and 11 at a concentration of 100 nM, respectively. Cells were harvested after 0, 2, 4, 8, 24, 48, and 72 hours. The harvested cells were centrifuged to form a pellet, washed with PBS, lysed with RIPA buffer supplemented with a mixture of protease inhibitors (Roche) and phosphatase inhibitors (Roche), and then frozen overnight at -80°C. The thawed sample was centrifuged, 1× LDS loading buffer and 1× reducing agent were added, and the sample was heated to 95°C. The prepared samples were loaded onto NuPAGE 4-12% Bis-Tris protein gels and transferred to nitrocellulose membranes. The membranes were blocked with 5% bovine serum albumin, incubated overnight with primary antibody, and then the corresponding protein signals were detected using HRP-labeled secondary antibody and an iBright CL1500 imaging system. The antibodies used are listed below.
[0431] Primary antibodies: rabbit anti-human eRF3 / GSPT1 [EPR22908-103] (ab234433, Abcam), rabbit anti-human IKAROS (5443, CST), rabbit anti-human HELIOS (D8W4X) (42427, CST), rabbit anti-human AIOLOS (D1C1E) (15103, CST), rabbit anti-human CK1a [EPR1961(2)] (ab108296, Abcam), mouse anti-human SALL4 (ab57577, Abcam), mouse anti-β-actin-peroxidase antibody (A3854, Sigma), and rabbit anti-human N-MYC (D1V2A) (84406, CST).
[0432] Secondary antibodies: HRP-labeled goat anti-rabbit IgG (7074, CST) and HRP-labeled horse anti-mouse IgG (7076, CST).
[0433] The results of the degradation activity assays of GSPT1 and various new substrates are as follows: Figure 1 and Figure 2 As shown.
[0434] Compared with reference compound 1, compounds 3, 4, and 5 all exhibited equivalent or enhanced GSPT1 degradation activity (see [reference]). Figure 1 Furthermore, all evaluated compound examples showed no significant effect on the expression levels of other novel substrates, even at the highest concentrations. These results confirm that the compounds of this invention exhibit selective degradation activity against GSPT1.
[0435] Meanwhile, when cancer cell lines were treated with reference compound 1 at a concentration of 100 nM and the degree of GSPT1 degradation over time was observed, GSPT1 expression levels gradually decreased over 24 hours, but then increased again from 48 to 72 hours (see [link to relevant documentation]). Figure 2 On the other hand, compounds 2, 3, 4, 8, and 11 all showed a stable decrease in GSPT1 expression levels throughout the measurement process. Therefore, this confirms that the compounds of the present invention exhibit more stable and sustained GSPT1 degradation activity compared to reference compound 1.
[0436] 5. Real-time cell proliferation analysis
[0437] To determine whether the duration of GSPT1 degradation affects the ability to inhibit cancer cell growth, cancer cells were treated with reference compound 1 and the compound of example, and then the growth of cancer cells was monitored in real time using the Incucyte S3 live cell analysis system (Sartorius, Ann Arbor, Michigan, USA).
[0438] Real-time cell proliferation analysis was performed at Seoul National University. NCI-H1155 cells were seeded at a density of 4000 cells per well in clear 96-well plates. Cells were cultured overnight at 37°C in a 5% CO2 humidified incubator, and then treated with different concentrations of reference compound 1 and test compounds. After compound treatment, cell growth was monitored in real-time for 72 hours using an Incucyte S3 live cell analysis system (Sartorius, Ann Arbor, Michigan, USA). The results are shown below. Figure 3 As shown.
[0439] Treatment with 100 nM reference compound 1 showed an inhibitory trend in cell growth of the lung cancer cell line NCI-H1155 within 48 hours, but cell growth recovered rapidly after 48 hours. Figure 3 (Marked with ●). This result is consistent with the rebound in GSPT1 expression levels after treatment with 100 nM reference compound 1 for 48 hours. Figure 2Consistent with the EC of reference compound 1. 50 The value was 198.3 nM (see Table 2), which indicates that reference compound 1 could not produce a sustained GSPT1 degradation effect at the effective dose for GSPT1 degradation.
[0440] On the other hand, compounds 3, 4, 5, 15, and 19 all exhibited sustained inhibitory effects on cancer cell growth at a concentration of 100 nM. Figure 3 (Marked with ●). Compared with reference compound 1, these compounds showed no rebound or only minimal rebound in cell growth at a concentration of 100 nM, even at lower concentrations of 30 nM. Figure 3 (Marked with ◆). Overall, it was demonstrated that the compounds of the present invention can induce GSPT1 degradation and inhibit cancer cell growth more persistently and stably than reference compound 1.
