Recombinant escherichia coli based on cyanamide-induced flagellum assembly gene as well as construction method and application of recombinant escherichia coli

Abstract

The invention relates to the field of biotechnology engineering, in particular to recombinant escherichia coli based on cyanamide-induced flagellum assembly genes as well as a construction method and application of the recombinant escherichia coli. The recombinant escherichia coli based on the cyanamide-induced flagellum assembly gene is constructed by overexpressing the flagellum assembly gene driven by a cyanamide-induced promoter into escherichia coli 045. The recombinant Escherichia coli can strengthen the formation of a biological membrane, and the formation of the biological membrane is strengthened by adding cyanamide to precisely regulate and control the expression of a flagellum assembly gene in the process of preparing L-valine through fermentation. When the recombinant escherichia coli is used for preparing the L-valine through fermentation, the yield of the L-valine is increased, the fermentation efficiency is improved, and the fermentation period is shortened. The method has the advantages that the method is simple and convenient to operate, the cell can be recycled in the immobilized fermentation of the L-valine, the cost is saved, the continuity of the whole fermentation is enhanced, and a cell immobilization strategy based on a biological membrane is provided for the engineering application of an L-valine production system.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology engineering, in particular to a recombinant Escherichia coli based on monomethylamine-induced flagellum assembly gene and a construction method and application thereof. BACKGROUND

[0002] L-valine is one of the most important amino acids in the human body, and its demand is increasing sharply due to its wide application in food, chemical and pharmaceutical industries. At present, microbial fermentation has been widely used in industry to produce L-valine with Escherichia coli as the best candidate strain. However, in the actual fermentation process, problems such as strain activity decline and unstable yield often occur.

[0003] Biofilm refers to an organized and complex microbial community attached to the surface of a living or non-living object and wrapped by extracellular polymers secreted by itself. There is evidence that flagellum regulatory genes can affect flagellum stability and thus affect the motility of bacterial cells. The rotational movement of flagella enables the bacterial cells to move, promotes their initial adhesion to the surface of the carrier, and thus promotes the formation of a three-dimensional structure of the biofilm.

[0004] In the prior art, immobilized cell technology, as an extension of immobilized enzyme technology, is often applied in fermentation production. The core principle of this technology is to restrict active cells in a specific space area through physical embedding, chemical bonding or mechanical entrapment. This technology is widely used in microbial fermentation and wastewater treatment of heavy metal wastewater and high-ammonia-nitrogen wastewater.

[0005] Based on this, the present application is based on the problems of strain activity decline and unstable yield in the actual fermentation process of Escherichia coli, in order to use genetic engineering methods to strengthen the ability of Escherichia coli to form biofilm based on the cell immobilization strategy of biofilm, so as to strengthen the production of L-valine. SUMMARY

[0006] The technical problem to be solved by the present application is to provide a recombinant Escherichia coli based on monomethylamine-induced flagellum assembly gene to overcome the shortcomings of the prior art.

[0007] The present application also solves the technical problem of providing a preparation method of the recombinant Escherichia coli.

[0008] The present application finally solves the technical problem of providing the application of the recombinant Escherichia coli in the fermentation preparation of L-valine.

[0009] To solve the above technical problems, the technical scheme adopted by the present application is as follows:

[0010] In a first aspect, the present application discloses a recombinant Escherichia coli based on monomethylamine-induced flagellum assembly gene, which is constructed by overexpressing flagellum assembly genes based on Escherichia coli 045 as a chassis strain.

[0011] The flagellar assembly gene is expressed by a cyanamide-induced promoter.

[0012] The Escherichia coli O45 was purchased from Nanjing High-tech University Biotechnology Research Institute Co., Ltd.

[0013] The flagella assembly genes include any one or a combination of flgM, flgN, fliA, flgL, and flgK.

[0014] Furthermore, the nucleotides of the flagella assembly genes flgM, flgN, fliA, flgL, and flgK are as shown in SEQ ID NO. 1 to 5, respectively.

[0015] Preferably, the flagella assembly gene is fliA.

[0016] The cyanamide-induced promoter is either DDI2 or DDI3.

[0017] Furthermore, the nucleotides of the cyanamide-induced promoters DDI2 and DDI3 are as shown in SEQ ID NO. 7-8.

[0018] Preferably, the cyanamide-inducible promoter is DDI3.

[0019] Secondly, the present invention discloses a method for constructing the recombinant Escherichia coli, the steps of which are as follows: the recombinant fragment obtained by overlapping the cyanamide-induced promoter and the flagellar assembly gene is cloned in one step with the linearized vector pRSFDuet, and after transformation and verification, the correct recombinant plasmid is extracted; then the recombinant plasmid is transformed into Escherichia coli O45 competent cells, and after verification, the recombinant Escherichia coli is obtained.

[0020] The linearized vector pRSFDuet was obtained by double digestion of the pRSFDuet plasmid with Nco I and BamHI.

[0021] Thirdly, this invention discloses the application of the recombinant Escherichia coli in the fermentation preparation of L-valine.

[0022] The fermentation medium consists of: 10 g / L glucose, 3 g / L yeast extract, 1.25 g / L phosphate, 1.125 g / L potassium chloride, 4.2 mg / L manganese sulfate monohydrate, 0.41 g / L magnesium sulfate heptahydrate, 19 mg / L ferrous sulfate heptahydrate, 0.02 mg / L biotin, 2 mg / L vitamin B1, and 0.01 g / L nicotinamide.

[0023] The fermentation is either single-batch free fermentation of recombinant Escherichia coli or continuous fermentation of immobilized recombinant Escherichia coli.

