Application of arabidopsis thaliana GALT4 in regulation and control of pollen development

Abstract

The invention belongs to the technical field of agriculture and biology, discloses application of arabidopsis thaliana GALT4 in regulation and control of pollen development, and verifies that the arabidopsis thaliana GALT4 gene is a plant male fertility key regulation and control gene with high pollen specificity expression, and the CDS sequence is shown as SEQ ID NO.1 for the first time. Polarity elongation of the pollen tube is maintained by regulating and controlling spatial and temporal distribution of methyl esterified pectin in the pollen tube. Knockout or silencing of the homologous gene in a plant can lead to reduction of pollen viability, abnormal development of pollen cell nucleus, malformation of pollen morphology, slowing of pollen germination rate and hindering of pollen tube polarity elongation. The invention provides a brand new molecular target for plant pollen morphological development and pollen tube growth regulation and control, can be used for fertility regulation and control and hybrid seed production optimization of cruciferous crops, and has important theoretical research value and industrial application prospect.

Description

Technical Field

[0001] This invention belongs to the fields of agriculture and biotechnology, and in particular relates to the application of Arabidopsis thaliana GALT4 in regulating pollen development. Background Technology

[0002] Polar elongation of pollen tubes depends entirely on the dynamic synthesis and modification of the cell wall. Pectin is a core component of the pollen tube wall, especially the spatiotemporally specific distribution of methyl esterified homogalacturonic acid (HG) at the pollen tube apex, which is a key factor in maintaining polar growth of the pollen tube and ensuring its normal penetration of the style for fertilization. Glycosyltransferases are key enzymes involved in pectin synthesis, modification, and cell wall construction. GALT4 belongs to the Arabidopsis GT31 family of hydroxyproline-O-galactosyltransferases. Current research only confirms that it has galactosyltransferase activity and can participate in the glycosylation modification of arabinogalactan protein. It is basally expressed in tissues such as flowers and siliques, but its specific biological functions in pollen germination and polar elongation of pollen tubes are completely unknown. Its application value in the regulation of male gametophyte function and the fine regulation of crop fertility remains a research gap.

[0003] Currently, most fertility-regulating materials used in crop hybrid seed production are completely male-sterile lines, which suffer from limitations in pairing cytoplasmic male-sterile lines and difficulties in propagating traditional nuclear male-sterile lines. However, fertility-fine-tuning materials that regulate pollen germination and pollen tube elongation can achieve a balance between reducing self-pollination set rate in hybrid seed production and allowing for self-pollination and seed retention in parental reproduction, combining seed production efficiency with propagation convenience, demonstrating significant application advantages. However, key gene targets suitable for this technological approach are currently very scarce. Therefore, identifying key genes regulating pollen germination and pollen tube polarity elongation, clarifying their regulatory mechanisms, and developing corresponding fertility-fine-tuning technologies have significant theoretical research value and promising industrial application prospects. Summary of the Invention

[0004] To address the aforementioned technical issues, this invention proposes the application of Arabidopsis GALT4 in regulating pollen development, clarifying the core function of the Arabidopsis GALT4 gene in regulating plant male fertility. It regulates male fertility by influencing pollen tube polar elongation through the distribution of pollen tube pectin methyl esterification, thereby providing a novel gene target and technical solution for utilizing heterosis in cruciferous crops. This reduces the existing problems of scarce functional male sterility targets and limited technology for creating sterile lines.

[0005] To achieve the above objectives, this invention provides the application of Arabidopsis GALT4 in regulating pollen development, and the CDS sequence of the Arabidopsis GALT4 gene is shown in SEQ ID NO.1.

[0006] Preferably, regulating plant pollen development includes one or more of the following: regulating pollen viability, pollen cell nucleus development, pollen morphogenesis, pollen germination, and pollen tube polar elongation.

[0007] Preferably, the Arabidopsis GALT4 gene maintains the polar elongation of pollen tubes by regulating the distribution of methylated pectin in the pollen tube, thereby regulating the male fertility of the plant.

[0008] Preferably, the methylated pectin includes highly methylated homogalacturonic acid and low-methylated homogalacturonic acid.

[0009] The study also provides the application of the Arabidopsis GALT4 gene in the cultivation of male-sterile lines in plants. The CDS sequence of the Arabidopsis GALT4 gene is shown in SEQ ID NO.1. By knocking out or silencing the homologous GALT4 gene in plants, male-sterile phenotypes such as reduced pollen viability, abnormal development of pollen cell nuclei, malformed pollen morphology, and inhibited pollen tube germination and elongation are induced.

[0010] Preferably, the plant is a cruciferous plant.

[0011] Preferably, cruciferous plants include one or more of rapeseed, Chinese cabbage, and kale.

[0012] A method for cultivating male-sterile plants is also provided, which involves knocking out or silencing the GALT4 gene in the target plant that is homologous to the sequence shown in SEQ ID NO.1, thereby completely eliminating the function of the GALT4 gene in the target plant and obtaining male-sterile plants.

[0013] Preferably, the target plant is a plant of the Brassicaceae family.

[0014] A method for restoring fertility in male-sterile plants is also provided, which involves introducing the Arabidopsis thaliana GALT4 gene shown in SEQ ID NO.1 into the male-sterile plant to restore the function of the GALT4 gene and restore the male fertility of the plant.