[0441] 6. pH stability
[0442] Add approximately 1 mg of reference compound 1 (molecular weight 497.40) powder to a 20 mL bottle, then add 10 mL of MeOH and mix thoroughly. Add approximately 2.4 g of acetic acid, 2.48 g of boric acid, and 3.92 g of phosphoric acid to a 500 mL bottle, then add 500 mL of purified water and mix thoroughly. Divide the mixture into seven separate bottles and adjust the pH to 2.7, 4.4, 5.2, 6.0, 7.1, 8.1, and 9.1 using 1 N HCl or 1 N NaOH solution. Transfer 10 μL of the MeOH solution of reference compound 1 to each of the seven bottles, add 990 μL of buffer solution, and mix thoroughly. Add approximately 2 mg of compound 3 (molecular weight 461.88) powder to a 2 mL flask and dissolve in 1 mL of DMSO. Add approximately 2.4 g of acetic acid, 2.48 g of boric acid, and 3.92 g of phosphoric acid to a 500 mL bottle, then add 500 mL of purified water and mix thoroughly. The mixed solution was aliquoted into six vials and adjusted to pH values of 2.0, 4.0, 7.0, 8.0, 9.0, and 11.0 using 1 N HCl or 1 N NaOH solution, respectively. 10 μL of compound 3 solution (2 mg / mL DMSO solution) was transferred to each of the six vials, and 990 μL of buffer solution was added. The mixtures were then thoroughly mixed. HPLC analysis was performed under the conditions described in Tables 3 and 4 below.
[0443] [Table 3]
[0444] HPLC analysis conditions for compound 1
[0445]
[0446] [Table 4]
[0447] HPLC analysis conditions for compound 3
[0448]
[0449] The pH stability results of reference compounds 1 and 3 are shown in Tables 5 and 6, respectively.
[0450] [Table 5]
[0451]
[0452] [Table 6]
[0453]
[0454] As shown in Table 5, after 24 hours in buffer solutions with pH values of 4.4, 5.2, and 6.0, the residual amounts of reference compound 1 were only 87%, 86.5%, and 79.2%, respectively. Furthermore, after 4 hours in neutral conditions at pH 7.1, the residual amount of reference compound 1 was 87.4%, indicating instability; after 24 hours, the residual amount was only 54.2%, demonstrating its high instability (Table 5). These results indicate that reference compound 1 is unstable at physiological pH (neutral pH) and cannot exhibit sustained efficacy. This result is consistent with the recovery of GSPT1 expression levels in cancer cell lines after 48 hours of treatment with reference compound 1. Figure 2 And cell proliferation occurs again ( Figure 3 The results are consistent.
[0455] On the other hand, compound 3 was very stable at pH 4.0 for 24 hours, and remained stable even at neutral pH 7.0 throughout the experiment (the residual amount of the compound after 24 hours was 81.12%). Therefore, this confirms that compound 3 exhibits superior pH stability compared to reference compound 1. These results indicate that compound 3 functions more stably than reference compound 1 at physiological pH (neutral pH). These results are consistent with... Figure 2 and Figure 3 The results shown are consistent. Unlike reference compound 1, GSPT1 expression levels remained stably decreased after 72 hours of treatment of cancer cell lines with compound 3. Figure 2 Furthermore, cell proliferation did not rebound. Figure 3 ).
[0456] 7. Proteomics analysis using TMT-labeled mass spectrometry
[0457] To determine whether the compounds of this invention selectively degrade only GSPT1 at the whole-cell proteome level, TMT-labeled proteomics analysis was performed.
[0458] Cell lysis buffers were prepared by dissolving tablets containing protease inhibitors and phosphatase inhibitors in a mixed solution of 8 M urea, 1% SDS, and 50 mM Tris at pH 8.5. HL60 cell lines were treated with three aliquots of DMSO sample, four aliquots of compound 3 sample, and four aliquots of compound 4 sample for 4 hours, respectively, followed by lysis with the cell lysis buffer. The lysed cell solutions were homogenized three times on ice using an ultrasonic homogenizer for 10 seconds each time, followed by centrifugation at 14000 g for 15 minutes at 4°C. Only the supernatant was separated and proteomics analysis was performed at the Institute for Basic Science (KBSI), Korea. Each sample was digested into peptide fragments using an S-Trap microcentrifuge column (Protifi, USA) according to the manufacturer's recommended method. Pretreated samples were individually TMT-labeled using an 11-fold TMT labeling kit (Thermo Fisher Scientific) according to the manufacturer's recommended method. Subsequently, mass spectrometry analysis was performed using an LC-MS / MS system consisting of an UltiMate 3000 RSLCnano system (Thermo Fisher Scientific) and an EASY-Spray Sources nanoparticle ionization source (Thermo Fisher Scientific) equipped with an Orbitrap Eclipse Tribrid mass spectrometer (Thermo Fisher Scientific). The results were analyzed, and only reliable peptides with a global FDR of less than 1% and first-ranked protein fragments, along with proteins having a minimum spectral count of 4 or higher after normalization, were used for analysis.
[0459] The results of quantitative analysis of 6534 endogenous proteins are as follows: Figure 4 As shown. Figure 4 As shown, compounds 3 and 4 reduced the abundance of GSPT1 only across the entire proteome. These results corroborate that compounds 3 and 4 exhibit selective action on GSPT1 at the whole proteome level and possess novel substrate specificity only for GSPT1.
[0460] 8. Assessment of protein translation rate inhibition ability
[0461] GSPT1 is an enzyme that mediates the protein translation termination step, and its degradation slows down the protein translation rate. Therefore, GSPT1 degradation is known to induce inhibition of the expression levels of oncogenic proteins (e.g., c-MYC, N-MYC, L-MYC, BCL-2, MCL-1, etc.), which are maintained at high expression levels in cancer cells in dependence of protein translation (Mullard, Nat Rev DrugDiscov. 2022, 21: 865-867). Simultaneously, GSPT1 degradation is known to activate a cell death mechanism known as the "integrative stress response" (Surka et al., Blood 2021, 137(5): 661-677). This response is known to be mediated by ATF-4 and ultimately leads to cell death in a caspase 3-dependent manner.