[0024] Specifically, the initial culture conditions for the single-batch free fermentation of the recombinant Escherichia coli were: T = 37°C, and aeration rate of 1.3 m³ / s. 3 The stirring speed was 600 rpm, the tank pressure was 0.05 MPa, and 10–30 mM cyanamide was added. The pH was maintained at approximately 7 throughout the process by adding ammonia. Samples were taken every two hours to measure sugar and OD. 600 When the sugar concentration in the fermentation broth reaches approximately 1 g / L, sugar replenishment begins. A 600 g / L sugar solution is added continuously to maintain the sugar concentration in the fermentation broth at approximately 1–2 g / L. Wait for the OD (Organization Rate) to develop. 600 When the temperature is between 40 and 50°C, switch to catalytic fermentation. After switching to catalytic fermentation, reduce ventilation and speed by half, and ensure dissolved oxygen is not lower than 25%. The total fermentation time should generally not exceed 50 hours. Fermentation should be stopped when crystallization occurs (product concentration 80-90 g / L).

[0025] Specifically, the initial culture conditions for the immobilized continuous fermentation of the recombinant Escherichia coli are: aeration 1.3m 3 The stirring speed was 600 rpm, the tank pressure was maintained at 0.05 MPa, and 10-30 mM cyanamide was added. The fed-batch sugar process was consistent with free fermentation, and the mixture was incubated at 37°C. Samples were taken every two hours to measure sugar content and OD. 600 When OD 600 When the concentration reaches approximately 40%, catalytic conversion can be initiated. After conversion, ventilation and fermentation speed should be halved. After conversion, acid concentration should be measured every two hours. When the acid concentration reaches approximately 70 g / L, the feed rate of 500 g / L sugar solution should be changed to 150 g / L sugar solution, maintaining the acid concentration at approximately 75 g / L. Throughout the process, ammonia should be added to maintain the pH at 7, and the base sugar concentration of the fermentation broth should be kept as low as possible at 0.5-1 g / L. After the first batch of fermentation is completed, the waste culture medium in the fermenter should be drained without opening the fermenter. The carrier should be retained, and new fermentation culture medium should be sterilized, cooled, and pumped into the tank. Care should be taken during operation to avoid contamination. The final volume of newly added fermentation culture medium should be half the volume of the fermenter. Then, the next batch of L-valine fermentation production can be started, thus initiating continuous fermentation. A total of 3-6 batches will be fermented.

[0026] Furthermore, the immobilized fermentation carrier is cotton fiber.

[0027] In the fermentation process, 10-30 mM cyanamide is added during the initial stage of fermentation.

[0028] Preferably, the concentration of the monocyanamide added is 10 mM.

[0029] Beneficial effects:

[0030] This invention, based on a biofilm enhancement strategy, constructs a recombinant *E. coli* strain based on a cyanamide-induced flagellar assembly gene by overexpressing a flagellar assembly gene driven by a cyanamide-induced promoter into *E. coli* O45 and optimizing the promoter and flagellar assembly gene. This recombinant *E. coli* strain enhances biofilm formation. During the fermentation of L-valine, by further adding a cyanamide inducer and optimizing the amount added, the expression of the flagellar assembly gene is precisely regulated by cyanamide, effectively enhancing biofilm formation. This results in increased L-valine yield, improved fermentation efficiency, and a shorter fermentation cycle in both subsequent free fermentation and immobilized fermentation. Immobilized fermentation further enables cell recycling, saving costs. By reducing the non-productive growth period, operational efficiency is improved, and the overall continuity of fermentation is enhanced. This provides a biofilm-based cell immobilization strategy for the engineering application of L-valine production systems. Attached Figure Description

[0031] The present invention will be further described in detail below with reference to the accompanying drawings, and the advantages of the present invention in the above and / or other aspects will become clearer.

[0032] Figure 1 Electrophoresis results of amplification of bacterial flagella assembly-related genes (flgM, fliA, flgN, flgK, flgL) and electrophoresis results of plasmid ptrc99a.

[0033] Figure 2 This is a schematic diagram of the recombinant plasmid ptrc99a-fliA.

[0034] Figure 3 PCR validation of recombinant strains overexpressing flgM, flgN, fliA, flgL, and flgK genes.

[0035] Figure 4 Crystal violet staining of biofilms - comparison of crystal violet staining between the original bacteria and the overexpressing recombinant strain.

[0036] Figure 5 The results are Swimming-single cell motility assays for recombinant strains WT, +flgM, +fliA, +flgN, +flgK, and +flgL.

[0037] Figure 6 The results of swarming-based population movement assays for recombinant strains WT, +flgM, +fliA, +flgN, +flgK, and +flgL are presented.

[0038] Figure 7 The effect of different concentrations of cyanamide on the growth of Escherichia coli O45.

[0039] Figure 8 This is a schematic diagram of the constructed recombinant plasmids ptrc+eGFP, +DDI2+eGFP, and +DDI3+eGFP.

[0040] Figure 9 Recombinant strain P trc -eGFP, P DDI2 -eGFP, P DDI3 The relative fluorescence intensity of the promoter expression effect in -eGFP.

[0041] Figure 10 The diagram shows the constructed recombinant plasmids ptrc+fliA, +DDI2+fliA, and +DDI3+fliA.

[0042] Figure 11 To validate the overexpressed gene using qRT-PCR.

[0043] Figure 12 For the original strain 045 (WT) and P trc -fliA、P DDI3 Re-verification of biological crystal violet staining with -fliA.

[0044] Figure 13 Images obtained using laser confocal microscopy for DAPI staining.

[0045] Figure 14 These are the results of single-batch free fermentation of different strains. Blue represents the growth stage; red represents the production stage.

[0046] Figure 15 The results of immobilized fermentation of different strains. Detailed Implementation

[0047] The present invention will be further described in detail below with reference to specific embodiments, and the advantages of the present invention in the above and / or other aspects will become clearer.

