RNA interference method for targeting FGFR4, nucleic acid and application thereof

Abstract

The present invention provides nucleic acid molecules for modulating the level or amount of mRNA of FGFR4. In particular, the present invention provides delivery of a primary microRNA to form a precursor after in vivo processing, as well as a microRNA for in vivo inhibition of expression of mRNA of FGFR4. The invention also provides a delivery system of the nucleic acid molecule, comprising a carrier, an exosome and a cell, and a pharmaceutical composition containing the same. The invention also provides the use of the nucleic acid molecule and delivery system in disease treatment and drug preparation, in particular methods and drugs for cancer.

Description

[0001] This application claims priority to Chinese Patent Application No. 202410642169.0, filed on May 22, 2024, entitled "Method for RNA Interference Targeting FGFR4, Nucleic Acid and Its Application", the entire contents of which are incorporated herein by reference. Technical Field

[0002] This invention relates to the fields of molecular biology and pharmaceuticals. Specifically, this invention relates to systems for delivering precursor miRNAs and their applications in disease treatment. Background Technology

[0003] RNA interference (RNAi) is a gene silencing phenomenon at the mRNA level triggered by double-stranded RNA, targeting specific sequences. It is widespread in animals, plants, and viruses, and mainly includes two pathways: small interfering RNA (siRNA) and microRNA (miRNA).

[0004] Endogenous miRNAs are hairpin-shaped secondary structures found in many primary RNA transcripts (pri-miRNAs). In the nucleus, the Drosha / DGCR8 complex binds to and cleaves the basal stem of the pri-miRNA to release stem-loop precursor miRNAs (pre-miRNAs). These pre-miRNAs are then exported from the nucleus, and the loop is cleaved by Dicer / TRBP to form a mature RNA double strand. The guide strand, also known as the target strand, separates from the target strand and loads onto the argonaute protein in the RNA-induced silencing complex (RISC), which then targets complementary mRNA transcripts for degradation or translational repression.

[0005] Artificial miRNA (amiRNA) technology involves replacing the mature sequence of natural miRNA with an artificially designed antisense sequence targeting other genes of interest. This achieves the effect of RNAi (RNAi) through the generation and action pathway of natural miRNA, offering advantages such as significant interference, rapid action, and low toxicity, and possessing broad application prospects. amiRNAs are typically generated intracellularly from expression vectors through transcription and processing, and their mechanism of action is the same as or similar to that of natural miRNAs. However, since the precursor processing mechanisms and action processes of miRNAs in vivo are not fully understood, further research is needed to ensure the expected normal synthesis of amiRNAs and to optimize their production levels. In addition to sequence specificity, factors affecting the silencing effect of amiRNAs include uncertainties such as the amiRNA's backbone sequence, cleavage sites, and synergistic interactions with other small molecules or proteins.

[0006] Fibroblast growth factor receptors (FGFRs) belong to the transmembrane receptor tyrosine kinase family and are high-affinity receptors for fibroblast growth factors (FGFs). The FGFR family includes four major members: FGFR1, FGFR2, FGFR3, and FGFR4. Aberrant activation of the FGF / FGFR signaling pathway has been identified as a carcinogenic factor in the cancer cascade. Dysregulation of FGFRs leads to cytotoxicity to targeted drugs, metastatic progression, and poor prognosis. Therefore, the FGFR signaling pathway is a promising therapeutic target for cancers including hepatocellular carcinoma (HCC), breast cancer, lung cancer, and rhabdomyosarcoma.

[0007] Currently, most studies focus on FGFR1 / 2 / 3; however, mounting evidence suggests that FGFR4 plays a crucial and unique role in the development of various tumors and the treatment of antitumor resistance. Abnormalities in the FGF19-FGFR4 signaling pathway have been confirmed as a carcinogenic factor in liver cancer. Several selective FGFR4 inhibitors have entered clinical trials, making FGFR4 a promising target for treating liver cancer caused by FGF19-FGFR4 signaling abnormalities.

[0008] Because the amino acid sequence of FGFR4 differs significantly from that of FGFR1 / 2 / 3, early FGFR inhibitors showed poor efficacy against FGFR4. Most small-molecule inhibitors targeting the FGFR4 kinase domain exhibit poor selectivity and off-target effects. Similarly, monoclonal antibodies targeting the FGFR4 extracellular domain and its ligands also suffer from adverse reactions such as hepatotoxicity. Based on the number of drugs currently in clinical trials and their therapeutic efficacy, kinase inhibitors remain the mainstream approach for treating these types of tumors. However, the off-target effects significantly limit their clinical application.