[0015] Compared with the prior art, the present invention has the following advantages and technical effects: 1) This invention is the first to clearly define the pollen-specific high expression characteristics of the Arabidopsis GALT4 gene, and the first to confirm that this gene is a key regulatory gene for pollen germination and pollen tube polar elongation in plants. Its loss of function will simultaneously affect pollen viability, nuclear development, morphogenesis, and pollen tube germination and elongation. This fills the research gap in the field of plant pollen and pollen tube development, and provides a new technical means for fertility regulation and hybrid seed production of cruciferous crops. Pollen tube growth performance can be optimized by regulating the expression of the GALT4 gene, which has important theoretical research value and industrial application prospects.

[0016] 2) This invention elucidates for the first time the molecular mechanism by which GALT4 regulates the polar elongation of pollen tubes, confirming that the protein is located in the Golgi apparatus and maintains the pectin methyl esterification gradient at the tip of the pollen tube by regulating the spatiotemporal distribution of methyl esterified pectin in the pollen tube, thereby ensuring the normal polar growth of the pollen tube. This provides a new theoretical perspective for the study of plant cell wall modification and pollen tube growth mechanism.

[0017] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0018] Figure 1 The figure shows the expression pattern analysis of AtGATL4. In the figure, A is the expression of AtGATL4 in different organs of Arabidopsis thaliana verified by RT-PCR, where Se represents seedling, R represents root, S represents stem, L represents leaf, and F represents flower; B is the relative expression level of AtGATL4 in different tissues of Arabidopsis thaliana verified by qRT-PCR. Figure 2 Image showing the results of GUS chemical staining; Figure 3 The diagram shows the genotype and expression identification of the atgalt4 mutant. Figure A is a schematic diagram of the AtGATL4 gene structure and the insertion site of T-DNA in the atgalt4-1 and atgalt4-2 mutants. Figure B is the agarose gel electrophoresis result of the three-primer PCR method for identifying the homozygous atgalt4 mutant. Figure C is the result of RT-PCR detection of the full-length transcript of AtGATL4 in wild-type, atgalt4-1, and atgalt4-2 mutants. Figure 4 The figures show the Alexandrite staining results of pollen viability in the atgalt4 mutant. Figure A shows the Alexandrite staining micrographs of wild-type pollen; B shows the Alexandrite staining micrographs of atgalt4-1 mutant pollen; C shows the Alexandrite staining micrographs of atgalt4-2 mutant pollen; D shows the Alexandrite staining micrographs of pollen from the pGATL4::GATL4 / gatl4 complementary plant; and E shows the statistical results of the percentage of viable pollen in different lines. This means P < 0.05. This represents P < 0.001; Figure 5The figures show the DAPI staining results of pollen cell nuclear development in atgalt4 mutants. In the figures, A is a DAPI staining micrograph of atgalt4-1 mutant, B is a DAPI staining micrograph of pollen from pGATL4::GATL4 / gatl4 complementary plants, C is a DAPI staining micrograph of pollen from atgalt4-2 mutant, and D is a DAPI staining micrograph of wild-type pollen. E shows the statistical results of the proportion of pollen cells that developed to the trinuclear stage in different lines. Different lowercase letters indicate P < 0.05. Figure 6 The images show the scanning electron microscope (SEM) images of mature pollen morphology from the atgalt4 mutant. A represents the SEM image of mature pollen grains from the atgalt4-1 mutant; B represents the SEM image of mature pollen grains from the pGATL4::GATL4 / gatl4 complementary plant; C represents the SEM image of mature pollen grains from the atgalt4-2 mutant; D represents the SEM image of mature pollen grains from the wild type; and E shows the statistical results of the proportion of abnormal pollen morphology in different strains. In the figures, ns represents P > 0.05. P < 0.05, F is a magnified SEM image of mature pollen grains of wild type, G is a magnified SEM image of mature pollen grains of atgalt4-1 mutant, H is a magnified SEM image of mature pollen grains of atgalt4-2 mutant, and I is a magnified SEM image of mature pollen grains of pGATL4::GATL4 / gatl4 complementary plant. Figure 7 This is a phenotypic analysis of pollen germination and pollen tube elongation in the atgalt4 mutant. Figure A shows micrographs of pollen germination experiments after 2h, 4h, and 12h of in vitro culture of wild-type, atgalt4-1 mutant, and pGATL4::GATL4 / gatl4 complementary plants; Figure B shows the statistical results of pollen tube length at different culture times. This represents P < 0.001. P represents P < 0.0001; C represents the statistical results of pollen germination efficiency at different culture times; D represents the semi-in vitro germination experiment micrographs of pollen from wild-type, atgalt4-1 mutant, and pGATL4::GATL4 / gatl4 complementary plants, showing the pollen tubes emerging from the style 2h, 6h, and 12h after pollination. Figure 8The image shows a confocal micrograph of the subcellular localization of AtGATL4. In the image, A is the green fluorescence signal of the 35S::GATL4:EGFP fusion protein, B is the bright field image of tobacco leaf epidermal cells, C is the red fluorescence signal of the Golgi marker protein 35S::SYP61:RFP, and D is a combined image of the green and red fluorescence signals. Figure 9 This image shows the immunofluorescence labeling results of pectin methyl esterification distribution in Arabidopsis pollen tubes. In the image, A represents the fluorescence signal of highly methylated homogalacturonic acid (HG) labeled with JIM7 antibody in pollen tubes of wild-type, atgalt4-1 mutant, and pGATL4::GATL4 / gatl4 complementary plants. B represents the fluorescence signal of low-methylated HG labeled with JIM5 antibody in pollen tubes of wild-type, atgalt4-1 mutant, and pGATL4::GATL4 / gatl4 complementary plants. Detailed Implementation

[0019] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0020] Unless otherwise defined, the technical or scientific terms used in this invention shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

[0021] Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without inventive effort are within the scope of protection of this invention. Experimental methods in the following embodiments that do not specify specific conditions are generally determined according to national standards.