[0462] To determine whether the compounds of this invention induced pharmacodynamic changes in NCI-H1155 (a lung cancer cell line known to be sensitive to GSPT1-induced cell death), puromycin was used to detect protein translation rates. Puromycin is a commonly used substance for measuring protein translation rates because it can replace tyrosyl-tRNA in the protein sequence during protein translation.
[0463] The NCI-H1155 cell line was purchased from the American Type Culture Collection (ATCC, Manassas, Virginia). Cells were cultured in RPMI 1640 medium (Cytiva) according to recommended protocol. The HL-60 cell line was purchased from the Korean Cell Bank (KCLB, Seoul, South Korea) and cultured in RPMI 1640 (Cytiva) supplemented with 10% FBS, 2 mM L-glutamine, and 100 units / mL streptomycin-penicillin. The NCI-H2023 cell line was purchased from the American Type Culture Collection (ATCC, Manassas, Virginia). Cells were cultured in DMEM / F12 1:1 medium (Cytiva) according to recommended protocol.
[0464] NCI-H1155 cells, HL-60 cells, and NCI-H2023 cells were seeded into 6-well plates (2 × 10⁶ cells per well). 6 (cells). After overnight incubation, the following experiments were performed.
[0465] First, NCI-H1155 cells were treated with 1 μM compound 3. Six hours after compound treatment, cells were treated with 1 μM puromycin. Cells were harvested at 0, 10, 20, 30, and 60 minutes after puromycin treatment. NCI-H2023 cells were treated similarly with 1 μM compound 3 and reference compound 1. Forty-eight hours after compound treatment, cells were treated with 1 μM puromycin. Cells were harvested at 0, 30, 60, and 90 minutes after puromycin treatment. The DMSO treatment group served as a control group.
[0466] To confirm the effect of compound 3's protein translation inhibition on the expression level of the downstream oncogenic protein N-MYC, NCI-H1155 cells were treated with 1 μM compound 3. Protein translation labeling was performed at 0, 2, 4, 8, and 24 hours after compound treatment by treatment with 1 μM puromycin. Cells were harvested 30 minutes after puromycin treatment. Furthermore, to confirm the expression levels of N-MYC, ATF-4, and cleaved caspase 3, NCI-H1155 and HL60 cells were treated with 0.3 μM and 1 μM compound 3, respectively. Cells were harvested at 0, 2, 4, 6, 8, and 24 hours.
[0467] Cell pellets harvested at each time point were centrifuged, washed with PBS, lysed with RIPA buffer supplemented with a mixture of protease inhibitors (Roche) and phosphatase inhibitors (Roche), and then frozen overnight at -80°C. The thawed samples were centrifuged, 1× LDS loading buffer and 1× reducing agent were added, and the mixture was heated to 95°C. The prepared samples were loaded onto NuPAGE 4-12% Bis-Tris protein gels and transferred to nitrocellulose membranes. The membranes were blocked with 5% bovine serum albumin, incubated overnight with primary antibody, and then the corresponding protein signals were detected using HRP-labeled secondary antibody and an iBright CL1500 imaging system. The antibodies used are listed below.
[0468] Primary antibodies: mouse anti-purinemycin (MABE343, Sigma), rabbit anti-human eRF3 / GSPT1 [EPR22908-103] (ab234433, Abcam), rabbit anti-human ATF-4 (D4B8) (11815, CST), rabbit anti-human lysed caspase 3 (Asp175) (9661, CST), and mouse anti-β-actin-peroxidase antibody (A3854, Sigma).
[0469] Secondary antibodies: HRP-labeled horse anti-mouse IgG (7076, CST) and HRP-labeled goat anti-rabbit IgG (7074, CST).
[0470] Analysis results as follows Figures 5 to 8 As shown.
[0471] like Figure 5 As shown, compared with the DMSO control group, the protein translation rate was significantly reduced in the compound 3 treatment group as GSPT1 degraded. Figure 6 As shown, approximately 4 hours after treatment with compound 3, protein translation inhibition induced by GSPT1 degradation was observed. 24 hours after treatment with compound 3, the expression level of the downstream oncogenic protein N-MYC was inhibited, at which point protein translation was completely suppressed. Figure 6 (Left figure). This indicates that GSPT1 degradation, protein translation inhibition, and decreased N-MYC expression levels occur sequentially. Even in samples not labeled with puromycin, a decrease in N-MYC expression levels was observed 24 hours after treatment with compound 3. Figure 6 (Right figure). Furthermore, as GSPT1 expression decreased, ATF-4 protein expression, which mediates the integrated stress response, increased, and it was observed that compound 3 treatment sequentially induced the activation (cleavage) of cell death-related caspase 3 24 hours after treatment. Figure 6 (Right figure). These pharmacodynamic changes were also observed in the acute myeloid leukemia (AML) cell line HL60. Figure 7 ).