[0009] Various delivery systems have been employed in the art to safely and accurately deliver artificial miRNAs or siRNAs to target tissues in the form of pri-miRNAs or pre-miRNAs. However, there is still a need in the art for improved methods and approaches to deliver artificial miRNAs with higher efficiency and fewer off-target effects. Summary of the Invention

[0010] This invention provides nucleic acid molecules and methods for regulating the level or amount of FGFR4 mRNA. Specifically, this invention provides nucleic acid molecules for delivering primary microRNAs (pri-miRNAs or pri-miRs) to form precursors and microRNAs (miRNAs or miRs) after in vivo processing.

[0011] Specifically, the present invention provides an isolated nucleic acid comprising a nucleic acid sequence encoding RNA that inhibits the expression of the FGFR4 gene, wherein the nucleic acid sequence contains a miRNA sequence that inhibits the FGFR4 gene.

[0012] In one aspect, the nucleic acids provided by the present invention are used to deliver primary microRNAs or precursor microRNAs into the body, which are processed intracellularly to produce highly specific artificial microRNAs or siRNAs that reduce FGFR4 expression.

[0013] The term "microRNA (or miRNA or miR)" as used herein refers to a non-coding RNA of 19-25 nucleotides in length that binds to the 3′UTR of a nucleic acid molecule and downregulates gene expression (by reducing the stability of the nucleic acid molecule or by inhibiting translation). The regulatory polynucleotides of this invention may comprise one or more microRNA sequences, microRNA seeds, or artificial microRNAs, for example, sequences that function as microRNAs.

[0014] The term "pre-miRNA" in this article refers to precursor microRNAs. Pre-miRNAs are approximately 70 base pairs long and are generated in the cell nucleus after being cleaved by Drosha. Pre-miRNAs are exported into the cytoplasm via export protein 5, where they are processed by the nuclease Dicer to form mature miRNAs.

[0015] The term "siRNA" in this article refers to small interfering RNA, sometimes also called short interfering RNA or silent RNA. It is a type of double-stranded RNA, typically 17-24 base pairs in length. It interferes with the expression of specific genes by degrading mRNA with a nucleotide sequence complementary to the antisense strand (also known as the guide strand) of the siRNA, thereby preventing translation.

[0016] The polynucleotide provided by this invention can efficiently deliver exogenous nucleotide sequences to exosomes, and after the exosomes reach the target cells, they can specifically inhibit the target genes in the target cells, and can minimize off-target side effects.

[0017] In one aspect of the invention, an isolated nucleic acid is provided, comprising a nucleic acid sequence encoding a pri-miRNA that represses FGFR4 gene expression. The pri-miRNA comprises a miRNA sequence that represses the FGFR4 gene, and one or more of a compensating sequence comprising a flanking structure sequence, a stem-loop structure, and the RNA sequence. In one embodiment of the invention, the nucleic acid sequence of the pri-miRNA in the nucleic acid comprises, from 5' to 3', a 5' flanking structure sequence, a miRNA sequence that represses FGFR4 gene expression, a stem-loop sequence, a compensating sequence, and a 3' flanking structure sequence.

[0018] As used in this article, "isolated" means that a substance has been separated from its original environment. For example, nucleic acids and polypeptides in their native state within living cells are not isolated and purified, but the same nucleic acid or polypeptide is isolated if it is separated from other substances present in its native state.

[0019] In one embodiment of the invention, the nucleic acid comprises multiple copies of the nucleic acid sequence of the pri-miRNA. In one embodiment of the invention, the multiple copies are 2-10 copies, preferably 2-5 copies, more preferably 2-3 copies. For example, it includes 2, 3, or 4 copies.

[0020] In one embodiment of the invention, the sequences encoding the pri-miRNAs that suppress gene expression of the plurality of copies in the aforementioned nucleic acids have spacer sequences between them. In yet another embodiment of the invention, the spacer sequences have 6-50 nucleotides, preferably 10-30 nucleotides.

[0021] Specifically, in one aspect of the present invention, the pri-miRNA has the structure of Formula I:

[0022]

[0023] Where "|" represents base pairing (A1A2…A a-1 A a (B) is the first RNA sequence; b B b-1 …B2B1) is the second RNA sequence, (A1A2…A a-1 A a ) and (B b B b-1 …B2B1) Completely complementary or substantially completely complementary, wherein a and b are each independent integers of about 15-29, preferably integers of about 18-22;

[0024] [M1M2…M m-1 M m [N] is the 5' end flank structure sequence; n N n-1 …N2N1] is a 3' end flanking structure sequence, where m and n are each independent integers of approximately 25-50, preferably, m <n;

[0025] The septal sequence that forms the stem-loop structure is called the C-stem-loop.

[0026] Where c is an integer of approximately 10-30, preferably an integer of approximately 16-20.

