Breeding method of high-yield high-quality disease-resistant triploid flowering Chinese cabbage variety

Abstract

The invention provides a breeding method of a triploid flowering Chinese cabbage variety, which comprises the following steps of: (1) hybridizing cabbage type rape serving as a female parent and flowering Chinese cabbage serving as a male parent to obtain a triploid hybrid F1 generation; (2) performing phenotype identification on the triploid hybrid F1 generation, and screening combinations which are early in bolting, synchronous in main stem and lateral branch development, obvious in subgenome heterosis and resistant to clubroot; (3) performing a multi-point planting test on the excellent triploid hybrid F1 to verify the yield and disease resistance of the flowering Chinese cabbage; and (4) breeding a special triploid flowering Chinese cabbage variety for seed production. The triploid flowering Chinese cabbage cultivated by the method has the following outstanding advantages of high yield, high economic value, strong disease resistance, multi-round picking and long market supply period. The method provided by the invention solves the problems of lack of special varieties of traditional brassica campestris and low yield of brassica campestris of a dual-purpose variety of brassica campestris, provides a new technical route for germplasm innovation of brassicaceous vegetables, and has important popularization and application values.

Description

Technical Field

[0001] This invention belongs to the field of plant breeding technology, specifically relating to a method for breeding high-yielding, high-quality, and disease-resistant rapeseed varieties using triploid materials and its application in autumn, winter, and spring vegetable production. Background Technology

[0002] Currently, the rapeseed scape (Brassica napus L., genome AACC, tetraploid) on the market is mainly divided into two types: "dual-purpose" (oil and vegetable) and "dedicated" (for specific purposes). The "dual-purpose" type can be harvested 1-2 times, and data from Anhui, Zhejiang, Chongqing, and other regions show that its yield is 1.2-2 times that of rapeseed alone. Dedicated rapeseed scape varieties (such as Xiziyuan No. 1 and Xiziyuan No. 2) yield approximately 600-800 kg per mu (approximately 0.067 hectares), with a yield 3-6 times that of rapeseed alone. In comparison, dedicated rapeseed scape varieties can be harvested multiple times, resulting in higher yields, a longer supply period, and more flexible cropping arrangements, solving the problem of succession with crops such as rice.

[0003] Despite this, existing Brassica napus (Brassica napus) varieties still have some problems, such as a lack of varieties specifically for flowering stems, insufficient realization of yield advantages, lack of resistance to clubroot disease, and poor resistance to sclerotinia stem rot. Crossing Brassica napus with Chinese cabbage (diploid, genome AA) produces triploid hybrids (genome AAC) with strong heterosis in terms of biomass. This heterosis stems from the interaction between the Brassica napus A subgenome and the Chinese cabbage A genome, mainly manifested as an additive gene effect, known as subgenomic heterosis. Although this hybridization method has been used in research on improving the traits of rapeseed or Chinese cabbage, due to the disordered meiosis of the resulting triploid materials and the extremely unstable offspring, there is no precedent for its direct application as a crop. Triploid materials are only used as intermediate materials for improving rapeseed or Chinese cabbage, and are further backcrossed or hybridized with rapeseed or Chinese cabbage.

[0004] This invention utilizes interspecific hybridization between Brassica napus and Chinese cabbage to obtain triploid hybrids in a field environment. These triploid hybrids are then creatively used for breeding specific varieties of flowering cabbage (rapeseed shoots), fully leveraging subgenomic hybrid vigor to achieve a breakthrough in the improvement of flowering cabbage varieties and overcome the shortcomings of existing technologies. This triploid flowering cabbage exhibits significant vegetative growth advantages, characterized by synchronous development of the main stem and lateral branches, more than eight harvests per plant during the growing season, and a yield of 800-1100 kg per plant. Through the inheritance of disease-resistant gene loci carried by the Brassica napus parent, the triploid flowering cabbage demonstrates significant disease resistance. Summary of the Invention

[0005] The purpose of this invention is to provide a method for breeding high-yielding, high-quality, and disease-resistant triploid rapeseed varieties specifically for rapeseed, in order to overcome the shortcomings of existing varieties, and to particularly emphasize the pioneering application of triploid materials in rapeseed breeding.