[0022] Unless otherwise defined or stated, all technical and scientific terms used in this invention have the same meaning as those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein can be applied to the methods of this invention. It should be noted that, unless otherwise specified, the embodiments and features described in this invention can be combined with each other.

[0023] Unless otherwise stated, all experimental instruments, equipment, and reagents used in the following examples are commercially available raw materials.

[0024] In the examples, wild-type Arabidopsis thaliana Col-0 was obtained from seeds preserved in our laboratory. The seeds of Arabidopsis thaliana GALT4 loss-of-function mutants glt4-1 and glt4-2 were purchased from the Arabidopsis thaliana mutant website (https: / / arabidopsis.info / ). The seeds of the complementary lines of the mutant pGATL4::GATL4 / gatl4 were obtained by infecting the constructed vector and then cultured in the laboratory.

[0025] Example 1 Tissue expression pattern analysis of the Arabidopsis GALT4 (AtGALT4) gene.

[0026] This embodiment systematically verifies the tissue expression characteristics of AtGALT4 using four methods: electronic expression profiling, RT-PCR, qRT-PCR, and GUS histochemical staining. The specific experimental steps are as follows: 1) Electronic expression profile analysis.

[0027] Log in to the Arabidopsis eFP Browser, enter the gene number AT1G27120 of AtGALT4, and retrieve the expression data of this gene in different tissues and developmental stages of Arabidopsis to obtain the electronic expression profile results. The CDS sequence of the AtGALT4 gene is shown in SEQ ID NO.1.

[0028] The results showed that AtGALT4 was expressed at a significantly higher level in mature pollen than in other tissues, while its expression was extremely low in vegetative organs such as roots, stems, leaves, and seedlings, and was almost undetectable. This preliminarily confirms that AtGALT4 is a pollen-specific expression gene.

[0029] 2) RT-PCR semi-quantitative analysis.

[0030] Experimental procedure: Roots, stems, leaves and anthers of Arabidopsis thaliana WT and gatl4 mutants were collected after 4 weeks of growth and placed in 2mL centrifuge tubes. The tubes were then immediately placed in liquid nitrogen, and RNA was extracted using a full-gold RNA extraction kit.

[0031] The extracted total RNA was immediately reverse transcribed into cDNA. The reverse transcription volume was 20 µL using the TransGold One-Step gDNA Removal and cDNA Synthesis SuperMix kit. All components were gently mixed, incubated at 42°C for 30 min, and then stored at -20°C.

[0032] After unifying the concentration of the obtained cDNA, conventional PCR amplification was performed.

[0033] GATL4-RTF:ATGGCCTCAAGGAGCCTC (SEQ ID NO.2); GATL4-RTR: CTCTTCTAATGAATGTCTTGATGA (SEQ ID NO. 3).

[0034] RT-PCR results showed that AtGALT4 was only detected as a distinct amplified band in flower tissues, while almost no amplified bands were detected in seedlings, roots, stems, and leaves, consistent with the electronic expression profile results (e.g., ...). Figure 1(As shown in A).

[0035] 3) qRT-PCR quantitative analysis.

[0036] Roots, stems, leaves, and anthers of Arabidopsis thaliana were collected, placed in 2 mL centrifuge tubes, and immediately placed in liquid nitrogen for RNA extraction using a full-gold RNA extraction kit.

[0037] The extracted total RNA was immediately reverse transcribed into cDNA. The reverse transcription volume was 20 µL using the TransGold One-Step gDNA Removal and cDNA Synthesis SuperMix kit. All components were gently mixed, incubated at 42°C for 30 min, and then stored at -20°C.

[0038] After unifying the concentration of the obtained cDNA, qPCR reaction systems were prepared using primers GATL4-qRTF and GATL4-qRTR. The Tubulin gene was used as an internal control, and to avoid errors, each sample reaction was performed in triplicate.

[0039] The real-time quantitative PCR instrument used was an ABI 7500, and the SYBR method was used for quantitative experiments.

[0040] The specific components and amounts of the qRT-PCR reaction system are as follows: 2×qPCR SYBR Mix 10µL; Forward Primer(10 µM) 0.6µL; Reverse Primer(10 µM) 0.6µL; cDNA template 1µL; ddH2O 7.8µL.

[0041] GATL4-qRTF: TTGGGATCATTACCTCCGTTTC (SEQ ID NO.4); GATL4-qRTR: TGCAACGTTCTACATCTTCCTT (SEQ ID NO. 5).

[0042] Note: During qRT-PCR experiments, the CT value amplified by the internal reference gene Tubulin can be used to represent the cDNA concentration and quality level of the sample. Generally, a value less than 23 is suitable; otherwise, a low cDNA concentration may lead to significant errors in the quantification results. If the CT value amplified by the internal reference gene is greater than 23, it is best to re-extract high-quality and high-concentration RNA and reverse transcribe it again.