[0027] The pri-miRNA provided by this invention, after biological processing (in vivo, in tissues, or in cells, etc.) (hereinafter referred to as "processing"), produces pre-miRNA or miRNA, ultimately generating an RNA sequence targeting the target mRNA. In this invention, the 5' flanking structural sequence (such as [M1M2…M...M...) in Formula I... m-1 M m ]) and the first RNA sequence (such as A1A2…A in Formula I) a-1 A a The structure composed of 3' flanking structures (such as [N in Formula I]) is also called the 5' arm, and the first RNA sequence in it is called the 5' arm RNA sequence or 5' arm miRNA. Correspondingly, the structure is composed of 3' flanking sequences (such as [N in Formula I]). n N n-1 …N2N1]) and the second RNA sequence (as shown in Formula I, B) b B b-1 The structure consisting of …B2B1) is also called the 3' arm, and the second RNA sequence therein is called the 3' arm RNA sequence or 3' arm miRNA. The pre-miRNA provided by this invention contains an RNA sequence targeting the target mRNA, which can be located or situated on the 5' arm or 3' arm of the stem-loop structure of the regulatory polynucleotide, i.e., the first miRNA sequence or the second miRNA sequence. The pre-miRNA provided by this invention can generate one or two single-stranded mature miRNAs. Based on processing from the 5' and 3' arms of the precursor, the corresponding first miRNA sequence (A1A2…A…B1) is... a- 1A a The single-stranded mature miRNA can be called miRNA-5p, corresponding to the second miRNA sequence (B). b B b-1 Mature miRNAs of …B2B1 can be called miRNA-3p.

[0028] miRNAs can be substantially complementary to at least a portion of the sequence of the mRNA encoding a gene. "Substantially complementary" means that the nucleotide sequences are sufficiently complementary to interact in a predictable manner, such as forming secondary structures. Typically, two "substantially complementary" nucleotide sequences have at least 70% complementary nucleotides; preferably, at least 80%; more preferably, at least 90%; and even more preferably, at least 95%; such as 98%, 99%, or 100%. Functionally, miRNAs interfere with the post-transcriptional degradation of mRNA expressing a specific gene with a complementary nucleotide sequence, thereby preventing translation.

[0029] In one aspect of the invention, the miRNA is 15-29 nucleotides (nt) in length, preferably 18-22 nt, such as 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt. Extensive testing has shown that RNA sequences shorter than 18 nt, especially less than 15 nt, are mostly ineffective. Conversely, RNA sequences longer than 22 nt, especially greater than 25 nt, not only significantly increase circuit costs but also do not outperform 18-22 nt sequences, resulting in poor economic efficiency. Therefore, miRNA sequences with a length of 15-25 nt, particularly 18-22 nt, are most effective.

[0030] In one aspect of the present invention, the pri-miRNA provided by the present invention, after biological processing, essentially yields only miRNAs with the sequence of the first miRNA, while the other RNA sequence does not form or hardly forms miRNA. In one embodiment of the present invention, the miRNA with the sequence of the first miRNA obtained after in vivo processing of the pri-miRNA provided by the present invention is active, that is, the 5' arm miRNA is active, while the miRNA with the sequence of the second miRNA is almost impossible to obtain, that is, the 3' arm miRNA is inactive or almost inactive.

[0031] In one aspect of the invention, the almost non-formed miRNA obtained after biological processing of the pri-miRNA provided by the invention accounts for less than 40% of the total miRNA obtained after processing the pri-miRNA, preferably less than 10%, more preferably less than 5%, for example less than or equal to 2%.

[0032] In one aspect of the invention, the target knockdown (KD) of the target mRNA that inhibits the miRNA sequence of the gene obtained by in vivo processing of the pri-miRNA of the nucleic acid provided by the invention is at least higher than about 30%, about 40%, 50%, 90%, 95%, or up to 99%.

[0033] In one aspect of the invention, the miRNA sequence of the nucleic acid pri-miRNA provided by the invention, after in vivo processing, inhibits the expression of the gene by a protein target knockdown of at least 40%, 50%, 90%, 95%, or up to 99%.

[0034] In one aspect of the invention, the target knockdown achieved by the pri-miRNA provided by the invention, which is almost non-formed after biological processing, is less than about 40%, 10%, 5%, or close to 0%.

[0035] In one aspect of the present invention, the pri-miRNA provided by the present invention, after biological processing, essentially produces miRNA without off-target effects.

[0036] In one embodiment of the present invention, the miRNA sequence that inhibits FGFR4 gene expression has the following nucleotide sequence:

[0037] TCCTTGTACCAGTGGCCACCA(SEQ ID NO.10)

[0038] TGTAATCAAGGTGAGATTCTG(SEQ ID NO.11)

[0039] ATCACGAGACTCCAGTGCTGA(SEQ ID NO.12)

[0040] ATGACGATGTGCTTCAGCCAC(SEQ ID NO.13)

[0041] TTGAGCATCTTGACGGCCACA(SEQ ID NO.14)

[0042] TCCAGATACTGCATGCCTCGG(SEQ ID NO.15)

[0043] TATAGTAGTCAATGTGGTGGA(SEQ ID NO.16)

[0044] TAGGGTCCGAAGGTCAGGCGG(SEQ ID NO.17)

[0045] TTAGCATAGCAGCTCTCCAGC (SEQ ID NO. 18).