[0048] Unless otherwise specified, the experimental methods described in the following examples are conventional methods; unless otherwise specified, the reagents and materials are commercially available.

[0049] In the following examples, the Escherichia coli 045 is an engineered strain that produces L-valine, purchased from Nanjing High-Tech University Biotechnology Research Institute Co., Ltd.

[0050] In the following embodiments, the biomass of the *E. coli* was measured by absorbance (OD) at 600 nm using a UV spectrophotometer. 600The concentrations of glucose and valine were determined using the 3,5-dinitrosalicylic acid method. L-valine was detected using the ninhydrin method, while L-valine was detected by high-performance liquid chromatography (HPLC) with an acetonitrile / water mixture (50:50, v / v) and 50 mM sodium acetate as the mobile phase at a flow rate of 0.6 mL / min, and quantified using UV detection at 360 nm. Organic acids were detected by HPLC using 0.5 mM sulfuric acid solution as the mobile phase at a flow rate of 0.6 mL / min.

[0051] This patent was approved by the Jiangsu Provincial Postgraduate Practice and Innovation Program in 2025, with project number SJCX25_0583.

[0052] Example 1: Molecular modification of recombinant strains

[0053] I. Amplification of the target gene

[0054] The genome of *E. coli* 045 was extracted according to the operating instructions of the bacterial genomic DNA extraction kit (Takara, catalog number 9763). Using the *E. coli* 045 genome as a template, PCR amplification was performed on bacterial flagella assembly-related genes (flgM, flgN, fliA, flgL, flgK). Amplification primers for the corresponding genes were designed using the primer design software snapgene, as shown in Table 1. These primers contained NcoI and HindIII restriction enzyme sites for subsequent ligation with plasmid ptrc99a. The nucleotide sequences of the bacterial flagella assembly-related genes flgM, flgN, fliA, flgL, and flgK are shown in SEQ ID NO. 1–5.

[0055] The PCR amplification used a 25 μL reaction system, with 1.5 μL of primers, 1.0 μL of template (genomic DNA), 1.0 μL of KOD enzyme, 10 μL of dNTPs (150 mM), and 10 μL of sterile water, each contained in a 25 μL tube. The PCR amplification conditions were as follows: denaturation at 98 °C for 2 min; annealing at 60 °C for 30 s; extension at 68 °C for 1 min / 1 kb (35 cycles in total); and complete extension at 68 °C for 10 min.

[0056] The target gene fragment obtained after PCR amplification was purified by gel extraction according to the instructions of the gel extraction kit (Takara, catalog number 9762).

[0057] Figure 1 The image shows the electrophoresis results of the amplification of bacterial flagella assembly-related genes (flgM, flgN, fliA, flgL, flgK). It can be seen that the migration position of the target band in the electrophoresis pattern is consistent with the expected molecular weight.

[0058] Table 1. Experimental primer sequences used for amplification

[0059] Primer name Primer sequence flgM-F TTTCACACAGGAAACAGACCATGGATGAGTATTGATCGCACTTC flgM-R CGCCAAAACAGCCAAGCTTTCAGTTACTCTGCAAGTCTT flgN-F TTTCACACAGGAAACAGACCATGGATGACACGTCTTGCAGAGAT flgN-R CGCCAAAACAGCCAAGCTTTCAGATCGAAATCTTTTTAC fliA-F AATTTCACACAGGAAACAGACCATGGGTGAATTCACTCTATACCGC fliA-R CGCCAAAACAGCCAAGCTTTTATAACTTACCCAGTTTAG flgL-F TTTCACACAGGAAACAGACCATGGATGCGTTTCAGTACACAGAT flgL-R CGCCAAAACAGCCAAGCTTTTATTTGCTGAGCTGGAAGA flgK-F TTTCACACAGGAAACAGACCATGGATGTCCAGCTTGATTAATAA flgK-R CGCCAAAACAGCCAAGCTTTTAGCGAATGTTAATCAGCG

[0060] II. Construction of Recombinant Plasmids

[0061] 1. Extract the ptrc99a plasmid

[0062] E. coli T1 glycerol bacilli (containing plasmid ptrc99a) were inoculated into LB liquid (ampicillin concentration: 100 mg / mL) and cultured at 37°C for 12 hours. The culture was collected in a 1.5 mL centrifuge tube, centrifuged at 10,000 rpm for 2 min, and the supernatant was discarded. The ptrc99a plasmid was extracted using the AxyPrep plasmid extraction kit from Corning Life Sciences, Inc.

[0063] 2. Carrier linearization

[0064] To ligate the target gene into plasmid ptrc99a, the vector needs to be digested with enzymes. The ptrc99a plasmid was double-digested using an NcoI / HindIII dual restriction endonuclease system. The double digestion reaction mixture was 20 μL: 2 μL 0.1% BSA, 2 μL 1*M QuickCut buffer, 0.5 μL each of NcoI and HindIII enzymes, 10 μL ptrc99a plasmid, and 5 μL sterile water. The digestion reaction was carried out at 37℃ for 2 h. After digestion, the plasmid was recovered by gel electrophoresis for subsequent experiments. The results of plasmid ptrc99a extraction and digestion, verified by electrophoresis, are shown below. Figure 1 As shown, the strip size is correct.

[0065] 3. Constructing recombinant plasmids

[0066] Each target gene fragment was then coupled with the purified linearized vector ptrc99a according to Vazyme's instructions. The ligation reaction was performed according to the instructions of the one-step cloning kit. The reaction was stopped immediately by incubating the mixture in a 37°C water bath for 30 minutes, followed by an ice bath for 5 minutes. The one-step cloning reaction mixture consisted of 20 μL: 9 μL ddH₂O, 4 μL 5×CE II Buffer, 4 μL of double-digested ptrc99a plasmid (25 ng / μL), and 1 μL of purified gene fragment (100 ng / μL). II2μL.