[0043] The results show (e.g.) Figure 1As shown in Figure B), AtGATL4 is expressed at the highest level in Arabidopsis pollen, and at extremely low levels in roots, leaves, and pods, almost undetectable.

[0044] 4) GUS histochemical staining analysis.

[0045] A GUS fusion expression vector for the AtGATL4 gene promoter was constructed. The expression vector was DX2181, and the restriction enzyme site was kpnI.

[0046] The primer sequences for amplifying the AtGATL4 gene promoter are as follows.

[0047] AtGATL4(gus-F): AGCTTGGCTGCAGGTCGACGGATCCCCTTAAGAACACCATTG (SEQ ID NO. 6); AtGATL4(gus-R): TAAGGGACTGACCACCCGGGGATCCCCTGAACCTAATTCT (SEQ ID NO. 7).

[0048] Screening of positive plants: Transformed Arabidopsis thaliana T1 generation seeds were collected, sterilized, and then evenly sown on 1 / 2 MS medium containing 15 mg / L hygromycin-resistant medium. After approximately 10 days of growth in a Arabidopsis thaliana light culture room, positive seedlings showed faster growth than non-positive seedlings. The taproots of positive seedlings were fully embedded in the medium and exhibited good growth, with cotyledons also unfolding. These positive seedlings were then transplanted into the substrate for normal culture to obtain positive plants.

[0049] CUS staining.

[0050] S1. Prepare GUS staining solution.

[0051] Take 50×X-Gluc stock solution (20 mg / mL) and mix thoroughly with GUS buffer (50 mM phosphate buffer pH 7.0, 0.5 mM potassium ferricyanide, 0.5 mM potassium ferrocyanide, 10 mM EDTA, 0.1% Triton X-100) at a volume ratio of 1:50. Prepare and use immediately.

[0052] S2. Sample collection: Cut the flowers and leaves of the positive plants into small pieces, place them in a 1.5 mL centrifuge tube, add freshly prepared GUS staining solution until the tissue sample is completely submerged.

[0053] S3. Incubation: Wrap the centrifuge tubes with aluminum foil and incubate at 37°C for 1-24 hours, observing the appearance of the blue signal during this period. The blue color gradually appears as the incubation time increases. When the expression level is high, the active site of GUS appears blue.

[0054] S4. Decolorization: After incubation, remove the GUS staining solution, add 70% anhydrous ethanol, and decolorize at room temperature 2-3 times, 1 hour each time, until the negative control tissue is completely white and the chlorophyll is completely removed.

[0055] S5. Observation and photography: The sample is stored in ethanol and can be observed with the naked eye or under a regular optical microscope. The blue on the white background is the GUS expression site, and the distribution location of the GUS blue signal is recorded.

[0056] The results showed that a strong blue GUS signal was detected only in the mature pollen of transgenic plants, while no GUS signal was detected in other parts of floral organs, roots, stems, leaves, or other vegetative tissues (e.g., Figure 2 As shown in the figure, the results are completely consistent with those of RT-PCR and qRT-PCR, further confirming that AtGALT4 is a pollen-specific highly expressed gene in Arabidopsis thaliana.

[0057] Example 2 Identification of AtGALT4 homozygous mutants and creation of complementary plants.

[0058] In this embodiment, the purchased T-DNA insertion mutants GABI_691E07 and SAIL_06401 were named atgatl4-1 and atgatl4-2, respectively. Homozygous identification was performed on them to verify that they were nonsense mutants with complete loss of function. Complementary plants were created for subsequent function recovery experiments. The specific steps are as follows: 1) Identification of homozygosity of AtGALT4 mutants.

[0059] Homozygous mutant plants were identified using the three-primer method (e.g.) Figure 3 (As shown in Figure B). The specific operation is as follows: S1. Use the online tool T-DNA Primer Design to find the sequences of the forward primer LP, reverse primer RP, and universal primer BP required for identifying the mutant; S2. Perform PCR amplification using LP+RP and RP+ intermediate primers respectively, and detect the products by agarose gel electrophoresis. S3. If the PCR product of LP+RP amplification has no target band, and the PCR product of RP+ intermediate primer has a target band, then the plant identified is a homozygous mutant.

[0060] atgatl4-1-LP: AGAGCCATTGTTAGGGAAAGG (SEQ ID NO. 8); atgatl4-2-LP: TTCACTCCGATTTCATTGGAC (SEQ ID NO.9); atgatl4-1-RP: CCTAAGGCCCTGTGAATTAGG (SEQ ID NO. 10); atgatl4-2-RP: CGAATATCAGCAGAAACGGAG (SEQ ID NO. 11); 2) T-DNA insertion site sequencing verification.

[0061] PCR amplification and sequencing were performed using AtGATL4 gene-specific primers (atgatl4-1-RP, atgatl4-2-RP) and T-DNA universal primers (O8409, LBb1.3) to determine the insertion site. Sequencing results showed that both mutants inserted into exons of AtGATL4 (e.g., ...). Figure 3 (As shown in A).

[0062] O8409: ATATTGACCATCATACTCATTGC (SEQ ID NO. 12); LBb1.3:ATTTTGCCGATTTCGGAAC (SEQ ID NO. 13).

[0063] 3) RT-PCR was used to verify the transcript deletion of the mutant.

[0064] Experimental procedure: RNA from atgatl4-1 and atgatl4-2 mutants was extracted and reverse transcribed into cDNA as a template. ACTIN was used as a semi-quantitative internal reference gene to prepare the PCR reaction system.