[0046] In one embodiment of the present invention, the combination of the RNA sequence that inhibits FGFR4 gene expression and its compensating sequence is a sequence set having the following nucleotide sequences:

[0047]

[0048] In one embodiment of the present invention, the RNA that inhibits FGFR4 gene expression is a pri-miRNA having a stem-loop structure. In one embodiment of the present invention, the sequence of the stem-loop structure has the following nucleotide sequence: GTTTTGGCCTCTGACTGAC (SEQ ID NO. 33).

[0049] In one embodiment of the present invention, the RNA that inhibits FGFR4 gene expression is pri-miRNA, which has a 5' flanking sequence (such as [M1M2…M in Formula I). m-1 M m ]) and the 3' end flank structure sequence (as shown in Equation I [N n N n-1 …N2N1]. In one embodiment of the invention, the 5' end flanking structure sequence and the 3' end flanking structure sequence each independently or simultaneously share greater than 80% identity with the pri-miR sequence of mammals (especially humans), preferably greater than 90%, preferably greater than 95%, and preferably 100%. In one embodiment of the invention, the pri-miR is pri-miR155.

[0050] In one embodiment of the present invention, the 5' flanking structure sequence of the pri-miRNA has the following nucleotide sequence: TGCTGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO.31).

[0051] In one embodiment of the present invention, the 3' flanking structure sequence of the pri-miRNA has the following nucleotide sequence: CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCAC (SEQ ID NO.32).

[0052] In one aspect of the invention, the invention also provides a pre-miRNA, which is processed from the pri-miRNA of the invention described above.

[0053] The present invention also provides isolated nucleic acids encoding a combination of RNAs that inhibit the expression of one or more target genes. The nucleic acids comprise (1) a nucleic acid sequence encoding RNA that inhibits the expression of the FGFR4 gene, and (2) a nucleic acid sequence encoding RNA that inhibits the expression of a second gene.

[0054] In one aspect of the present invention, the second gene includes LRRK2 gene, EGFR gene, KRAS gene, VEGFR gene, mTOR gene, TNF-α gene, integrin-α gene, B7 gene, TGF-β1 gene, HER2 gene, H2-K gene, H2-D gene, H2-L gene, HLA gene, GDF15 gene, miRNA-21, miRNA-214, TNC gene, PTP1B gene, PD-1, PD-L1, CTLA4, PTGS2 gene, TTR gene, APP gene, TAU gene, FUS gene, FGF19 gene, CTNNB1 gene, KHK gene, mHTT gene, and α-synuclein gene, etc.

[0055] In another aspect of the invention, a vector is provided comprising isolated nucleic acids comprising the aforementioned nucleic acid sequences of the invention, including RNA encoding repressive FGFR4 gene expression and repressive FGFR4 and second gene expression. In yet another aspect of the invention, the vector is an expression vector. The nucleic acids of the invention may be located downstream of a promoter of the vector (e.g., but not limited to, CMV, U6, CBA, or a CBA promoter having SV40 introns).

[0056] In one embodiment of the invention, the vector is a plasmid. In one embodiment of the invention, after administration to a mammal, the plasmid can be enriched in tissues (including: liver, lungs, gastrointestinal tract, mammary glands, kidneys, brain, spleen, lymph nodes, thyroid gland, reproductive organs, blood cells or lymphocytes, especially the liver), transcribe and / or express the RNA fragment of the invention, and the RNA fragment is encapsulated in exosomes within the cells of the tissue.

[0057] In one embodiment of the present invention, the vector is a viral vector. For example, it may be a baculovirus expression vector, an adenovirus vector, a retrovirus vector, a herpesvirus vector, or a lentivirus vector. In one embodiment of the present invention, the vector is an adenovirus vector, such as adenovirus-associated virus type 5, adenovirus-associated virus type 8, or adenovirus-associated virus type 9.

[0058] In one embodiment of the invention, the plasmid or viral vector is enriched and expressed in the liver of a mammal after administration, and its product is encapsulated in large quantities in exosomes.

[0059] In one aspect of the invention, a cell comprising the isolated nucleic acid of the invention as described above is provided. Cells comprising the nucleic acid of the invention as described above can be obtained by transfecting cells with plasmids or viral vectors. Transfection of cells with nucleic acid constructs can be performed using various methods. These methods include, but are not limited to, cationic lipid transfection, electroporation, viral transfection, and calcium phosphate transfection.