[0472] Meanwhile, in NCI-H2023 cells, which are known not to induce cell death by GSPT1 degradation, compound 3 only partially inhibited GSPT1 degradation and therefore did not inhibit protein translation. Figure 8 (Left figure). On the other hand, reference compound 1 still exhibited strong GSPT1 degradation activity and inhibited protein translation in NCI-H2023 cells ( Figure 8 (See right figure). The above results corroborate the practicality of the compounds of this invention as personalized medicines, due to their particularly excellent anticancer activity against cancer cells sensitive to GSPT1 degradation.
[0473] 9. Cell viability analysis
[0474] The inhibitory effects of the compounds of this invention on cell proliferation were observed using the lung cancer cell line NCI-H1155 and the acute myeloid leukemia (AML) cell lines HL60, MOLM13, MOLM14, MV-4-11 and U937.
[0475] The NCI-H1155 cell line was purchased from the American Type Culture Collection (ATCC, Manassas, Virginia). Cells were cultured in RPMI 1640 medium (Cytiva) according to the recommended protocol. NCI-H1155 cells in the exponential growth phase were seeded at a density of 6000 cells per well in SPL 33596 white 96-well analytical plates and incubated overnight at 37°C in a 5% CO2 humidified incubator. Cells were finally treated with medium mixed with 3-fold concentrations of the test compound at concentrations of 1.5 nM, 4.6 nM, 13.7 nM, 41.2 nM, 123.5 nM, 370.4 nM, 1.111 μM, 3.333 μM, and 10 μM. The HL-60 cell line was purchased from the Korean Cell Bank (KCLB, Seoul, South Korea). Cells were cultured in RPMI 1640 medium (Cytiva) according to the recommended protocol. HL-60 cells in the exponential growth phase were seeded at a density of 4000 cells per well in SPL 33596 white 96-well analytical plates and incubated overnight at 37°C in a 5% CO2 humidified incubator. Cells were treated with a medium containing 3-fold concentrations of the test compound at concentrations of 1.5 nM, 4.6 nM, 13.7 nM, 41.2 nM, 123.5 nM, 370.4 nM, 1.111 μM, 3.333 μM, and 10 μM. After 72 hours of incubation according to the manufacturer's recommended protocol, cytotoxicity was determined using the Promega CellTiter Glo reagent. The luminescence signal was measured using a Varioskan LUX multimode microplate reader. The relative IC50 was calculated in the same manner as in the "3. GSPT1 Degradation Capacity Assessment" experiment described above. 50 and absolute IC 50Experiments were conducted at Seoul National University using MOLM13, MOLM14, MV-4-11, and U937 cell lines. Cytotoxicity was assessed using the WST-8 reagent after 72 hours of incubation under drug treatment conditions. MOLM13, MOLM14, MV-4-11, and U937 cells in the exponential growth phase were seeded at a density of 4000 cells per well in SPL 30096 clear 96-well analytical plates and cultured overnight at 37°C with 5% CO2 humidification. Cells were then treated with a medium containing twice the concentration of the test compound at concentrations of 1 nM, 3 nM, 10 nM, 30 nM, 100 nM, 300 nM, 1 μM, 3 μM, and 10 μM. Cytotoxicity was determined using the CELLOMAX™ WST-8 reagent (PRECAREGENE, CM-VA0500) after 72 hours of incubation, according to the manufacturer's recommended protocol. The absorbance at 450 nm was measured using a SpectraMAX i3x microplate reader (Molecular Devices, SpectraMAX i3x).
[0476] The results of evaluating the cell proliferation activity of the compounds in various cancer cell lines are shown in Table 7 below.
[0477] [Table 7]
[0478]
[0479] As shown in Table 7 above, compounds 1 to 20 generally exhibited enhanced anticancer efficacy compared to reference compounds 1 and 2 in the tested lung cancer cell lines and acute myeloid leukemia cell lines.
[0480] Meanwhile, WuXi AppTec was commissioned to conduct cell proliferation inhibition experiments on the following small cell lung cancer (SCLC) and lung adenocarcinoma (LUAD) cell lines.
[0481] Small cell lung cancer (SCLC): NCI-H526, NCI-H69, NCI-H2029, NCI-H889, NCI-H1963, NCI-H524, NCI-H82, NCI-H446, NCI-H211, SHP77.
[0482] Lung adenocarcinoma (LUAD): NCI-H1975, A549, NCI-H358, NCI-H460.
[0483] Cells in the exponential growth phase were seeded into GreinerCELLSTAR #655090 black 96-well analytical plates at the appropriate cell number per well according to the conditions established by WuXi AppTec, and cultured overnight in a 37°C, 5% CO2 humidified incubator. Cells were treated with culture medium containing 10 times the target concentration of the test compound at concentrations of 1.5 nM, 4.6 nM, 13.7 nM, 41.2 nM, 123.5 nM, 370.4 nM, 1.111 μM, 3.333 μM, and 10 μM. After incubation for 72 hours according to the manufacturer's recommended protocol, cytotoxicity was determined using the Promega Cell Titer Glo reagent. The luminescence signal was measured using a PerkinElmer 2104 EnVision microplate reader (PerkinElmer 2104 EnVision multi-label reader).