[0067] Thaw E. coli T1 competent cells on ice until liquid. Add competent cells and plasmids at a ratio of 10:1 to a pre-chilled centrifuge tube. Incubate on ice for 30 min, then heat shock in a 42°C water bath for 90 seconds. Cool in an ice box for 3 min, add 1 mL of LB medium, and incubate on a shaker at 37°C and 200 rpm for 1 hour. Centrifuge to remove most of the supernatant, resuspend the bacterial culture, and plate it onto LB agar plates containing 100 μg / mL ampicillin-resistant medium. Pick a single spot on the plate and inoculate it into 100 mg / mL ampicillin LB liquid medium. Incubate overnight at 37°C.

[0068] The recombinant plasmids ptrc99a-flgM, ptrc99a-flgN, ptrc99a-fliA, ptrc99a-flgL, and ptrc99a-flgK were extracted and sequenced for verification using universal sequencing primers (check-F: GCACTCCCGTTCTGGATAATGTTTTTT; check-R: CGTGTTTGATTTATCTGTATCAGGCTG). Figure 2 A schematic diagram of the constructed recombinant plasmid ptrc99a-fliA is shown.

[0069] 4. Construct recombinant bacterial strains overexpressing genes related to bacterial flagella assembly.

[0070] After successful sequencing verification of the recombinant plasmid, the recombinant plasmid was transformed into E. coli O45 competent cells via heat shock. Single colonies were picked, and the relevant recombinant plasmid was extracted for gel electrophoresis verification and sequencing for further comparison and confirmation. Primers were used as shown in the table above. Finally, recombinant strains +flgM, +flgN, +fliA, +flgL, and +flgK were constructed. Figure 3 The electrophoresis results of the extracted recombinant plasmids ptrc99a-flgM, ptrc99a-flgN, ptrc99a-fliA, ptrc99a-flgL, and ptrc99a-flgK are shown, indicating that the recombinant plasmids have been successfully introduced into the original E. coli 045, and the overexpression of the recombinant strains +flgM, +flgN, +fliA, +flgL, and +flgK has been successfully constructed.

[0071] Example 2: Biomembrane Characterization Experiment

[0072] I. Crystal violet staining of biological membranes (CV)

[0073] Crystal violet staining experiments were performed using 96-well clear plates. Specifically, a static culture mode was adopted: original *E. coli* 045 (WT) and 5 recombinant strains (+flgM, +fliA, +flgN, +flgK, +flgL) were selected, pre-cultured at 37℃ and 220 rpm, and then the bacterial concentration was adjusted to OD using sterile PBS buffer.600 ≈1 was used as the inoculum. A 1% v / v inoculum system (180 μL LB + 20 μL bacterial suspension) was constructed in 96-well clear plates, with 4–8 biological replicates per group, and incubated statically at 37°C for 36 h. The biofilm treatment process included: 1. Removal of planktonic cells (PBS washing); 2. Fixation and staining (200 μL crystal violet, 15 min in the dark); 3. Decolorization and quantification (33% acetic acid desorption, OD measured after shaking for 30 min). 570 (Value). This method enables quantitative comparison of the film-forming ability of different bacterial strains through spectral detection.

[0074] The formula for 500mL crystal violet is as follows: (1) Prepare solution A: weigh 0.5g of crystal violet, add 100mL of ethanol, and mix thoroughly; (2) Prepare solution B: weigh 4g of ammonium oxalate, add 400mL of pure water, and mix thoroughly; (3) Mix solution A and solution B, place filter paper in a funnel, let stand and filter to obtain crystal violet.

[0075] The results are as follows Figure 4 As shown, the amount of biofilm formed by the recombinant strain +fliA was significantly increased by 41% compared with the original strain 045, followed by the recombinant strains +flgK and +flgL.

[0076] II. Motion Characterization Experiment

[0077] The recombinant strains obtained by modifying flagella-related genes were subjected to swimming and swarming experiments to observe whether the gene modification would affect the motility of Escherichia coli.

[0078] Six bacterial strains (WT, +flgM, +fliA, +flgN, +flgK, +flgL) were cultured overnight in liquid LB. Overexpressing strains required the addition of the corresponding antibiotic-Amp. The bacterial culture was diluted to OD using fresh LB. 600 Set to 1 for later use.

[0079] 1. Swarming - Group movement

[0080] Formula (100mL): 1g peptone, 0.5g yeast powder, 1g NaCl, 0.3g glucose, 0.3g agar. Prepare fresh before use and pour into plates.

[0081] Experimental procedure: Use a pipette to drop 1.2 μL of bacterial suspension onto the surface of the plate to form a dot, and incubate at 25°C for 16 h (do not invert).

[0082] 2. Swimming - Motility of individual bacterial cells

[0083] Formula (100mL): 1g peptone, 0.7g NaCl, 0.5g agar, prepare fresh before use, pour into plates;

[0084] Experimental procedure: Dip the inoculation needle into the bacterial solution and insert it into the center of the plate. Incubate at 25°C for 40 hours (do not invert).

[0085] Table 2 Results of swarming experiment

[0086] Strain WT +fliA +flgM +flgN +flgK +flgL Diameter / mm 17.8 26.2 27.5 17.1 26.5 21.9

[0087] The results are as follows: Figure 5 , Figure 6 As shown in Table 2, compared with WT, overexpression of the gene fliA had the greatest positive impact on the motility of the original strain 045 cell population. In the swimming experiment, the surface of the cells formed by the original strain was relatively uniform, while the diameter of the cells formed by +fliA was significantly larger and the texture more complex, with obvious growth traces visible to the naked eye. This was followed by +flgK and +flgL. Comparing the swarming experiment results, it was observed that the cells formed by WT had an inward protrusion in the center and were thinner around the edges, while the diameter of the chemotactic loop in +fliA, +flgM, and +flgK was significantly larger and the central protrusion structure disappeared, indicating enhanced cooperative migration among the populations.