[0060] In one aspect of the invention, an exosome is provided containing RNA that inhibits FGFR4 gene expression, comprising the pri-miRNA, pre-miRNA, or RNA molecule of the present invention as described above. In one embodiment of the invention, the exosome is an exosome derived from human tissue or cells. The tissue includes the liver, lungs, gastrointestinal tract, mammary gland, kidney, brain, spleen, lymph nodes, thyroid gland, reproductive organs, blood cells, or lymphocytes. In one embodiment of the invention, the exosome is an exosome derived from the liver or liver cells.

[0061] The exosomes of the present invention can be purified using known exosome purification techniques. For example, exosomes can be purified by tangential flow filtration (TFF) or ultracentrifugation, for example, at 100,000 x g for 1-2 hours. Alternative or additional purification methods can be used, such as antibody-based methods, such as immunoprecipitation using specific antibodies, magnetic bead purification, or resin-based purification. The exosomes can then be quantified and characterized.

[0062] The RNA provided by this invention can be delivered to different tissues to inhibit specific target genes and treat related diseases. For example, siRNA targeting the FGFR4 gene can treat related cancers in the liver.

[0063] In one aspect of the invention, a pharmaceutical composition is provided comprising the nucleic acid, carrier, or cell as described above. The pharmaceutical composition further includes a pharmaceutically acceptable carrier or excipient for delivering the nucleic acid, carrier, or cell to a subject.

[0064] The drug can be administered orally, by inhalation, subcutaneously, intramuscularly, or intravenously. The dosage form of the drug can be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes, etc. After administration to mammals, the plasmids or viral vectors in the drug accumulate in tissues (including the liver, lungs, gastrointestinal tract, mammary glands, kidneys, brain, spleen, lymph nodes, thyroid gland, reproductive organs, blood cells or lymphocytes, especially the liver). The products expressed are encapsulated in large quantities in exosomes within the cells of these tissues and delivered to the target tissue to exert a therapeutic effect.

[0065] The pharmaceutical composition can be used to treat various diseases, including cancer, acute and chronic infectious diseases, or other acute and chronic diseases. The cancer can be any cancer, including leukemia, lymphoma, multiple myeloma, or solid tumors. In one aspect of the invention, the cancer is an FGFR4-related cancer. In one aspect of the invention, the cancer is leukemia, lymphoma, multiple myeloma, or solid tumor. For example, the disease is liver cancer. The acute and chronic infectious diseases include viral influenza, viral hepatitis, AIDS, SARS, bacterial diseases (e.g., tuberculosis, bacterial pneumonia), and other acute and chronic infectious diseases caused by various pathogenic microorganisms. The other acute and chronic diseases include respiratory diseases, immune system diseases, blood and hematopoietic system diseases such as cardiovascular diseases, endocrine and metabolic diseases, digestive system diseases, nervous system diseases, urinary system diseases, reproductive system diseases, and musculoskeletal system diseases. For example, the diseases mentioned are cancer, pulmonary fibrosis, colitis, obesity, cardiovascular disease caused by obesity, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease, or graft-versus-host disease.

[0066] In one aspect of the invention, a method of treating a disease is provided, comprising administering to a subject a nucleic acid, vector, or exosome as described above. The disease includes cancer, acute or chronic infectious diseases, or other acute or chronic illnesses.

[0067] Those skilled in the art will understand that the actual dose administered varies depending on a variety of factors, such as the carrier, target cells or tissue, the general condition of the subject to be treated, the degree of transformation / modification sought, the route of administration, the manner of administration, the type of transformation / modification sought, and so on. Detailed Implementation

[0068] The following will further illustrate the essence and beneficial effects of the present invention with reference to embodiments. These embodiments are only used to illustrate the present invention and are not intended to limit the present invention.

[0069] Example 1: Materials and Methods

[0070] Table 1. Cells, Materials, and Reagents:

[0071]

[0072]

[0073] Example 2 Nucleic Acid Synthesis and Plasmid Preparation

[0074] 1. Jiangsu Genewiz Biotechnology Co., Ltd. was commissioned to synthesize or prepare the nucleic acid fragments listed in Table 2 below. The sequence of the pri-miRNA is shown in the table below.

[0075] Table 2. pri-miRNA sequences and structures

[0076]

[0077]

[0078]

[0079] The pri-miRNA sequences are shown in SEQ ID NO.1-9, and their structures from 5' to 3' include: 5' flanking sequence TGCTGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO.31); first miRNA sequence; stem-loop structure sequence GTTTTGGCCTCTGACTGAC (SEQ ID NO.33); compensation sequence, or second miRNA sequence; 3' flanking sequence CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCAC (SEQ ID NO.32).

[0080] The combinations of the first and second miRNA sequences of FGFR4-1 to FGFR4-9 are shown in the table below:

[0081] Table 3 miRNA sequences of pri-miRNA

[0082]

[0083]

[0084] Additionally, a scramble miRNA was provided as a negative control for the experiment. It had the same 5' flanking sequence, 3' flanking sequence, and stem-loop structure sequence as the aforementioned pri-miRNA, but did not have a sequence encoding mRNA complementary to FGFR4.