[0065] The primer sequences are as follows.

[0066] ACTIN-F: ATGGCTGAGGCTGATGATATT (SEQ ID NO.14); ACTIN-R: TTAGAAACATTTTCTGTGAACGATT (SEQ ID NO. 15); GATL4-F: AGGTAAAGTGGGTGGCTGCTC (SEQ ID NO. 16); GATL4-R: ACATCCACAACCATCACCCC (SEQ ID NO. 17).

[0067] The results showed that a clear amplification band of the full-length AtGALT4 transcript was detected in wild-type plants, while no amplification band was detected in the homozygous mutants of galt4-1 and galt4-2 (e.g., Figure 3 As shown in Figure C), both mutants were confirmed to be nonsense mutants with complete loss of AtGALT4 function.

[0068] 4) Construction of pGATL4::GATL4 / gatl4 complementary plants.

[0069] The full-length DNA of GATL4 was amplified using primers pGATL4::GATL4-L and pGATL4::GATL4-R and the restriction endonuclease (T / CTAGA), extending 2 kb upstream of the GATL4 start codon. This amplified DNA was then cloned into the linear vector pCam35tlegfps2#4. The constructed expression vector plasmid was transformed into Agrobacterium GV3101. Positive strains were obtained, and the gatl4 mutant was infected using the inflorescence infection method to obtain pGATL4::GATL4 / gatl4 complementary plants.

[0070] pGATL4::GATL4-L: ATTACGAATTTCGACCTGCAAATAGATCCAAGAGGTTTCT (SEQ ID NO. 18); pGATL4::GATL4-R: ACCGGCGCTCAGTTGGAAT(SEQ ID NO.19); T / CTAGA:tcccctgaagatacaaatcgat (SEQ ID NO. 20).

[0071] Example 3 Detection of the effect of AtGALT4 on pollen development.

[0072] This embodiment systematically examines the effects of AtGALT4 dysfunction on pollen viability, nuclear development, and morphogenesis using three methods: Alexander staining, DAPI staining, and scanning electron microscopy.

[0073] Experimental materials: Wild-type Arabidopsis thaliana Col-0, galt4-1 homozygous mutant, galt4-2 homozygous mutant, and pGATL4::GATL4 / gatl4 complementary plants were planted at the same time under the same culture conditions, and the flowers that had just begun to show white and had not yet opened were used as experimental materials.

[0074] 1) Alexandrine staining to detect pollen viability.

[0075] Select the pistil from a flower that has just begun to show white color but has not yet opened. Place it on a glass slide with a drop of Alexander stain, soak it for 10 minutes, rinse the pistil with a small amount of water, cover it with a coverslip, and observe it under a microscope.

[0076] The results showed that almost all pollen grains in the wild-type and complementary plants were stained purplish-red, with normal pollen viability and a viable pollen count exceeding 98%. However, in the galt4-1 and galt4-2 mutants, a large amount of pollen was stained green, exhibiting sterility characteristics. Specifically, the galt4-1 mutant had only 75.9% viable pollen, a decrease of 24.1% compared to the wild type, while the galt4-2 mutant had 76.3% viable pollen, a decrease of 23.7% compared to the wild type. The number of viable pollen grains in the complementary plants was not significantly different from that in the wild type (e.g., ...). Figure 4 (As shown in the image). The above results indicate that the AtGALT4 gene plays an important role in pollen viability, and its loss of function significantly reduces pollen viability in Arabidopsis thaliana.

[0077] 2) DAPI staining to detect pollen cell nuclear development.

[0078] S1. Preparation of DAPI staining solution: Prepare DAPI staining solution according to the formula shown in Table 1, and store at 4°C protected from light after preparation.

[0079] Table 1. Preparation of DAPI staining solution

[0080] S2. Take 30 μL of DAPI staining solution and add it to a glass slide. Take flowers that open at the same time from each lineage, hold the anther with tweezers, and gently dip the pollen into the DAPI staining solution to make the pollen evenly dispersed.

[0081] S3. Cover with a coverslip and let stand at room temperature in the dark for 5 minutes.

[0082] S4. Use the DAPI ultraviolet channel of a fluorescence microscope to take pictures and observe, and count the percentage of pollen that have developed to the trinucleate stage (1 vegetative nucleus + 2 sperm nuclei).

[0083] The results showed that over 95% of pollen in both wild-type and complementary plants completed two normal mitotic divisions and developed to the trinuclear stage; however, in the galt4-1 and galt4-2 mutants, only about 60% of pollen developed to the trinuclear stage, and about 40% remained at the uninucleate or binucleate stage, failing to complete normal nucleus development; the complementary plants completely reversed this defect, restoring the proportion of trinucleate pollen to the wild-type level (e.g., Figure 5 (As shown). The above results confirm that AtGALT4 is involved in regulating the development of Arabidopsis pollen cell nuclei, and its loss of function leads to abnormal pollen cell nucleus development.

[0084] 3) Observe pollen morphology using scanning electron microscopy.

[0085] S1. Pollen collection: Between 8:00 and 11:00 a.m., collect flowers that are currently in bloom from each strain. Use tweezers to quickly rub the pollen onto the wall of a 1.5 mL centrifuge tube. Open the cap of the centrifuge tube, cover the opening with sealing film, and poke several small holes in the sealing film with a toothpick.

[0086] S2. Drying treatment: Place the centrifuge tubes containing pollen in a 0℃ freeze dryer and freeze dry for 4-6 hours.