[0006] The method for breeding triploid rapeseed varieties provided by this invention includes the following steps:

[0007] (1) Using Brassica napus L. (AACC) as the female parent and Brassica rapa L. (AA) as the male parent, a triploid hybrid F1 generation was obtained; the Brassica napus is a stable material with early bolting, strong branching ability and resistance to clubroot disease;

[0008] (2) Phenotypic identification of triploid hybrid F1 generation was carried out to screen for lines that bolt early, develop the main stem and lateral branches synchronously, have strong subgenome heterosis, and are resistant to clubroot disease;

[0009] (3) Conduct multi-location planting trials on the superior triploid hybrid F1 to verify its rapeseed yield and disease resistance;

[0010] (4) Select and breed triploid rapeseed varieties specifically for rapeseed production.

[0011] Among them, the flowering cabbage mentioned in step (1) includes, but is not limited to, red flowering cabbage and white flowering cabbage.

[0012] Among them, the rapeseed mentioned in step (1) is the stable material '0M109' which bolts early, has strong branching ability, and is resistant to clubroot disease, and the Chinese cabbage is the red cabbage 'Royal First-Class Red' which bolts early, has strong branching ability, and is of good marketability.

[0013] Among them, the subgenomic heterosis mentioned in step (2) is manifested as vigorous vegetative growth and high rapeseed yield.

[0014] In step (2), the resistance to clubroot disease is confirmed by molecular marker selection or field resistance identification.

[0015] Among them, the triploid hybrid F1 has the AAC genome and has the characteristics of early bolting, synchronous development of main and lateral branches, long harvest period, high yield and resistance to clubroot disease.

[0016] In one specific embodiment of the present invention, the method for breeding triploid rapeseed varieties includes the following steps:

[0017] (1) Parental selection: Brassica napus L. (AACC) is used as the female parent. The Brassica napus L. is a stable line that bolts early, has strong branching ability, and is resistant to clubroot disease. It can be an inbred line or a sterile line. Brassica rapa L. (AA) is used as the male parent. Pure lines with excellent bolting traits, such as red cabbage scapes and white cabbage scapes, can be selected.

[0018] (2) Hybridization: Artificial emasculation and chemical emasculation (no emasculation for sterile lines) are carried out when the female parent rapeseed is in the bud stage (when the bud is 3-5 mm long), and then the male parent Chinese cabbage is pollinated with fresh fresh pollen and then bagged for isolation.

[0019] (3) Obtaining AAC triploid hybrid F1 generation: After pollination, the seeds are harvested through natural fruiting and then sown to obtain triploid F1 generation plants.

[0020] (4) Screening of superior triploid hybrid F1: Phenotypic identification was performed on triploid hybrid F1 plants to screen for lines that bolted early, developed the main stem and lateral branches synchronously, exhibited strong subgenomic heterosis, and were resistant to clubroot disease. Among these, subgenomic heterosis was manifested in vigorous vegetative growth and high flowering stem yield; resistance to clubroot disease was confirmed by molecular marker identification.

[0021] (5) Verification of variety characteristics: Multi-point planting trials were conducted on the selected superior triploid hybrid F1 to further verify its rapeseed yield and disease resistance.

[0022] This invention is the first to apply triploid materials to the breeding of rapeseed-specific varieties, fully leveraging the hybrid vigor and unique growth characteristics of triploid plants. Compared with traditional tetraploid rapeseed varieties, triploid rapeseed exhibits significant growth advantages, and through modern breeding techniques such as molecular marker-assisted selection, precise improvements in rapeseed yield and disease resistance have been achieved. This innovative breeding strategy provides a new direction for germplasm innovation in cruciferous vegetables and has significant application value.

[0023] Compared with existing technologies, the triploid rapeseed cultivated in this invention has the following outstanding advantages: high yield, high economic value, strong disease resistance, multiple harvests, and a long market supply period. This invention solves the problems of the scarcity of traditional rapeseed-specific varieties and the low yield of dual-purpose rapeseed varieties, providing a new technical route for the germplasm innovation of cruciferous vegetables and has important value for promotion and application. Attached Figure Description

[0024] Figure 1 The results of the disease resistance identification of the triploid rapeseed 'Zaotai T5R' parent 0M109 (Brassica napus type) are shown.