[0085] 2. Construct a pri-miRNA nucleic acid fragment containing the above-mentioned FGFR4-inhibiting miRNA and a plasmid expressing the contained miRNA.

[0086] Jiangsu Genewise Biotechnology Co., Ltd. was commissioned to insert the above-mentioned nucleic acid fragment encoding the pri-miRNA targeting FGFR4 into the pcDNA6.2-EmGFP-mir9 vector to prepare plasmids carrying the pri-miRNA sequence targeting FGFR4. The resulting plasmids were named FGFR4-1 to FGFR4-9, respectively.

[0087] Example 3: Preparation and Analysis of Cells and Exosomes

[0088] The plasmid prepared in Example 2 was transfected into HEK293T cells using Lipofectamin 3000 according to the manufacturer's instructions, and exosomes in the cell culture medium were observed. Nanoparticle tracking analysis (NTA) showed that the number and size distribution of secreted exosomes were similar across groups, with peak values ​​between 128-131 nm. Transmission electron microscopy (TEM) confirmed that the purified exosomes exhibited typical round vesicle morphology and were of the correct size. Furthermore, enrichment of specific exon markers (CD63, TSG101, and CD9) was detected only in the purified exosomes and not in the cell culture medium. Exosomal RNA was extracted and miRNAs were analyzed using miRNA-seq to determine the miRNA composition.

[0089] The results are shown in Table 4 below.

[0090] Table 4 miRNA composition detection

[0091]

[0092] Example 4: Validation of miRNA plasmid activity

[0093] 1. Changes in intracellular FGFR4 gene mRNA levels after transfection of 293T cells with miRNA plasmid: Trypsin-digested 293T cells were collected, and the cell density was adjusted to 0.6E6 / mL by adding complete culture medium. 1.2M cells (2mL) were added to each well of a six-well plate to cover the entire bottom. The plates were labeled and incubated at 37℃, 5% CO2 for 18-24 hours. Using Lipofectamin 3000, 3ug of miRNA plasmid was transfected into 293T cells according to the manufacturer's instructions. Simultaneously, an empty vector containing scrambled miRNA was transfected as a negative control. After incubation at 37℃, 5% CO2 for 48 hours, the culture medium was removed, and the cells were collected.

[0094] Total RNA was extracted from cells using the RNeasy Plus Mini Kit, and reverse transcribed using HiScript IIQ RT SuperMix. qPCR was used to detect changes in FGFR4 gene mRNA in 293T cells, with mRNA target knockdown (KD) determined according to 2... –ΔΔCt The method calculates the Ct value, where Ct represents the cycle threshold of the sample during the qPCR reaction. ΔCt = Ct value of the target gene FGFR4 - Ct value obtained from the internal reference gene GAPDH / β-actin. ΔΔCt = ΔCt value of the experimental group - ΔCt value of the control group. Here, the experimental group refers to the 293T cell group transfected with the FGFR4 miRNA plasmid; the control group refers to the 293T cell group transfected with the scramble miRNA plasmid.

[0095] The qPCR primers used for the FGFR4 target gene and the GAPDH / β-actin internal reference gene are as follows:

[0096] Table 5 qPCR primers

[0097] Forward primer sequence (5' to 3') Reverse primer sequence (5' to 3') FGFR4 GCACTGGAGTCTCGTGATGG CCACAGCGTTCTCTACCAGG GAPDH ACAACTTTGGTATCGTGGAAGG GCCATCACGCCACAGTTTC β-actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT

[0098] The results are shown in Table 6 below.

[0099] Table 6 miRNA activity assay - mRNA target knockdown (KD)

[0100] pri-miRNA mRNA KD by miRNA Scramble miRNA 100％ miFGFR4-3 44.80％ miFGFR4-4 48.50％ miFGFR4-5 59.90％ miFGFR4-6 53.90％ miFGFR4-7 45.40％ miFGFR4-8 50.70％ miFGFR4-9 46.90％

[0101] 2. Changes in intracellular FGFR4 protein levels after miRNA plasmid transfection into 293T cells

[0102] Changes in FGFR4 protein in 293T cells were detected using Western blotting. Cells transfected with miRNA plasmids were collected and lysed using RIPA (Beyotime). The total protein concentration in the cell lysate was determined using a BCA protein quantification kit. 25 μg of total protein from the cell lysate was added to 4X LDS (Thermo Fisher) and incubated at 70°C for 10 min for protein denaturation. PAGE gel electrophoresis was then performed at 135V for 70 min. After electrophoresis, membranes were transferred using a transfer apparatus, blocked with 5% skim milk, and incubated overnight at 4°C with antibodies against the target gene FGFR4 and the internal control gene Tubulin, respectively. The membranes were then incubated at room temperature for 1 h with Goat Anti-Rabbit IgG (H+L), Secondary Antibody / Goat Anti-Mouse IgG (H+L), and Secondary Antibody, respectively. After washing with PBST solution, take the reagent from Tanon™ Femto-sig ECL Western Blotting Substrate, mix them at a 1:1 ratio (1 mL), and evenly drop them onto the PVDF membrane. Image the membrane using a TANON 5200multi imager, and finally perform grayscale analysis on the protein bands using ImageJ software.