[0088] The above swimming and swarming experiments demonstrate that modifications to genes fliA (regulator of flagellated operons), flgM (anti-sigma28 (FliA) factor, regulator of FlhD), flgK (motor-active protein), and flgL (unspinning protein) can affect the motility of E. coli, which may in turn affect the colony's ability to cluster and promote the initial colonization of biofilms.

[0089] Example 3: Construction of a Highly Efficient Film-Forming Escherichia coli Strains

[0090] I. Determination of the growth curve of the original strain 045

[0091] To ensure the smooth progress of subsequent experiments, a cyanamide tolerance test was first conducted on *E. coli* O45 (WT). Specifically, the original strain O45 was inoculated into 5 mL of LB liquid containing different concentrations of cyanamide and cultured overnight. The OD values ​​of the bacterial cultures obtained after overnight culture were then measured. 600 Dilute to 1 and inoculate into 100 mL LB agar at a 1% v / v inoculum. Incubate under the following conditions: 37°C, 200 rpm, 12 h. OD values ​​of different bacterial suspensions are measured every 2 h. 600 And record the data and draw charts.

[0092] The results are as follows Figure 7As shown, the growth curves of WT strains were not significantly affected by the addition of 10mM, 20mM, and 30mM cyanamide. However, the results indicate that higher concentrations of cyanamide (>30mM) have a significant negative impact on the OD value and growth rate of the strain. Therefore, considering all factors, subsequent experiments were conducted at concentrations of 10mM, 20mM, and 30mM to screen for the optimal addition amount of cyanamide.

[0093] II. Construction of Highly Efficient Film-Forming Escherichia coli Strains

[0094] 1. Preliminary screening of cyanamide dosage and inducible promoters

[0095] To verify whether the cyanamide-induced promoters DDI2 and DDI3 could be applied to *E. coli* O45-related strains, green fluorescent protein (eGFP) was used to characterize the intensity of the product expression module promoters, specifically the intensity of DDI2 and DDI3, to assess promoter expression efficacy. The intensity of the green fluorescence value is directly linked to the strength of different promoter expression effects; a higher fluorescence value indicates stronger promoter expression. Therefore, to screen for more suitable promoters and cyanamide addition amounts, three recombinant strains P with different promoter and fluorescent protein combinations were constructed. trc -eGFP, P DDI2 -eGFP, P DDI3 -eGFP, Figure 8 The diagram shows the recombinant plasmids ptrc+eGFP, +DDI2+eGFP, and +DDI3+eGFP corresponding to the recombinant strains.

[0096] Specifically, recombinant strain P trc -eGFP, P DDI2 -eGFP, P DDI3 The construction process of -eGFP is as follows:

[0097] The pRSFDuet plasmid was double-digested with Nco I and BamHI, and the linearized vector pRSFDuet was recovered by gel extraction.

[0098] Using plasmid ptrc99a as a template, PCR amplification was performed using primers TrcE-F / R to obtain the trc promoter. Using yeast genomic DNA as a template, PCR amplification was performed using primers DDI2-EGFP-F / R and DDI3-EGFP-F / R to obtain the DDI2 and DDI3 promoters, respectively. Using a plasmid containing eGFP as a template, PCR amplification was performed using primers EGFP-DDI2-F / R and EGFP-DDI3-F / R to obtain the eGFP gene fragment linked to the DDI2 and DDI3 promoters.

[0099] The recombinant fragments obtained by overlapping each promoter with the eGFP gene fragment were then combined with the purified linearized vector pRSFDuet according to Vazyme's instructions. Following the instructions of the one-step cloning kit, the cells were transformed into E. coli T1 competent cells to obtain the corresponding recombinant plasmids. The verified recombinant plasmids ptrc+eGFP, +DDI2+eGFP, and +DDI3+eGFP were then transformed into E. coli O45 competent cells to obtain the recombinant strain P. trc -eGFP, P DDI2 -eGFP, P DDI3 -eGFP. The nucleotide sequences of the promoters trc, DDI2, and DDI3 are shown in SEQ ID NO. 6 to 8, respectively, and the nucleotide sequence of the green fluorescent protein eGFP is shown in SEQ ID NO. 9.

[0100] Among them, the recombinant strain P trc -eGFP, P DDI2 -eGFP, P DDI3 The primer sequences used in the -eGFP construction process are shown in Table 3.

[0101] Table 3 Recombinant strain P trc -eGFP, P DDI2 -eGFP, P DDI3 Primer sequences used in the -eGFP construction process

[0102]

[0103]

[0104] Furthermore, regarding WT and P trc -eGFP, P DDI2 -eGFP, P DDI3 Relative fluorescence analysis was performed using -eGFP.

[0105] (1) WT, P trc -eGFP, P DDI2 -eGFP, P DDI3 These four strains -eGFP were cultured in LB broth at 25℃ / 37℃ (the recombinant strains contained Amp resistance, and P was also considered). trc The required inducer was IPTG, and the optimal induction temperature was 25℃. Since the final fermentation required a constant temperature of 37℃, the experimental conditions were set at 25℃ and 37℃, with overnight incubation at 220 rpm. Among these conditions, P... trc -eGFP culture requires IPTG induction, P DDI2 -eGFP, PDDI3 -eGFP was induced by adding different concentrations of cyanamide (10 / 20 / 30mM).

[0106] (2) Next, dilute the bacterial culture to OD using sterile PBS solution. 600 The value was set to 0.5, and the corresponding sample was obtained.

[0107] (3) Take 200 μL of sample and add it to the 96-well black plate.

