Kelp gametophyte gene editing method and application

Abstract

The invention discloses a kelp gametophyte gene editing method and application, and belongs to the technical field of gene editing, the kelp gametophyte gene editing method comprises the following steps: preparing a kelp gametophyte receptor; assembling an RNP complex and preparing a microcarrier; introducing the RNP compound into a kelp gametophyte by using a gene gun; and recovering culture and screening. According to the technical scheme, the dependency of a microinjection technology on precise instruments and professional operation skills is eliminated, efficient gene delivery can be achieved through a standardized gene gun operation process, the technical threshold is greatly reduced, and the kelp gametophyte gene editing method has remarkable technical advantages. According to the method, the high-throughput characteristic of a gene gun technology is fully exerted, multiple mutants can be obtained through one-time bombardment, the experiment efficiency is greatly improved, and powerful support is provided for kelp large-scale gene function research and molecular breeding.

Description

Technical Field

[0001] This invention belongs to the field of gene editing technology, specifically relating to a method and application for gene editing of kelp gametophytes. Background Technology

[0002] With the rapid development of molecular biology and genetic engineering, the CRISPR / Cas system has become a revolutionary gene-editing technology. Due to its ease of operation, low cost, and precise and efficient editing, it has shown enormous application potential in biomedical research, agricultural improvement, and microbial engineering. Kelp (Saccharina japonica), a large marine brown algae with high economic and ecological value, has wide applications in food, biofuels, and biomedicine. However, current kelp varieties are obtained through traditional selective breeding or hybridization breeding, which suffers from low breeding efficiency, long cycles, and poor controllability, severely limiting the development of the kelp industry. Applying CRISPR / Cas technology to kelp gene editing will provide new possibilities for kelp genetic improvement and functional gene research.

[0003] While CRISPR / Cas technology is relatively mature in terrestrial plants and model organisms, its application in kelp is still in its early exploratory stages. Kelp's unique growth environment (low temperature) and physiological characteristics (complex cell wall structure) present additional challenges to the delivery and efficient editing of CRISPR / Cas systems. Currently, only in 2023 have Japanese researchers achieved targeted gene knockout in kelp by transforming the ribonucleoprotein complex (RNP) into kelp via microinjection, and introduced the adenine transphosphoribosylase (APT) gene into kelp as an endogenous selection marker gene, which can be used for subsequent functional gene editing in kelp. Although this method can deliver exogenous genes, it requires highly skilled operators, has low throughput, and is prone to causing mechanical damage to cells, resulting in low cell survival rates, severely limiting the rapid promotion and application of this technology in kelp gene editing.

[0004] In contrast, gene guns (particle bombardment) offer advantages such as ease of operation, high throughput, lack of host limitations, and efficient penetration of hard cell walls, and have been successfully applied in various plants and algae. Developing a gene gun-based APT gene knockout technology for kelp that has a lower off-target rate, is more efficient, stable, and easy to implement, would provide a powerful tool for kelp functional genomics research and molecular breeding. Summary of the Invention

[0005] The purpose of this invention is to provide a method and application for gene editing in kelp gametophytes. This invention provides a technical solution for introducing CRISPR / Cas9 ribonucleoprotein complex (RNP) into kelp gametophytes with a lower off-target rate using sgRNA targeting the kelp APT gene and using a gene gun, thereby achieving targeted knockout of kelp ligand genes and providing a new approach for the genetic transformation and breeding of kelp RNP complexes.

[0006] To achieve the above objectives, the present invention employs the following technical solution:

[0007] This invention provides an sgRNA targeting the kelp APT gene, the sgRNA sequence of which is shown in SEQ ID NO.3.