[0103] The results are shown in Table 7 below. Protein target knockdown (KD) was calculated using the following method.

[0104] ImageJ software was used to analyze the grayscale values ​​of the target protein FGFR4 band and the internal reference protein Tubulin band. The grayscale value of the experimental group = grayscale value of the target protein FGFR4 band in the experimental group / corresponding grayscale value of the internal reference protein Tubulin band in the experimental group; the grayscale value of the control group = grayscale value of the target protein FGFR4 band in the control group / corresponding grayscale value of the internal reference protein Tubulin band in the control group; protein target knockdown (KD) = (1 - (grayscale value of the control group - grayscale value of the experimental group) / grayscale value of the control group) × 100; here, the experimental group refers to the 293T cell group transfected with the FGFR4 miRNA plasmid; the control group refers to the 293T cell group transfected with the scramble miRNA plasmid.

[0105] Table 7 miRNA activity assay - protein target knockdown (KD)

[0106]

[0107] Example 5: Design of pri-miRNA for double-copy inhibition of FGFR4

[0108] 1. Synthesis and plasmid construction of gene fragments designed with double-copy pri-miRNA

[0109] Jiangsu Genewise Biotechnology Co., Ltd. was commissioned to synthesize the nucleic acid fragments shown in Table 8 below.

[0110] Table 8. Double-copy pri-miRNA gene fragment sequence

[0111]

[0112]

[0113] Specifically, 2X-miFGFR4 is a nucleic acid fragment of the pri-miRNA corresponding to the aforementioned FGFR4, having two copies: the 2×miFGFR4-7 sequence fragment (SEQ ID NO. 28) comprises two miFGFR4-7 sequence fragments (SEQ ID NO. 7) and a spacer sequence between these two sequence fragments: CTCGAGATATC (SEQ ID NO. 34). Similarly, the 2×miFGFR4-8 sequence fragment (SEQ ID NO. 29) comprises two miFGFR4-8 sequence fragments (SEQ ID NO. 8) and a spacer sequence between these two sequence fragments: CTCGAGATATC (SEQ ID NO. 34); and the 2×miFGFR4-9 sequence fragment (SEQ ID NO. 30) comprises two miFGFR4-9 sequence fragments (SEQ ID NO. 9) and a spacer sequence between these two sequence fragments: CTCGAGATATC (SEQ ID NO. 34).

[0114] According to the method disclosed in Example 2, a pri-miRNA nucleic acid fragment containing the above-mentioned multiple copies of FGFR4 inhibitor and a plasmid expressing the contained miRNA were constructed.

[0115] 2. Comparison of plasmid activity between two copies of pri-miRNA and one copy of pri-miRNA

[0116] 2.1 Following the method disclosed in Example 4, after transfecting 293T cells with a plasmid carrying two copies of pri-miRNA targeting FGFR4, the changes in FGFR4 gene mRNA levels in the cells were detected.

[0117] The results are shown in Table 9 below.

[0118] Table 9. Gene target knockdown activities of two-copy pri-miRNA design and single-copy pri-miRNA design.

[0119] pri-miRNA mRNAKD by miRNA Scramble miRNA 100％ miFGFR4-7 45.40％ miFGFR4-8 50.70％ miFGFR4-9 46.90％ 2×miFGFR4-7 28.3％ 2×miFGFR4-8 30.3％ 2×miFGFR4-9 29.8％

[0120] 2.2 Following the method disclosed in Example 4, after transfecting 293T cells with a plasmid carrying a sequence of two copies of pri-miRNA targeting FGFR4, the changes in intracellular FGFR4 protein levels were detected, as shown in Table 10 below.

[0121] Table 10. Protein target knockdown activities of two-copy pri-miRNA design and single-copy pri-miRNA design.

[0122]

[0123] 2.3 Hep3B2.1-7 Cell Proliferation Assay

[0124] Hep3B2.1-7 cells, digested with trypsin, were counted and their density adjusted to 5E4 / mL with complete culture medium. 5000 cells (100 μL) were added to each well of a 96-well plate, ensuring the cell suspension covered the entire bottom. The plates were labeled and incubated at 37°C in a 5% CO2 incubator for 18-24 hours. Using JetPRIME, 0.2 μg of a single miRNA plasmid and 0.1 μg of a 2× miRNA plasmid were transfected into Hep3B2.1-7 cells according to the manufacturer's instructions. Simultaneously, an empty vector containing scrambled miRNA was transfected as a negative control. After incubation at 37°C in a 5% CO2 incubator for 24 / 48 / 72 hours, 10 μL of LCK-8 Solution was added to each well, and the cells were incubated at 37°C in a 5% CO2 incubator for 4 hours. The absorbance at 450 nm was measured using a microplate reader.