[0025] Figure 2 The results of chromosome karyotype identification for the triploid rapeseed 'Zaotai T5R' are shown (scale bar is 10 μm).

[0026] Figure 3 The results show the molecular identification of clubroot resistance in the triploid rapeseed 'Zaotai T5R'.

[0027] Figure 4 The image shows a production trial of the triploid rapeseed 'Zaotai T5R'.

[0028] Figure 5 The image shows the field performance of the triploid rapeseed 'Zaotai T5R'. Detailed Implementation

[0029] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention.

[0030] Example 1: Obtaining triploid rapeseed plants

[0031] (1) Selection and preparation of parental lines: The female parent is selected from rapeseed varieties of the Brassica napus type, which are required to bolt early, have strong branching ability, and be highly resistant to clubroot disease. Rapeseed sowing, seedling raising, transplanting and field management are carried out in a conventional manner. The male parent is selected from red, white and red cabbage varieties with early bolting and strong branching ability. Sowing is carried out 20-30 days after the female parent sowing, and conventional field management is adopted in the later stage.

[0032] (2) Hybridization: The female parent rapeseed is artificially emasculated during the bud stage, and then pollinated with fresh fresh pollen from the male parent red rapeseed. The mixture is then bagged and isolated for 7 days.

[0033] (3) Obtaining triploid F1 generation: After the hybrid siliques mature, the seeds are harvested and sown to obtain triploid F1 generation plants. Chromosome number identification is performed on the root tips of the plants to confirm that the plants are AAC triploid hybrids containing 29 chromosomes.

[0034] Following the steps described above, eight rapeseed parent plants of the Brassica oleracea type were randomly crossed with nine Chinese cabbage parent plants to obtain a total of 24 triploid hybrid F1 strains. The specific combinations are shown in Table 1.

[0035] Table 1 Parental information of triploid hybrids

[0036] Example 2: Screening of superior triploid rapeseed shoots

[0037] All triploid hybrid F1 generations were transplanted to the field. 20-30 individual plants from each line were sampled for clubroot resistance molecular marker detection (marker name cnu_m090a, a publicly available marker linked to the PbBa8.1 site on the A genome; forward primer sequence: GCAAAGATCGGCGAAGAAGA; reverse primer sequence: TGCAGACACATTCGAACAAACA). F1 lines stably carrying clubroot resistance marker sites were screened. Morphological characteristics of the selected lines were further investigated, and bolting yield was measured. Superior triploid hybrids with early bolting, strong branching ability, significant subgenomic heterosis, and long harvesting period were selected.

[0038] Through systematic comparison, the superior hybrids T5R and 4R were selected from 24 triploid hybrids. Their parent combination was 0M109×V05, and the resulting triploid hybrid T5R was named "Early Bolting T5R" (Table 2). Among the combinations, 0M109 is a self-bred inbred line of Brassica napus (Huang Xiaoqin, Zhang Lei, Yang Xiaoxiang, et al. Analysis of the current status of disease resistance breeding of major rapeseed diseases in Southwest China based on disease resistance evaluation [J]. Chinese Journal of Oil Crops, 2023, 45(06):1103-1108.DOI:10.19802 / j.issn.1007-9084.2023215), which has the characteristics of early bolting, weak apical dominance of the main stem, strong branching ability, and strong comprehensive disease resistance (high resistance to clubroot, low resistance to sclerotinia stem rot, and resistance to viral diseases). Figure 1 The characteristics of V05 are as follows: V05 is a commercial red cabbage variety 'Royal Poinsettia', characterized by early bolting and strong branching ability. Upon identification, the hybrid T5R of this combination has 29 chromosomes and an AAC genome (…). Figure 2 All 28 F1 plants identified carried the clubroot resistance marker cnu_m090a. Figure 3 Through Chongqing Changshou ( Figure 4 Cultivation trials in Yibin and Pengzhou, Sichuan Province, have determined that the early-flowering T5R variety has advantages such as early flowering, synchronous development of the main stem and lateral branches, rapid development of lateral shoots after the main flower stalk is harvested (5-10 days), long harvesting period, multiple harvests, and high yield of flowering stalks (800-1100 kg / mu). Figure 5 ).