[0087] S3. Sample adhesion and gold sputtering: The dried pollen is adhered to the conductive tape for the scanning electron microscope, sputtered with gold, and then observed and photographed under the scanning electron microscope (model JSM-7500F).

[0088] The results showed that the morphology of mature pollen from wild-type and galt4-1, galt4-2, and complementary plant mutants was observed by scanning electron microscopy. Figure 6 (As shown in AD). Compared with wild-type mature pollen, some pollen grains in the galt4-1 mutant showed a collapsed morphology, and some pollen grains in the galt4-2 mutant showed a shriveled and wrinkled morphology. The pollen morphology of the complementary plant was not significantly different from that of the wild type. (Magnified observation is shown...) Figure 6 As shown in Figure F), the abnormal pollen volume of the mutant was significantly smaller than that of the wild type. Subsequently, the abnormal pollen was statistically analyzed (…). Figure 6 As shown in Figure E, compared to the wild type, approximately 40% of the pollen morphology in the galt4-1 and galt4-2 mutants is abnormal, and complementary plants can compensate for the abnormal pollen morphology in the mutants. These results confirm that AtGALT4 is a key regulatory gene for pollen morphogenesis in Arabidopsis thaliana, and its loss of function leads to abnormal pollen morphology.

[0089] Example 4 Effects of AtGALT4 on pollen germination and pollen tube elongation.

[0090] The regulatory effect of AtGALT4 on pollen germination rate and pollen tube elongation was verified through in vitro germination experiments and semi-in vitro germination experiments.

[0091] Experimental materials: Same as in Example 3.

[0092] 1) Pollen in vitro germination experiment.

[0093] S1. Preparation of pollen germination medium: Prepare pollen germination medium according to the formula shown in Table 2.

[0094] First, completely dissolve the sucrose in distilled water, then add the other components in sequence, mix thoroughly, add agar powder, heat to boiling until completely dissolved, pour the mixture onto a plate while hot, let it solidify, and set aside for use. Prepare the culture medium fresh each time.

[0095] Table 2 Pollen germination culture medium

[0096] S2. Pollen inoculation and culture: Take fresh flowers that open at the same time for each line. After the plant blooms, remove the anthers and gently spread them evenly on the surface of the pollen germination medium to disperse the pollen grains evenly on the surface of the medium. Inoculate 3 culture dishes for each line. After inoculation, seal with breathable sealing film and completely wrap with aluminum foil to protect from light. Place in an artificial climate chamber at 20-24℃ and 50% humidity for 2, 4 and 12 hours.

[0097] S3. Observation and statistics: After 2h, 4h and 12h of culture, the culture medium containing pollen was cut into small pieces with a scalpel, placed on a glass slide, and observed and photographed under an optical microscope.

[0098] S4. Use ImageJ software to count the pollen germination rate (pollen tube length exceeding pollen grain diameter is considered germination) and the average pollen tube length; use Prism software for data analysis and statistical difference analysis.

[0099] The results showed that the pollen germination rate and pollen tube growth of mutant and wild-type plants were statistically analyzed after 2, 4, and 12 hours of in vitro culture (e.g., ...). Figure 7 (As shown in AC). Two hours after pollination, neither the mutant nor the wild type showed any signs of germination. At 4 hours, the pollen germination rate of WT was 67%, with an average pollen tube germination length of 137.89 μm, while the germination rate of the atgatl4-1 mutant was only 31%, with an average pollen tube germination length of 25.94 μm. Twelve hours after pollination, the pollen germination rate of WT reached 91%, with an average pollen tube germination length of 271.63 μm, while the germination rate of the atgatl4-1 mutant was only 79%, with an average pollen tube germination length of 125.91 μm. This indicates that AtGATL4 is involved in regulating pollen tube germination and growth.

[0100] 2) In vitro germination experiment of pollen.

[0101] S1. Emasculation and pollination: Select WT flowers that have just begun to show white color and emasculate them. Then, use pollen from WT, atgatl4-1, and PGATL4:GATL4 / gatl4 to pollinate the emasculated pistils.

[0102] S2. Cultivation and Observation: Immediately after pollination, remove the pistil with tweezers and place it flat on the prepared pollen germination medium for cultivation at the specified time (2h, 4h, 6h). At 2h, 4h, and 6h after pollination, observe the pistil under a stereomicroscope and take pictures to record the number and length of pollen tubes that emerge from the style.

[0103] The results showed that 2 hours after pollination, no pollen tubes were observed to emerge from the style in any of the lines; 4 hours after pollination, a large number of pollen tubes emerged from the pistil style of the wild-type and complementary plants, with uniform length and vigorous growth, while the number of pollen tubes emerging from the pistil style of the galt4-1 mutant was extremely small, less than 20% of that of the wild type, and the pollen tubes were significantly shorter than those of the wild type; 6 hours after pollination, pollen tubes of the wild-type and complementary plants grew extensively, covering the surface of the culture medium, while the pollen tubes of the galt4-1 mutant remained extremely few and extremely short (e.g., ...). Figure 7 (As shown in D).

[0104] The above results confirm that the absence of AtGATL4 leads to a weakened ability of pollen tubes to pass through the stigma and a slower growth rate.

[0105] Example 5 Subcellular localization analysis of AtGALT4 protein.

[0106] The subcellular localization of the AtGALT4 protein was verified by using a transient transformation system in tobacco leaves combined with confocal microscopy.