[0125] Calculate cell viability: Cell viability percentage = [(AC) / (BC)] × 100%

[0126] A: Absorbance of the experimental group (absorbance containing culture medium, cells, test drug, and CCK-8 Solution); B: Absorbance of the control group (absorbance containing culture medium, cells, and CCK-8 Solution); C: Absorbance of the blank group (absorbance containing culture medium and CCK-8 Solution).

[0127] The results are shown in Table 11 below.

[0128] Table 11 Hep3B2.1-7 cell viability

[0129]

[0130] The foregoing description of the present invention should not be construed as limiting it. Unless otherwise indicated, the present invention will be practiced using conventional techniques such as organic chemistry, polymer chemistry, and biotechnology, and it is obvious that the invention can be implemented in other ways besides those specifically described in the foregoing description and examples. Other aspects and modifications within the scope of the invention will be apparent to those skilled in the art. Many changes and variations are possible based on the teachings of the present invention, and therefore fall within the scope of the invention.

Claims

1. An isolated nucleic acid comprising a nucleic acid sequence encoding a pri-miRNA that inhibits FGFR4 gene expression, wherein the pri-miRNA comprises, from 5' to 3', a 5' flanking sequence, a miRNA sequence that inhibits FGFR4 gene expression, a stem-loop sequence, a compensation sequence, and a 3' flanking sequence, wherein the miRNA sequence that inhibits FGFR4 gene expression is an RNA sequence complementary to or substantially complementary to the mRNA sequence that expresses the FGFR4 gene.

2. The nucleic acid of claim 1, comprising multiple copies of the nucleic acid sequence of the pri-miRNA, preferably, the multiple copies being 2-10 copies, for example, 2, 3 or 4 copies.

3. The nucleic acid according to claim 1 or 2, wherein the miRNA sequence that inhibits FGFR4 gene expression has the following nucleotide sequence: TCCTTGTACCAGTGGCCACCA(SEQ ID NO.10) TGTAATCAAGGTGAGATTCTG(SEQ ID NO.11) ATCACGAGACTCCAGTGCTGA(SEQ ID NO.12) ATGACGATGTGCTTCAGCCAC(SEQ ID NO.13) TTGAGCATCTTGACGGCCACA(SEQ ID NO.14) TCCAGATACTGCATGCCTCGG(SEQ ID NO.15) TATAGTAGTCAATGTGGTGGA(SEQ ID NO.16) TAGGGTCCGAAGGTCAGGCGG(SEQ ID NO.17) TTAGCATAGCAGCTCTCCAGC (SEQ ID NO. 18).

4. The nucleic acid according to claim 3, wherein the combination of the miRNA sequence that inhibits FGFR4 gene expression and its compensating sequence constitutes a sequence set having the following nucleotide sequences:

5. The nucleic acid according to claim 1, wherein the miRNA that inhibits FGFR4 gene expression has a stem-loop structure and its sequence has the following nucleotide sequence: GTTTTGGCCTCTGACTGAC (SEQ ID NO.33).

6. The nucleic acid according to claim 1, wherein the miRNA that inhibits FGFR4 gene expression has a 5' flanking sequence and a 3' flanking sequence, each of which independently or simultaneously shares greater than 80% identity with a mammalian or human (preferably human) pri-miR sequence (e.g., pri-miR155), preferably greater than 95%, more preferably 100%.

7. The nucleic acid according to claim 6, wherein the 5' flanking structure sequence has the following nucleotide sequence: TGCTGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO. 31); and / or wherein the 3' flanking structure sequence has the following nucleotide sequence: CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCAC (SEQ ID NO. 32).

8. A vector comprising encoding the isolated nucleic acid of any one of claims 1-7.

9. A cell comprising the nucleic acid of any one of claims 1-7 or the vector of claim 8. Optionally, the exosomes in the cells contain RNA obtained by in vivo processing of the pri-miRNA.

10. A pharmaceutical composition comprising the nucleic acid of any one of claims 1-7 or the carrier of claim 8, the cell of claim 9 or the exosomes secreted by said cell.

11. Use of the nucleic acid of any one of claims 1-7, or the vector of claim 8, or the cell of claim 9, or the exosomes secreted by said cell, in the preparation of a medicament for treating a disease. Preferably, the disease is cancer, acute or chronic infectious diseases, or other acute or chronic diseases. More preferably, the cancer is leukemia, lymphoma, multiple myeloma, or a solid tumor, for example, liver cancer.

Images