[0484] like Figure 9a As shown, compounds 3 and 4 exhibited minimal inhibitory effects on LUAD cell lines, while demonstrating excellent overall anticancer effects on SCLC cell lines.
[0485] Since SCLC is primarily referred to as a cancer with a neuroendocrine phenotype (Nat Rev Dis Primers. 2021 Jan 14; 7(1): 3), it was confirmed whether the compounds of this invention exhibit anticancer efficacy against pulmonary neuroendocrine carcinoma (lung NEC), a type of non-small cell lung cancer (NSCLC) with a neuroendocrine phenotype, and against neuroendocrine prostate cancer (NEPC), a type of prostate cancer known to have a neuroendocrine phenotype and a very poor prognosis. This experiment was conducted by WuXi AppTec in the same manner as with cells derived from small cell lung cancer (SCLC) and lung adenocarcinoma (LUAD).
[0486] Lung neuroendocrine carcinoma (NEC): NCI-H1770, NCI-H2106.
[0487] Neuroendocrine prostate cancer (NEPC): NCI-H660.
[0488] Figure 9b Compounds 3 and 4 were shown to have effects on ECGs in LUAD, SCLC, lung NEC, and NEPC cell lines. 50 Calculation results. For example... Figure 9b As shown, compounds 3 and 4 showed almost no inhibition of LUAD cell proliferation, but exhibited excellent cell proliferation inhibitory activity against SCLC, lung NEC, and NEPC. Therefore, it was found that the compounds of this invention, possessing excellent GSPT1 degradation activity, exhibit particularly superior anticancer effects against cancers with a neuroendocrine phenotype. This underscores the practicality of the compounds of this invention as personalized medicines.
[0489] 10. Cytotoxicity assays and therapeutic window derivation for normal cells
[0490] The safety of the compounds of the present invention in normal cells and the resulting improved therapeutic window were confirmed. To this end, the cytotoxicity of the compounds was compared and evaluated using HEKa primary skin cells donated from healthy adults.
[0491] HEKa cell lines were purchased from the American Type Culture Collection (ATCC, Manassas, Virginia). Cells were cultured in dermal cell basal medium (ATCC) according to the recommended protocol. HEKa cells were seeded at a density of 10,000 cells per well in SPL 33596 white 96-well analytical plates and incubated overnight at 37°C in a 5% CO2 humidified incubator. Cells were treated with medium mixed with 3-fold concentrations of the test compound at concentrations of 1.5 nM, 4.6 nM, 13.7 nM, 41.2 nM, 123.5 nM, 370.4 nM, 1.111 μM, 3.333 μM, and 10 μM. After 72 hours of incubation according to the manufacturer's recommended protocol, cytotoxicity was determined using the Promega Cell Titer Glo reagent. The luminescence signal was measured using a Varioskan LUX multimode microplate reader. Absolute IC50 was calculated in the same manner as in the "3. GSPT1 Degradation Capacity Assessment" experiment described above. 50 .
[0492] The results of the comparison of the cytotoxicity of the compounds to normal cells are shown in Table 8 below. The therapeutic index in Table 8 uses the IC50 of NCI-H1155 and HL60 listed in Table 7. 50 The value is calculated.
[0493] [Table 8]
[0494]
[0495] As shown in Table 8, compared with reference compound 1, the compounds of the present invention exhibit lower overall cytotoxicity to normal cells (HEKa cells), thus confirming them as safer compounds with a wider therapeutic window.
[0496] also, Figure 10 The results of the in vitro therapeutic index comparison between reference compound 1 and compounds 3 and 4 are shown.
[0497] like Figure 10As shown, there was no significant difference between the concentration of reference compound 1 that exhibited anticancer activity against NCI-H1155 or HL60 and the concentration that showed cytotoxicity against HEKa cells (i.e., exhibiting a low therapeutic index). On the other hand, compounds 3 and 4 exhibited wider therapeutic windows (significantly higher therapeutic indices) compared to reference compound 1. In particular, compound 3 showed almost no cytotoxicity against HEKa cells, exhibiting a very wide therapeutic window (…). Figure 10 (See image below).
[0498] 11. Evaluation of in vivo anticancer efficacy using acute myeloid leukemia (AML) cell lines.
[0499] Champions Oncology was commissioned to evaluate the in vivo anticancer efficacy using acute myeloid leukemia (AML) cell lines, and the evaluation was conducted according to Champions Oncology's internal IACUC guidelines. First, the HL60-Luc cell line (5 × 10⁻⁶ cells) was used... 6 Compound 3 (HL60 cells / 0.2 mL PBS, a luciferase-labeled acute myeloid leukemia cell line) was transplanted into 6- to 8-week-old completely immunodeficient female NCG mice (Charles River) via tail vein injection. Progression of acute myeloid leukemia (AML) was measured by quantitative bioluminescence intensity analysis. Bioluminescence intensity was recorded 4 to 10 days post-transplantation. When bioluminescence intensity above the background value (bioluminescence intensity in mice without HL60 cells) was measured in more than 90% of the total subjects, animals were randomly assigned to groups and administration of compound 3 was initiated. The dosage form was prepared by dissolving compound 3 in a mixture of 5% DMSO, 10% Solutol HS-15, and 85% sterile saline. Compound 3 was orally administered to the groups at doses of 5 mg / kg once daily, 15 mg / kg once or twice daily, and 30 mg / kg once daily. Bioluminescence intensity was measured dorsally and ventrally and based on total luminescence intensity (total flux, photons / second, photons per second). During medication, the progression of AML should be measured twice a week. After discontinuation of medication, measurements should be taken once a week on the back and once a week on the ventral side. Body weight should be measured twice a week.