[0039] Table 2. Statistical results of traits in triploid hybrids

[0040]

[0041] Note: 1 This represents the number of plants containing clubroot resistance markers / total number of plants; 2 This represents the number of days from transplanting to the first harvest of the flowering stem; 3 The comparison of seedling growth with the commercial control variety "Multi-Harvest Rapeseed" was conducted using the visual inspection method; 4 To determine whether the lateral shoots develop synchronously with the main shoot, a visual inspection method is used.

[0042] Example 3: Cultivation Techniques and Production Trials

[0043] A production trial of the triploid rapeseed variety "Zaotai T5R" was conducted in Changshou District, Chongqing, with the commercial rapeseed variety "Duocai Youtai" serving as a control. Seedlings were raised and transplanted using the same method as conventional rapeseed cultivation, at a density of 40cm x 45cm. Transplanting took place on November 15, 2024. The planting area for Zaotai T5R was 10 mu (approximately 667 hectares), and for Duocai Youtai, 2 mu (approximately 0.13 hectares). Base fertilizer consisted of 1000kg of well-rotted organic fertilizer and 30kg of N:P:K compound fertilizer (N:K ratio 15:15:15) per mu. Seven days after survival, 7kg / mu of urea was applied as top dressing. Another 7kg / mu of urea was applied during the bolting stage, and 5kg / mu of urea was applied after each harvest.

[0044] According to statistics (Table 3), the control variety 'Duocaiyoutai' had weak seedling growth, with the first harvest on January 1, 2025; after harvesting, it suffered from severe diseases, with the last harvest on February 20, totaling 12 harvests, with an average yield of 412.5 kg / mu and a value of 2475 yuan / mu; after deducting fertilizer and labor costs of 1300 yuan / mu, the net value was approximately 1175 yuan / mu. The triploid rapeseed 'Zaotai T5R' had its first harvest on December 18 and ended on March 1 of the following year, totaling 15 harvests, with an average yield of 936.5 kg / mu and a value of 5619 yuan / mu; after deducting fertilizer and labor costs of 1500 yuan / mu, the net value was approximately 4100 yuan / mu.

[0045] Table 3. Statistical data from the production trial of Zaotai T5R.

[0046]

[0047] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A method for breeding triploid flowering stalk varieties, characterized in that, Includes the following steps: (1) Using Brassica napus L. (AACC) as the female parent and Brassica rapa L. (AA) as the male parent, a triploid hybrid F1 generation was obtained; the Brassica napus is a stable material with early bolting, strong branching ability and resistance to clubroot disease; (2) Phenotypic identification of triploid hybrid F1 generation was carried out to screen for lines that bolt early, develop the main stem and lateral branches synchronously, have strong subgenome heterosis, and are resistant to clubroot disease; (3) Conduct multi-location planting trials on the superior triploid hybrid F1 to verify its rapeseed yield and disease resistance; (4) Select and breed triploid rapeseed varieties specifically for rapeseed production.

2. The method for breeding triploid rapeseed varieties according to claim 1, characterized in that, The flowering cabbage mentioned in step (1) includes, but is not limited to, red flowering cabbage and white flowering cabbage.

3. The method for breeding triploid rapeseed varieties according to claim 1, characterized in that, The rapeseed mentioned in step (1) is '0M109', a stable material with early bolting, strong branching ability and resistance to clubroot disease, and the Chinese cabbage is 'Royal First-Class Red', a red cabbage with early bolting, strong branching ability and excellent marketability.

4. The method for breeding triploid rapeseed varieties according to claim 1, characterized in that, The subgenomic heterosis described in step (2) is characterized by vigorous vegetative growth and high rapeseed yield.

5. The method for breeding triploid rapeseed varieties according to claim 1, characterized in that, The clubroot resistance described in step (2) is confirmed by molecular marker selection or field resistance identification.

6. The method for breeding triploid rapeseed varieties according to claim 1, characterized in that, Its triploid hybrid F1 has an AAC genome and is characterized by early bolting, synchronous development of main and lateral branches, long harvest period, high yield, and resistance to clubroot disease.

Images