[0107] 1) Construction of subcellular localization vector.

[0108] The stop codon was removed from the promoter sequence of the AtGATL4 gene, and the gene was amplified with whole-genome DNA to further construct the eGFP fusion protein expression vector of the AtGATL4 gene.

[0109] S1. Amplification of the target fragment: The CDS region (917bp) of the AtGALT4 gene with the stop codon removed was amplified using specific primers. Homologous arms of the BamHI restriction site were introduced at both ends of the primers. The PCR reaction system is shown in Table 3, and the primer sequences are shown below.

[0110] PCR reaction conditions: 94℃, 5 min, (94℃, 30 s, 60℃, 30 s, 72℃, 1 min) 30 cycles, 72℃, 5 min.

[0111] AtGATL4(BamH I)-F: CGAACGATAGCCATGGTACCaATGGCCTCAAGGAGCCTC (SEQ ID NO. 21); AtGATL4(BamH I)-R: CATGCCTGCGGCCGCCGGATCCCTCTTCTAATGAATG (SEQ ID NO. 22).

[0112] Table 3 PCR reaction system

[0113] S2, Vector digestion and linearization: The overexpression vector EGFP was digested with the restriction endonuclease BamHI.

[0114] Enzyme digestion system

[0115] Experimental procedure: Incubate at 37℃ for 60 min, then at 65℃ for 10 min.

[0116] S3. Recovery: The linearized vector and DNA fragments were recovered using a PCR product recovery kit (purchased from Beijing TransGen Biotech Co., Ltd.).

[0117] S4. Homologous recombination ligation: The CDS fragment of the GATL4 gene was ligated to the linearized vector e-GFP via homologous recombination. The homologous recombination reaction system is shown in Table 4.

[0118] Experimental procedure: After preparing the homologous recombination reaction system, the mixture was placed in a water bath at 50°C for 15 minutes.

[0119] Table 4 Homologous recombination reaction system

[0120] S5. Transformation: Transform the ligation product into E. coli. The detailed method is as follows.

[0121] Thaw competent cells on ice, add 5 μL of ligation product and mix gently, then incubate in a metal bath at 42°C for 30 min. Heat shock at 42℃ for 60 seconds, then quickly return to ice and let stand for 2 minutes; Add 500 mL LB, mix well, and incubate at 37°C and 200 rpm for 60 min. Spread 20 μL onto the corresponding antibiotic plate and incubate overnight at 37°C.

[0122] S6. Positive clone identification and plasmid extraction: Transformed E. coli colonies were selected for PCR screening. The primary screening primers were the universal vector primer eGFP-F and the gene-specific primer atgatl4(CDS)-R, with the sequences shown below.

[0123] eGFP-F: CAATCAAGCATTCTACTTCTATTGCAGCA (SEQ ID NO. 23); atgatl4(CDS)-R: CTCTTCTAATGAATGTCTTGATGA (SEQ ID NO. 24).

[0124] S7. Store the bacterial culture with the correct sequence alignment at -80°C.

[0125] 2) Instantaneous transformation of tobacco leaves.

[0126] S1. Agrobacterium activation: Take the bacterial solution out of the -80℃ freezer, add 1.5mL LB (add 1.5mL cannabidiol) and 500μL of bacterial solution to a sterile 15ml centrifuge tube, and activate it in a shaker at 28℃.

[0127] S2. Bacterial Culture and Resuspension: Transfer the activated bacterial culture to 50 mL of LB liquid medium containing the corresponding antibiotic at a ratio of 1:100, and incubate at 28°C on a shaker until OD. 600 The OD value was set at 0.8-1.0. The bacterial culture was poured into a 50 mL centrifuge tube and centrifuged at 6000 rpm for 10 min to collect the bacterial cells. The supernatant was discarded, and the cells were washed twice with resuspension buffer (as shown in Table 5). Finally, the OD value of the bacterial culture was adjusted using the resuspension buffer. 600 Resuspended to 0.3-0.4.

[0128] Table 5 Resuspension Formulation

[0129] S3. Mixing and Injection of Bacterial Solution: Mix the target gene bacterial solution and P19 bacterial solution (OD value 0.6-0.8) thoroughly at a volume ratio of 1:2, and incubate the prepared bacterial solution in the dark for 2 hours with aluminum foil; use a syringe with the needle removed to draw up the mixed bacterial solution and slowly inject it into the back of the leaf.

[0130] S4. Cultivation and Observation: Mark the injected leaves, cultivate in the dark for 12 hours, then cultivate in the light for 2 days, observe with a confocal microscope, and record the results.

[0131] Confocal micrographs show (e.g.) Figure 8 As shown in the figure, GATL4-eGFP appears as a punctate fluorescent signal in the cytoplasm, possibly in the Golgi apparatus. To further confirm this result, GATL4-eGFP was co-localized with the marker protein SYP61-RFP expressed in the Golgi apparatus. It was found that the green fluorescent signal of AtGATL4 overlapped with the red fluorescent signal of SYP61, proving that AtGATL4 is localized in the Golgi apparatus.

[0132] Example 6 Detection of the regulatory effect of AtGALT4 on the distribution of pectin methyl esterification in pollen tubes.

[0133] Immunohistochemical staining was performed on pollen tubes of WT, atgatl4-1, and pGATL4::GATL4 / gatl4 after 4 hours of growth using monoclonal antibodies JIM5 and JIM7, respectively.