[0500] The efficacy evaluation results of this compound in the HL-60-Luc AML animal model are as follows: Figure 11a As shown. Figure 11a As shown, when administered orally daily at a dose of 5 mg / kg, compound 3 inhibited the progression of AML. Furthermore, when administered once daily at doses of 15 mg / kg or higher, compound 3 not only inhibited AML progression but also exhibited tumor regression.
[0501] Meanwhile, the experiment was followed up until day 60 to confirm whether AML progression was still suppressed after drug withdrawal. The results showed that when compound 3 was administered twice daily at a dose of 15 mg / kg, no AML relapse occurred more than one month after drug withdrawal. This confirmed the safety of compound 3, as it did not cause weight loss in mice at the administered dose. Figure 11b Regardless of whether medication was used, weight loss was observed in the rapidly progressing AML group. These experimental results confirm that compound 3 is safe and exhibits excellent anticancer efficacy in vivo.
[0502] 12. Evaluation of in vivo anticancer efficacy using lung cancer cell lines
[0503] The study commissioned Seoul National University to evaluate the in vivo anticancer efficacy using lung cancer cell lines, and the evaluation was conducted according to Seoul National University's internal IACUC guidelines. 5 × 10 6 H1155 cell lines were subcutaneously transplanted into 5-week-old female Balb / c nude mice. Mouse body weight and tumor volume were measured every 3 days. A dosage form was prepared by dissolving compound 3 in a mixture of 5% DMSO, 10% Solutol HS-15, and 85% sterile saline. A dosage form was prepared by dissolving compound 4 in a mixture of 5% NMP, 5% Solutol HS-15, and 90% sterile saline. The dosage form was administered when the tumor volume reached approximately 100 mm². 3 Compounds 3 and 4 were administered starting at [time missing]. The dosage of compound 3 included: 5 mg / kg, 15 mg / kg, or 30 mg / kg once daily; 15 mg / kg twice daily; or 30 mg / kg for 5 days followed by a 9-day interval. Compound 4 was administered orally at doses of 3 mg / kg and 10 mg / kg once daily for 6 days. Cancerous tissue was removed 6 hours and 24 hours after the last administration, and pharmacodynamic changes were observed.
[0504] The pharmacodynamic and anticancer efficacy evaluation results of compounds 3 and 4 in the NCI-H1155 lung cancer animal model are shown in Figures 12 and 13.
[0505] When compound 4 was administered at a dose of 3 mg / kg, GSPT1 protein expression levels were partially reduced at 6 and 24 hours post-administration, but no significant changes were observed in the expression level of the downstream oncogenic protein N-MYC. Conversely, when compound 4 was administered at a dose of 10 mg / kg, GSPT1 protein expression levels were completely reduced at 6 and 24 hours post-administration, and the expression level of the downstream oncogenic protein N-MYC was also significantly reduced. Figure 12a Furthermore, it was confirmed that when compound 4 was administered at a dose of 10 mg / kg, tumor volume was significantly reduced on day 6. Figure 12b ).
[0506] Meanwhile, compound 3 significantly inhibited tumor proliferation at all evaluated doses without causing significant weight loss (Figure 13). Furthermore, similar to the results in the AML animal model, when administered once daily at doses of 15 mg / kg or higher, compound 3 inhibited lung cancer tissue growth and further demonstrated complete tumor regression. In addition, the experiment was followed up until day 40 to confirm whether lung cancer recurrence was still suppressed after drug withdrawal. The results showed that when compound 3 was administered twice daily at a dose of 15 mg / kg, no lung cancer recurrence was observed approximately one month after drug withdrawal, except for one of the nine animals.
[0507] The present invention has been described herein based on exemplary embodiments. However, it should be understood that the invention is not limited to the described embodiments, and all variations, modifications, alterations, and alternatives that do not depart from the spirit and essential characteristics of the invention fall within the scope of the invention.
Claims
1. A compound of formula I or a stereoisomer thereof, hydrate, solvate or pharmaceutically acceptable salt thereof: [Formula I] In equation I, R 1 It is a halogen, a C1-C6 alkyl, a C1-C6 alkoxy, a C1-C6 haloalkyl, or a C1-C6 haloalkoxy; R 2 For optional use by R 2a Substituted C1-C6 alkyl groups; R 2a It can be hydroxyl, halogen, C1-C6 alkoxy, C1-C6 haloalkoxy or -NR'R''; R' and R'' are each hydrogen or C1-C6 alkyl, or R' and R'' may form a 3- to 8-membered heterocycle, optionally containing an additional heteroatom selected from N, O, and S, together with the nitrogen atom to which they are attached; and R 3 It is hydrogen or halogen.