[0108] (4) Read the values ​​using an ELISA reader. The specific settings are: excitation wavelength 490nm, emission wavelength 530nm, 25℃.

[0109] (5) Calculate the relative fluorescence intensity using the following formula: FP / OD=(FP-FP) bp ) / (OD-OD bp )

[0110] Correction: FP bg - Background fluorescence value of non-fluorescent expression strain WT; OD bg - The background OD value of the culture medium.

[0111] Experimental results are as follows Figure 9 As shown in the figure. Data analysis and comparison concluded that the trc promoter is highly sensitive to temperature; fermentation is unfavorable at 37℃, but proceeds well at 25℃. In contrast, the cyanamide-induced promoters DDI2 and DDI3 are unaffected by culture temperature and can be used in subsequent experiments. Furthermore, DDI3 exhibited the highest relative fluorescence intensity under 10 mM cyanamide induction, indicating that DDI3 expression was strongest at a concentration of 10 mM cyanamide. Simultaneously, this experiment not only preliminarily demonstrated that cyanamide promoters can be used to construct systems that enhance biofilm formation in *E. coli* O45, but also preliminarily screened out the optimal induction condition: 10 mM cyanamide.

[0112] 2. Highly efficient film-forming strain of Escherichia coli P trc -fliA、P DDI2 -fliA、P DDI3 -fliA construction

[0113] A highly efficient film-forming strain of *E. coli*, P, was constructed using the fliA gene, the IPTG-inducible promoter trc, or the cyanamide promoters DDI2 and DDI3. trc -fliA、P DDI2 -fliA、P DDI3 -fliA. Figure 10 The diagram shows the recombinant plasmids ptrc+fliA, +DDI2+fliA, and +DDI3+fliA corresponding to the constructed highly efficient Escherichia coli film-forming strains.

[0114] Specifically, the highly efficient film-forming strain of Escherichia coli P trc -fliA、P DDI2 -fliA、P DDI3 The -fliA build process is as follows:

[0115] The pRSFDuet plasmid was double-digested with Nco I and BamHI, and the linearized vector pRSFDuet was recovered by gel extraction.

[0116] Using plasmid ptrc99a as a template, PCR amplification was performed using primers TrcA-F / R to obtain the trc promoter. Using yeast genomic DNA as a template, PCR amplification was performed using primers DDI2-fliA-F / R and DDI3-fliA-F / R to obtain the DDI2 and DDI3 promoters, respectively. Using the genome of *E. coli* 045 as a template, PCR amplification was performed using primers fliA-DDI2-F / R and fliA-DDI3-F / R to obtain the fliA gene fragment linked to the DDI2 and DDI3 promoters.

[0117] The recombinant fragments obtained by overlapping each promoter with the fliA gene fragment were then combined with the purified linearized vector pRSFDuet according to Vazyme's instructions. Following the instructions of the one-step cloning kit, transform the cells into E. coli T1 competent cells to obtain the corresponding recombinant plasmids. Then, transform the verified recombinant plasmids ptrc+fliA, +DDI2+fliA, and +DDI3+fliA into E. coli O45 competent cells to obtain recombinant strain P. trc -fliA、P DDI2 -fliA、P DDI3 -fliA. Wherein, the recombinant strain P trc -fliA、P DDI2 -fliA、P DDI3 The primer sequences used in the -fliA construction process are shown in Table 4.

[0118] Table 4 Recombinant strain P trc -fliA、P DDI2 -fliA、P DDI3 Primer sequences used in the -fliA construction process

[0119] Primer name Primer sequence TrcA-F AATAAGGAGATATACCATGGttgacaattaatcatccggctcgtataatgtg TrcA-R tagagtgaattcacGATATCACTAAGATGGccatggtctgtttcc DDI2-fliA-F AATAAGGAGATATACCATGGttcaaaGGTTAAACTCGCTTAGACTATGTct DDI2-fliA-R tcacGATATCACTAAGATGGGATTGATTCTTTTGAAGAGGAGCAAGGCA fliA-DDI2-F CCTCTTCAAAAGAATCAATCCCATCTTAGTGATATCgtgaattcactctataccgc fliA-DDI2-R GGCGCGCCGAGCTCGAATTCGGATCCttataacttacccagtttag DDI3-fliA-F CACGGCCGCATAATCGAAATttcaaaGGTTAAACTCGCTTAGACTATGTct DDI3-fliA-R tcacGATATCACTAAGATGGGATTGATTCTTTTGAAGAGAAGCAAGGCA fliA-DDI3-F AATCCCATCTTAGTGATATCgtgaattcactctataccgctgaaggt fliA-DDI3-R GGCGCGCCGAGCTCGAATTCGGATCCttataacttacccagtttag

[0120] To further screen for a more suitable cyanamide-induced promoter and the optimal amount of inducer for the early regulation of the film-forming system, the strain P was subjected to... DDI2 -fliA、P DDI3 -fliA was used for real-time PCR experiments.

[0121] (1) Induction culture of strains: WT and 3 engineered strains (P) were selected. trc -fliA、P DDI2 -fliA、P DDI3 -fliA) was inoculated into LB broth (recombinant strain containing Amp resistance) and cultured at 25°C and 200 rpm until the mid-log phase (OD50). 600 ≈0.6). Among them: strain P trc -fliA requires the addition of 0.5mM IPTG for induction; strain P DDI2 -fliA、P DDI3 The two strains -fliA require induction with different concentrations of cyanamide (10 / 20 / 30mM) solution;

[0122] (2) RNA extraction and quality control: The extraction of suspension cells was performed according to the bacterial RNA extraction kit (catalog number RC113-C1) of Novizan (Vazyme). The integrity and purity were verified by 1% agarose gel electrophoresis (standard: clear and non-tailed double bands can be observed).