[0134] S1. Incubate the pollen on pollen germination medium for 4 hours until the pollen tubes grow out.

[0135] S2. Use a pipette to draw the fixative (as shown in Table 6) into the pollen germination medium, ensuring that the pollen tubes are completely immersed in the fixative, and fix at room temperature for 90 min.

[0136] Table 6. Preparation system of 50 mM PIPES Buffer (pH=6.8) stationary phase

[0137] S3. Use a pipette to aspirate the fixative from the edge of the culture medium, add washing solution (as shown in Table 7) and rinse 3 times, 5 minutes each time.

[0138] Table 7. Preparation system of 50 mM PIPES Buffer (pH=6.8) cleaning solution

[0139] S4. After aspirating the washing solution, add PBS and wash 3 times, 5 minutes each time.

[0140] S5. Add JIM5 and JIM7 antibodies (volume ratio 1:5 with PBS) separately and incubate overnight at 4°C.

[0141] S6. After aspirating the antibody, wash with PBS three times, 5 minutes each time.

[0142] S7. After aspirating the washing solution, add the secondary antibody (rat volume ratio 1:100 in PBS) and incubate at 30°C for 3 hours.

[0143] Wash three times with S8 and PBS, 5 minutes each time. Add anti-fluorescence quenching agent and take pictures for observation.

[0144] The results showed that: 1) JIM7 immunofluorescence results (high methyl esterification HG): In the pollen tubes of WT, high methyl esterification pectin was specifically enriched in the growth region at the tip of the pollen tube, showing a bright ring-shaped fluorescence signal in the posterior region of the tip, which is a typical feature of normal polar growth of pollen tubes; while in the pollen tubes of the glt4-1 mutant, no obvious JIM7 labeling signal was detected, and high methyl esterification pectin almost completely disappeared; in the pollen tubes of the pGATL4::GATL4 / gatl4 complementary plants, the ring-shaped fluorescence signal of high methyl esterification pectin at the tip was completely restored, with no significant difference from WT (e.g., Figure 9 (As shown in A).

[0145] 2) JIM5 immunofluorescence results (low-methylated HG): In the pollen tubes of WT plants, no obvious JIM5 signal was detected, and the content of low-methylated pectin was extremely low; while in the pollen tubes of the glt4-1 mutant, a large amount of strong JIM5 fluorescence signal was detected, and low-methylated pectin accumulated abnormally throughout the pollen tube; in the pollen tubes of pGATL4::GATL4 / gatl4 complementary plants, only a weak JIM5 fluorescence signal was detected, recovering to WT levels (e.g., Figure 9 (As shown in B).

[0146] The above results confirm that AtGALT4 maintains the pectin methyl esterification gradient at the pollen tube tip by regulating the spatiotemporal distribution of highly methylated and low methylated pectin in the pollen tube, thereby regulating the polar elongation of the pollen tube. The loss of AtGALT4 function directly disrupts the normal distribution pattern of pectin methyl esterification in the pollen tube, resulting in inhibited polar growth of the pollen tube, slowed pollen germination rate, and decreased pollen tube elongation ability.

[0147] The Arabidopsis GALT4 gene disclosed in this invention can serve as a molecular target for regulating pollen tube growth performance in cruciferous crops. By upregulating or downregulating GALT4 gene expression through genetic engineering, pollen germination rate and pollen tube elongation can be directionally regulated, providing new technological means for crop hybridization and fertility regulation. Furthermore, the GALT4 gene and its encoded protein can be used to screen compounds that regulate pollen tube growth, leading to the development of novel plant growth regulators.

[0148] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. The application of Arabidopsis GALT4 in regulating pollen development, characterized in that, The CDS sequence of the Arabidopsis GALT4 gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The regulation of plant pollen development includes one or more of the following: regulation of pollen viability, pollen cell nucleus development, pollen morphogenesis, pollen germination, and pollen tube polar elongation.

3. The application according to claim 1, characterized in that, The Arabidopsis GALT4 gene maintains polar elongation of the pollen tube by regulating the distribution of methylated pectin in the pollen tube.

4. The application according to claim 3, characterized in that, The methylated pectin includes highly methylated homogalacturonic acid and low-methylated homogalacturonic acid.

5. The application of the Arabidopsis GALT4 gene in plant fertility regulation, characterized in that, The CDS sequence of the Arabidopsis GALT4 gene is shown in SEQ ID NO.

1. By knocking out or silencing the homologous GALT4 gene in plants, the plants exhibit phenotypes such as reduced pollen viability, abnormal pollen cell nucleus development, pollen morphology deformity, slowed pollen tube germination rate, and inhibited elongation.

6. The application according to claim 5, characterized in that, The plant in question is a member of the Brassicaceae family.

7. The application according to claim 6, characterized in that, The cruciferous plants include one or more of rapeseed, Chinese cabbage, and kale.

8. A method for regulating pollen germination and pollen tube polarity elongation in plants, characterized in that, Knock out or silence the GALT4 gene in the target plant that is homologous to the sequence shown in SEQ ID NO.1, downregulate the function of the GALT4 gene in the target plant, and obtain plants with slowed pollen germination rate and inhibited pollen tube polar elongation. Alternatively, the Arabidopsis GALT4 gene shown in SEQ ID NO.1 can be introduced into the target plant to upregulate the function of the GALT4 gene in the target plant, thereby obtaining plants with increased pollen germination rate and enhanced pollen tube polarity elongation.

Images