[0008] This invention provides a method for gene editing in kelp gametophytes, the gene editing method comprising the following steps:

[0009] (1) Preparation of kelp gametophytes: After crushing the kelp gametophytes, filter them and place them in a culture medium for static culture to allow them to attach naturally;

[0010] (2) Preparation of RNP complex and microcarrier: Cas9 nuclease and sgRNA were mixed in PBS buffer and incubated to form RNP complex; gold powder was weighed and washed with anhydrous ethanol, sterile water and PBS buffer to obtain microcarrier;

[0011] (3) Using a gene gun to introduce the RNP complex into kelp gametophytes: using the attached kelp gametophytes as recipients, the RNP complex and microcarrier are uniformly mixed and dropped onto the center of the carrier membrane, and the kelp gametophyte recipient cells are transformed by a gene gun.

[0012] (4) The kelp gametophytes transformed by the gene gun were cultured and screened.

[0013] Furthermore, in step (1), the kelp gametophytes must be broken up and filtered through a 200-300 mesh sieve to ensure that the cell concentration of the filtered gametophytes is less than 1×10⁻⁶. 7 / ml, as experimental material, was incubated in solid culture medium for 4-6 days to allow it to adhere naturally, and the process was repeated twice.

[0014] Furthermore, the culture conditions for kelp gametophytes in step (1) are: light intensity of 30-40 μmol·m⁻¹. -2 ·s -1 The temperature was 13℃, the light-dark ratio was 16h:8h, the culture medium was cooled seawater that had been sterilized by high-pressure steam, and additional NaNO3-N 4mg / L and KH2PO4-P 0.4 mg / L were added.

[0015] Furthermore, in step (2), the molar ratio of Cas9 to sgRNA is 1:1.5-2.

[0016] Furthermore, the diameter of the gold powder in step (2) is 0.8um-1.2um.

[0017] Furthermore, in step (3), the pressure of the ruptureable membrane converted by the gene gun is 1100 Psi, the distance between the receptor and the termination screen is 6 cm, and the vacuum degree is 26-27 inch Hg.

[0018] Furthermore, the kelp gametophyte receptor cells attach in batches to increase the amount of gametophytes used.

[0019] Furthermore, the post-bombardment culture conditions in step (4) are: 30-40 μmol·m⁻¹ light intensity. -2 ·s -1 The culture was carried out at a temperature of 17℃ with a light-dark ratio of 16h:8h.

[0020] This invention also provides the application of the gene editing method described above in the targeted knockout of genes in kelp gametophytes.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] 1. This invention provides an sgRNA targeting the kelp APT gene with a potentially lower off-target rate, and a novel kelp gene knockout method based on a gene gun delivery CRISPR-Cas system. Its core advantages are the lower potential off-target rate of the sgRNA and the simplicity and high throughput of the transformation operation.

[0023] 2. The technical solution described in this invention eliminates the dependence of microinjection technology on precision instruments and professional operating skills. Efficient gene delivery can be achieved through a standardized gene gun operation procedure, which greatly reduces the technical threshold. The gene editing method described has significant technical advantages.

[0024] 3. Compared with the method of transforming plasmids, the microcarrier preparation method used in this invention does not use ethanol to dissolve the microcarriers, but uses PBS instead, because ethanol denatures Cas9 protein; after bombardment, it is cultured at a higher temperature and a longer photoperiod, i.e., 17°C, with a light-dark ratio of 16h:8h, which helps to inhibit gametophyte development and promote rapid gametophyte growth; by using this method to co-transform with other gene RNPs, the purpose of knocking out other genes can be achieved through 2-FA resistance screening.

[0025] 4. The technical solution described in this invention fully utilizes the high-throughput characteristics of gene gun technology, which can obtain multiple mutants in a single bombardment, greatly improving experimental efficiency and providing strong support for large-scale gene function research and molecular breeding of kelp. Attached Figure Description

[0026] Figure 1 This is an experimental flowchart of the kelp gametophyte gene editing described in this invention;

[0027] Figure 2 The results of agarose gel electrophoresis analysis of APT DNA fragments after in vitro cleavage by the Cas9 nuclease;

[0028] Figure 3 This is a clone of the kelp gametophyte grown after screening;

[0029] Figure 4 Sequencing and alignment results of kelp gametophyte clone mutants. Detailed Implementation

[0030] The technical solution of the present invention will be further described in detail with reference to the following specific examples.