2. The compound or its stereoisomer, hydrate, solvate or pharmaceutically acceptable salt according to claim 1, wherein... R 1 It is a halogen, a C1-C6 alkyl, a C1-C6 haloalkyl, or a C1-C6 haloalkoxy. R 2 For optional use by R 2a Substituted C1-C6 alkyl groups; R 2a It is a hydroxyl or C1-C6 haloalkoxy group; and R 3 It is hydrogen or halogen.
3. The compound or its stereoisomer, hydrate, solvate or pharmaceutically acceptable salt according to claim 2, wherein... R 1 It is a halogen or a C1-C6 alkyl group; R 2 It is a C1-C6 alkyl group; and R 3 It is hydrogen or halogen.
4. The compound or its stereoisomer, hydrate, solvate or pharmaceutically acceptable salt according to claim 3, wherein... R 1 It is a halogen; R 2 It is a C1-C6 alkyl group; and R 3 It is hydrogen.
5. The compound or its stereoisomer, hydrate, solvate or pharmaceutically acceptable salt according to claim 2, wherein... R 1 For F, Cl, Br, I, -OCH2F, -OCHF2, -OCF3, -CH2F, -CHF2, -CF3, or -CH3; R 2 It is -CH3, -CH2CH3, -CH2OCF3, -CH2OCHF2, -CH2OCH2F, -CH2OH, or -CH2CH2OH; and R 3 It can be H or F.
6. The compound or its stereoisomer, hydrate, solvate or pharmaceutically acceptable salt according to claim 1, wherein... R 1 It is a halogen; R 2 It is a C1-C6 alkyl group substituted by NR'R''; R' and R'' are each hydrogen or C1-C6 alkyl, or R' and R'' may form a 3- to 8-membered heterocycle, optionally containing an additional heteroatom selected from N, O, and S, together with the nitrogen atom to which they are attached; and R 3 It is hydrogen.
7. The compound of claim 6 or its stereoisomers, hydrates, solvates or pharmaceutically acceptable salts, wherein... R' and R'' are each hydrogen or C1-C3 alkyl, or R' and R'' together with the nitrogen atom to which they are attached form a morpholine ring, a thiomorpholine ring, a piperazine ring, or a piperidine ring.
8. The compound of claim 6 or its stereoisomers, hydrates, solvates or pharmaceutically acceptable salts, wherein... R 2 It is -CH2-morpholino, -CH2-CH2-morpholino, -CH2-NH2, -CH2-NH(CH3), -CH2-N(CH3)2, -CH2CH2-NH2, -CH2-CH2NH(CH3)2 or -CH2-CH2-N(CH3)2.
9. The compound or its stereoisomer, hydrate, solvate or pharmaceutically acceptable salt according to claim 1, wherein, The compound is any of the following formulas: 。 10. A pharmaceutical composition for treating uncontrolled cell proliferation diseases in mammals, comprising a therapeutically effective amount of the compound or its stereoisomer, hydrate, solvate or pharmaceutically acceptable salt according to any one of claims 1 to 9.
11. The pharmaceutical composition according to claim 10, wherein, The uncontrolled cell proliferation disease mentioned is cancer.
12. The pharmaceutical composition according to claim 11, wherein, The cancers mentioned are selected from childhood acute leukemia, medulloblastoma, brain cancer, lung cancer, leukemia, bladder cancer, colon cancer, cervical cancer, endometrial cancer, ovarian cancer, squamous cell carcinoma, kidney cancer, peritoneal cancer, breast cancer, stomach cancer, colorectal cancer, prostate cancer, pancreatic cancer, urogenital tract cancer, lymphoma, laryngeal cancer, skin cancer, malignant melanoma, colorectal cancer, endometrial cancer, thyroid cancer, rhabdomyosarcoma, liver cancer, and combinations thereof.
13. The pharmaceutical composition according to claim 12, wherein, The cancer has a neuroendocrine phenotype.
14. The pharmaceutical composition according to claim 13, wherein, The cancer in question is neuroendocrine prostate cancer, castration-resistant prostate cancer, or pulmonary neuroendocrine tumor.
15. The pharmaceutical composition according to claim 10, wherein, The pharmaceutical composition also contains at least one known agent for treating cancer.
16. The pharmaceutical composition according to claim 15, wherein, The at least one pharmaceutical agent is selected from: Uracil nitrogen mustard, nitrogen mustard, cyclophosphamide, ifosfamide, melphalan, chlorambucil, piperobromidine, triethylene melamine, triethylene thiophosphatidylcholine, busulfan, carmustine, lomustine, streptozotocin, dacarbazine, temozolomide, thiotepa, hexamethylmelamine, methotrexate, 5-fluorouracil, fluorouracil, cytarabine, 6-mercaptopurine, 6-thioguanine, fludarabine phosphate, pentostatin, bortezomib, vinblastine, vincristine, vinorelbine, vindesine, bleomycin, actinomycin D, daunorubicin, doxorubicin, epirubicin, dexamethasone, clofarabine, cladribine, pemetrexed, idarubicin, paclitaxel, docetaxel, ixabepilone, procainamide, topotecan, irinotecan, deoxymyopicrin Mitomycin C, L-Asparaginase, Interferon, Etoposide, Teniposide, 17α-Ethinylestradiol, Diethylstilbestrol, Testosterone, Prednisone, Fluoromethyltestosterone, Drotahistamine Propionate, Testrolide, Medroxyprogesterone Acetate, Tamoxifen, Methylprednisolone, Methyltestosterone, Prednisolone, Triamcinolone, Chlorestrin, Hydroxyprogesterone, Ammoniaglutide, Estrogen, Medroxyprogesterone Acetate, Leucine Proprene, flutamide, toremifene, goserene, cisplatin, carboplatin, hydroxyurea, acridine, procarbazine, mitotane, mitoxantrone, levamisole, novibone, anastrozole, letrozole, capecitabine, raloxifene, droloxifene, hexamethylmelamine, oxaliplatin, gefitinib, capecitabine, erlotinib, azacitidine, temozolomide, gemcitabine, or angiostatin; DNA methyltransferase inhibitors, HDAC inhibitors, glucocorticoids, mTOR inhibitors, cytotoxic agents, BCL2 inhibitors, FLT3 inhibitors, IDH 1 / 2 inhibitors, CDK inhibitors, transcription inhibitors, or HSP inhibitors; or combinations thereof.