[0123] (3) cDNA Acquisition: Considering the non-degradable nature of cDNA, the RNA extracted in step (2) needs to be reverse transcribed into cDNA. The IIQ RT SuperMix for qPCR (+gDNA wiper) kit (catalog number R223-01) is used for gDNA removal and reverse transcription, and cDNA is synthesized and stored at -80℃.

[0124] (4) qPCR amplification detection: Corresponding primers were designed (Table 5) for real-time quantitative PCR, using cDNA from different strains as templates and 16S rRNA as an internal control, and PCR was performed using Novizan's reagents. qPCR Green Master Mix (product number Q141-02) enzyme was used for qPCR.

[0125] Table 5 Primers for Real-Time PCR

[0126] Gene Upstream primer (5'-3') Downstream primer (5'-3') fliA TTGACGATCTGCTACAGGCG TACGCTGCACTGCGTAAGTT 16S TCGGGAACCGTGAGACAGGTAGT CCGCTGGCAACAAAGGATAAGCTAGA

[0127] Comparison results ( Figure 11 The study found that DDI3 expression was superior to DDI2, and that the gene expression level was stable and extremely high under the condition of adding 10 mM cyanamide. Ultimately, DDI3 was initially selected as the cyanamide-inducible promoter, and 10 mM of cyanamide inducer was added.

[0128] 3. Characterization experiments for further verification

[0129] Relative fluorescence intensity analysis and quantitative real-time PCR experiments preliminarily screened out DDI3 and 10mM cyanamide as effective agents for constructing a preliminary membrane-forming regulation system. However, further characterization experiments are needed to supplement the screening and verification that cyanamide can effectively enhance cell immobilization strategies based on population effects by precisely regulating flagellar assembly gene expression in the constructed system.

[0130] (1) Crystal violet staining of biological membranes

[0131] Original strain 045 and P trc -fliA、P DDI3 The modified strain of -fliA was used in the crystal violet experiment, P trc -fliA uses IPTG as an inducer, P DDI3 -fliA was added with cyanamide at final concentrations of 10, 20, and 30 mM as an inducer, and the culture time was 36 h. The results are as follows: Figure 12 As shown.

[0132] From the perspective of film formation morphology comparison, P trc -fliA showed a more visible aggregation effect; different concentrations of cyanamide induced film formation, and it was clearly shown that the film aggregation effect was inversely proportional to the concentration of cyanamide. Finally, we screened DDI3 for constructing a system to enhance biofilm formation and determined that the amount of cyanamide inducer added for subsequent experiments was 10 mM.

[0133] (2) DAPI staining laser confocal microscopy imaging

[0134] DAPI, because it can directly cross the cell membrane and bind to DNA, can be used for staining live cells. WT and P... DDI3 -fliA was incubated statically for 24 hours and then stained with DAPI. Results are as follows: Figure 13 As shown, WT exhibits a discrete, weak fluorescence signal on the substrate surface (sparser in the blue area), indicating a low number of bacteria adhering to the cell-climbing sheet and a weak colonization ability of the WT strain. Meanwhile, in P... DDI3 The fliA results showed high-density fluorescent aggregates (dense blue areas) and a significant increase in biofilm thickness, demonstrating that overexpression of fliA significantly enhances the surface adhesion ability of microbial cells. The cells exhibited obvious aggregation and adhered extensively to the cell slide, forming a biofilm between cells.

[0135] Example 4: Single-batch free fermentation

[0136] (1) The activated original strain 045 (WT) and recombinant strain P DDI3-fliA was inoculated into seed culture medium and cultured at 37°C until the logarithmic growth phase OD. 600 =10~12.

[0137] The seed culture medium has the following formula: 30 g / L glucose, 3 g / L yeast extract, 1 g / L dipotassium hydrogen phosphate, 1 g / L potassium dihydrogen phosphate, 5 g / L ammonium sulfate, 4.2 mg / L manganese sulfate monohydrate, 0.5 g / L magnesium sulfate heptahydrate, 18 mg / L ferrous sulfate heptahydrate, 0.02 mg / L biotin, 2 mg / L vitamin B1, and 10 mg / L nicotinamide.

[0138] (2) Take 2L of the cultured seed culture and pump it into a 50L serrated reactor containing 22.5L of fermentation medium. The initial culture conditions are: T = 37℃, aeration rate of 1.3m³ / min. 3 The stirring speed was 600 rpm, the tank pressure was 0.05 MPa, and 10 mM cyanamide was added. The pH was maintained at approximately 7 throughout the process by adding ammonia. Samples were taken every two hours to measure sugar and OD. 600 When the sugar concentration in the fermentation broth reaches approximately 1 g / L, sugar replenishment begins. A 600 g / L sugar solution is added continuously to maintain the sugar concentration in the fermentation broth at approximately 1–2 g / L. Wait for the OD (Organization Rate) to develop. 600 At a temperature between 40 and 50 °C, the process is switched to catalytic fermentation. After switching to catalytic fermentation, ventilation and fermentation speed are reduced by half, and dissolved oxygen must be maintained at no less than 25%. The total fermentation time is controlled at 36 hours. The single-batch free fermentation of the above two strains is repeated three times.

[0139] The fermentation medium has the following formula: 10 g / L glucose, 3 g / L yeast extract, 1.25 g / L phosphate, 1.125 g / L potassium chloride, 4.2 mg / L manganese sulfate monohydrate, 0.41 g / L magnesium sulfate heptahydrate, 19 mg / L ferrous sulfate heptahydrate, 0.02 mg / L biotin, 2 mg / L vitamin B1, and 0.01 g / L nicotinamide.