[0031] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods, and the materials and reagents used can be purchased from biological or chemical reagent companies.

[0032] Example 1: Design and Synthesis of Kelp sgRNA

[0033] The target exon sequence of the adenine transphosphoribosylase (APT) gene and the T2T kelp genome sequence were extracted. The sgRNA guide sequence for the target gene was designed, as shown in Table 1. The APT gene sequence is shown in SEQ ID NO: 1. As shown in Table 1, the sgRNA with the "best" off-target risk assessment in the first three exons of the APT gene was selected as the sgRNA guide sequence APT_exon1_A_6. The spacer sequence + PAM sequence is: 5'-3' (antisense strand): CTGGCTATTCGCCTCGCCTCTGG (SEQ ID NO. 3), with a GC content of 65%.

[0034] Compared with other sgRNA sequences, APT_exon1_A_6 has a lower potential off-target rate, mainly because it has no off-target sites with 3 or fewer mismatched bases (as shown in columns 1M-3M of Table 1), and the number of off-target sites with 4 mismatched bases is the lowest (as shown in column 4M of Table 1).

[0035] Table 1. Information on sgRNA of APT gene in kelp

[0036]

[0037] Example 2: In vitro validation of the sgRNA

[0038] 1. Extraction of kelp gametophyte DNA: DNA was extracted from kelp gametophytes using a plant genomic DNA extraction kit (Tiangen). The steps were as follows: approximately 80 mg of fresh gametophytes were thoroughly ground in liquid nitrogen; GP1 was added, mixed, and incubated in a 65°C water bath for 20 min; chloroform was added, mixed, centrifuged, and the supernatant was collected, followed by the addition of GP2; the mixture was transferred to an adsorption column, centrifuged, and the waste liquid was discarded; after rinsing with GD and PW, 50 μL of sterile water was added for elution.

[0039] 2. Using the extracted DNA as a template, primers APT-F1 and APT-R1 were designed. The APT gene fragment containing the PAM site was amplified using high-fidelity DNA polymerase 2 × Phanta Max Master Mix (Novizan). The fragment is 477 bp long, and the specific gene sequence is shown in SEQ ID NO: 2. This fragment was used as a DNA template for in vitro splicing.

[0040] 3. Sp Cas9 nuclease was mixed with 10 pmol each of APT-sgRNA and sgRNA in an equimolar ratio in Cas9 reaction buffer and incubated at 37°C for 10 min to form the RNP complex. 1 pmol of purified DNA template was added, and the mixture was incubated at 37°C for 60 min. 2 μL of proteinase K was added, and the mixture was digested at 56°C for 10 min. Electrophoresis on 1.2% agarose gel was performed. After in vitro Cas9 digestion, two DNA fragments of 314 bp and 163 bp in length were generated, indicating successful cleavage of the target site. The cleavage results are shown below. Figure 2 As shown.

[0041] Example 3: Preparation of kelp gametophyte acceptors

[0042] 1. Preparation of solid culture medium: After filtering natural seawater through a 0.22 μm filter membrane, add 10 g of agar powder per 1000 ml, sterilize using a vertical high-pressure steam sterilizer at 121℃ for 20 min, cool to 60℃, pour into petri dishes with a diameter of 9 cm and a height of 2 cm, and use as solid plates after solidification.