17. The pharmaceutical composition according to claim 16, wherein... The DNA methyltransferase inhibitor is 5-aza-2'-deoxycytidine, 5-azacytidine, zabraline, epigallocatechin-3-gallate, procaine, or a combination thereof; The HDAC inhibitors are vorinostat, entenostat, pabistat, trogostatin A, moxistat, belistat, danostat, givitstat, tobastatin A, plascinnostat, drocinnostat, quincinnostat, romidesin, valproic acid, AR-42 (OSU-HDAC42), acetyldinarin, ricinolone, aspirin, or combinations thereof; The glucocorticoids mentioned are dexamethasone, prednisolone, methylprednisolone, betamethasone, triamcinolone, fludrocortisone, beclomethasone, or combinations thereof; The mTOR inhibitor is BEZ235, everolimus, sirolimus, tesirolimus, rapamycin, AZD8055, or a combination thereof; The cytotoxic agent is selected from alkylating agents, antimetabolites, antitumor antibiotics, mitotic inhibitors, or chemotherapeutic agents selected from anthracyclines, cytarabine, purine analogs, sorafenib, ozogatozumab, rituximab, or combinations thereof. The alkylating agent is selected from carboplatin, cisplatin, cyclophosphamide, chlorambucil, melphalan, carmustine, busulfan, lomustine, dacarbazine, oxaliplatin, ifosfamide, nitrogen mustard, temozolomide, thiotepa, bendamustine, and streptozotocin. The antimetabolites are selected from gemcitabine, 5-fluorouracil, capecitabine, hydroxyurea, mercaptopurine, pemetrexed, fludarabine, nerabine, cladribine, clofarabine, cytarabine, decitabine, pralatrexate, fluorouridine, methotrexate, and thioguanine. The antitumor antibiotics are selected from doxorubicin, mitoxantrone, bleomycin, daunorubicin, actinomycin D, epirubicin, idarubicin, procainoxicin, mitomycin, pentostatin, and pentorubicin; The mitotic inhibitors are selected from irinotecan, topotecan, rubitecan, cabazitaxel, docetaxel, paclitaxel, etoposide, vincristine, ixaprilone, vinorelbine, and teniposide. The BCL2 inhibitor is venetoclax, navittoclax, ombatoc mesylate, sabutoc, or risatoclax; The FLT3 inhibitor is midotutolin, quezartinib, girritinib, sorafenib, clarabib, or pericidatinib; The IDH 1 / 2 inhibitors are evanixib, enxidipine, vorasidinil, ostasidinil, AGI-6780, AGI-5198, or GSK321; The CDK inhibitors are samuraciclib, alvocidib, fadraciclib, seliciclib, zotiraciclib, atuveciclib, enitociclib, voruciclib, SY5609, XL201, Q-901, KRLS-017, GTAEXS-617, TGN-1062, THZ1, THZ2, SY-1365, YKL-5-124, and ICE. C0942, LY3405105, LDC4297, BS-181, SNS-32, AT-7519, AZD-4573, KB-0742, AU-07, BTXA-51, GFH-009, JS-101 , PRT-2527, QHRD-107, TP-1287, SYHX-1903, CTX-439, KIN-004, SY-12882, THZ-531, CT-7439, AU-003 or AU-004; The transcriptional inhibitor is rupettedine; and The HSP inhibitor is phenytoin, phenytoin, spiramycin, aspiramycin, gatspeptide, onanaspi, gerdemycin, or azadirachtin.
18. A method for modulating cereblon activity or GSPT1 activity in at least one cell, comprising contacting the at least one cell in vitro with an effective amount of the compound or its stereoisomer, hydrate, solvate or pharmaceutically acceptable salt according to any one of claims 1 to 9.
19. A method for treating uncontrolled cell proliferation disorders, comprising administering to a subject a therapeutically effective amount of the compound or its stereoisomer, hydrate, solvate or pharmaceutically acceptable salt according to any one of claims 1 to 9.
Citation Information
Patent Citations
Process for the production of mycorrhizal fungi
EP0015103A1
Substituted n-(2-(2,6-dioxopiperidin-3-YL)-1,3-dioxoisoindolin-5-YL)arylsulfonamide analogs as modulators of cereblon protein
WO2022066835A1