[0140] The results are as follows Figure 14 As shown, WT and P at the fermentation endpoint DDI3 The L-valine yields of -fliA were 84.42 g / L and 87.35 g / L, respectively. At this point, the original strains WT and P... DDI3 Crystallization occurred in all strains of -fliA, so fermentation was stopped. Based on comprehensive comparison, strain P... DDI3 -fliA exhibited the best L-valine production capacity, with its production efficiency (2.56 g / L / h) and sugar-acid conversion rate (0.46 g / g) being significantly higher than WT (2.19 g / L / h, 0.42 g / g). This indicates that the expression of the membrane-forming gene fliA in the early stage can improve the efficiency of L-valine production.

[0141] In addition, strain P, which produces a high amount of biofilm.DDI3 Compared to WT, -fliA exhibits a faster initial growth rate, an earlier catalytic conversion time point, and an increased final OD value. This change is beneficial for shortening the fermentation cycle and enhancing fermentation intensity, directly reflected in the increase in sugar-acid conversion ratio and production efficiency.

[0142] Example 5: Immobilized Continuous Fermentation

[0143] The immobilized fermentation carrier was made of cotton fiber, and the fermenter used was 50L. Large pieces of carrier were sewn onto a carrier frame in a serrated pattern, and then the carrier frame was placed into the fermenter. The fermentation broth needed to completely submerge the carrier. The original strain 045 (WT) and the recombinant strain P were then added. DDI3 The seed culture of -fliA was inoculated into the fermentation medium at a rate of 10% v / v, at which point the total volume of the fermentation medium was half the volume of the fermenter, i.e., 25 L. Initial culture conditions were: aeration 1.3 m... 3 The stirring speed was 600 rpm, the tank pressure was maintained at 0.05 MPa, and 10 mM cyanamide was added. The fed-batch sugar addition process was the same as that for free fermentation, and the culture was carried out at 37°C. Samples were taken every two hours to measure sugar and OD. 600 When OD 600 When the concentration reaches approximately 40%, catalytic conversion can be initiated. After conversion, ventilation and fermentation speed should be reduced by half. After conversion, acid concentration should be measured every two hours. When the acid concentration reaches approximately 70 g / L, the feed rate of sugar solution should be changed from 600 g / L to 150 g / L, maintaining the acid concentration at approximately 75 g / L. Throughout the process, ammonia should be added to maintain the pH at 7, and the base sugar concentration of the fermentation broth should be kept as low as possible at 0.5-1 g / L. After the first batch of fermentation is completed, the waste culture medium in the fermenter should be drained without opening the fermenter. The carrier should be retained, and new fermentation culture medium should be sterilized, cooled, and pumped into the fermenter. Care should be taken during operation to avoid contamination. The final volume of newly added fermentation culture medium should be half the volume of the fermenter. Then, the next batch of L-valine fermentation production can be started, thus initiating continuous fermentation. A total of 3-6 batches will be fermented.

[0144] Analysis of the fermentation results shows that... Figure 15 As shown. Modified strain P DDI3 Compared to WT, L-valine production in the first to fourth batches of fermentation with -fliA not only increased but also accelerated at a faster rate. This phenomenon reflects a shorter overall fermentation cycle and increased fermentation intensity, consistent with the results of single-batch free fermentation. Calculations show that P... DDI3 The sugar-acid conversion ratio of -fliA was 0.51 g / g, which was better than the original strain's 0.45 g / g, and the production efficiency (1.57 g / L / h) was also significantly improved compared to the original strain's 1.18 g / L / h.

[0145] This invention provides a recombinant *E. coli* strain based on a cyanamide-induced flagellar assembly gene, its construction method, and its application. Many methods and approaches exist for implementing this technical solution; the above description is merely a preferred embodiment. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications should also be considered within the scope of protection of this invention. All components not explicitly stated in this embodiment can be implemented using existing technologies.

Claims

1. A recombinant *Escherichia coli* based on a cyanamide-induced flagella assembly gene, characterized in that, The strain was constructed by overexpressing the flagellar assembly gene using Escherichia coli O45 as the chassis strain. The flagellar assembly gene is expressed by a cyanamide-induced promoter.

2. The recombinant Escherichia coli according to claim 1, characterized in that, The flagella assembly genes include any one or a combination of flgM, flgN, fliA, flgL, and flgK.

3. The recombinant Escherichia coli according to claim 2, characterized in that, The nucleotides of the flagella assembly genes flgM, flgN, fliA, flgL, and flgK are as shown in SEQ ID NO.1 to 5, respectively.

4. The recombinant Escherichia coli according to claim 1, characterized in that, The cyanamide-induced promoter is either DDI2 or DDI3.

5. The recombinant Escherichia coli according to claim 4, characterized in that, The nucleotides of the cyanamide-induced promoters DDI2 and DDI3 are shown in SEQ ID NO.7-8, respectively.

6. The method for constructing recombinant Escherichia coli according to any one of claims 1 to 5, characterized in that, The steps are as follows: The recombinant fragment obtained by overlapping the cyanamide-induced promoter and the flagellar assembly gene is cloned in one step with the linearized vector pRSFDuet, transformed and verified, and the correct recombinant plasmid is extracted; then the recombinant plasmid is transformed into E. coli O45 competent cells, and the recombinant E. coli is obtained after verification.

7. The construction method according to claim 6, characterized in that, The linearized vector pRSFDuet was obtained by double digestion of the pRSFDuet plasmid with Nco I and BamHI.

8. The use of the recombinant Escherichia coli according to any one of claims 1 to 5 in the fermentation preparation of L-valine.

9. The application according to claim 8, characterized in that, The fermentation is either single-batch free fermentation of recombinant Escherichia coli or continuous fermentation of immobilized recombinant Escherichia coli.

10. The application according to claim 8, characterized in that, The fermentation process involves the addition of 10–30 mM cyanamide.

Images