[0043] 2. A healthy kelp gametophyte clone line was used as the experimental material. After the gametophyte clones reached a sufficient quantity, they were homogenized and then filtered through a 200-300 mesh sieve. The filtered gametophytes (cell concentration less than 10) were then used. 7 ( / ml) was used as experimental material, along with a small amount of culture medium, and placed in a solid culture medium for static incubation for 4-6 days. Culture conditions: light 30-40 μmol·m⁻². -2 ·s -1The temperature was 13℃, the light-dark ratio was 16h:8h, the culture medium was cooled seawater that had been sterilized by high-pressure steam, and additional NaNO3-N 4 mg / L and KH2PO4-P 0.4 mg / L were added.

[0044] Since using too high a concentration of gametophytes in a single application can cause aggregation, after the gametophytes have adhered firmly the first time, the broken and filtered gametophyte cell fluid can be added again to allow them to adhere a second or third time. This can effectively increase the number of gametophyte cells and improve the knockout success rate.

[0045] Example 4: Preparation of RNP complex and microcarrier

[0046] 1. Preparation of RNP complex: For each bombardment, 25 pmol of SpCas9 nuclease and 50 pmol of sgRNA were mixed in PBS buffer at a molar ratio of Cas9:sgRNA = 1:2 and incubated at 37°C for 5 min to form the RNP complex.

[0047] 2. Microcarrier preparation: Weigh 30 mg of gold powder with a diameter of 1 μm and place it in a 1.5 ml low-adsorption centrifuge tube. Add 1 ml of anhydrous ethanol, vortex for 3-5 min, let stand for 1 min, centrifuge at 600 rpm for 1 min, and discard the supernatant. Add 1 ml of distilled water to the precipitate, vortex for 1 min, let stand for 1 min, centrifuge and discard the supernatant. Repeat twice. Add 1 ml of PBS buffer to the precipitate, vortex for 1 min, let stand for 1 min, centrifuge and discard the supernatant. Repeat twice. Add 100 μl of PBS buffer to the precipitate to prepare microcarriers. Divide each microcarrier into 10 μl centrifuge tubes for 10 bombardment experiments.

[0048] Example 5: Gene Gun Bombardment

[0049] In this embodiment, the kelp gametophyte recipient cells obtained in Example 3 were bombarded using a Bio-Rad PDS-1000 / He™ gene gun. The culture medium from the solid plate in Example 3 was poured out and blown out in a sterile environment until no liquid flow occurred, avoiding excessively high ambient temperatures. The RNP complex from Example 4 and 10 μL of the microcarrier described herein were uniformly mixed and dropped onto the center of a carrier membrane sterilized and dried with anhydrous ethanol. After natural drying (approximately 1-2 hours), gene gun transformation was performed at ruptured membrane pressures of 1100 Psi, 1350 Psi, and 1550 Psi, a vacuum degree of 26-27 inch Hg, and a recipient-to-terminator distance of 6 cm. When the vacuum chamber pressure returned to 0, the sample was quickly removed and added to the pre-cooled sterile seawater described in Example 3.

[0050] Experiments have shown that mutant gametophytes can be obtained under a ruptured membrane pressure of 1100 Psi and a distance of 6 cm between the receptor and the termination screen. However, no mutants were obtained at ruptured membrane pressures of 1350 Psi and 1550 Psi. This suggests that excessive pressure can cause severe damage to the cell structure of kelp gametophytes or excessive penetration of microcarriers, preventing the effective transfer of exogenous RNPs.

[0051] Example 6: Recovery Culture and Screening

[0052] Place the culture dish under low light conditions: light intensity 10-20 μmol·m -2 ·s -1 The temperature was 13℃, the light-dark ratio was 16h:8h, and the culture was restored for 5 days.

[0053] Weigh an appropriate amount of 2-FA and dissolve it in DMSO to prepare a 40 mM 2-FA stock solution. Dilute this solution 1000 times and add it to sterilized and cooled natural seawater to achieve a final 2-FA concentration of 40 μM. Add 4 mg / L NaNO3-N and 0.4 mg / L KH2PO4-P. Maintain the solution at 30-40 μmol·m⁻¹. -2 ·s -1 Continue culturing under 17°C light and temperature conditions, with a light-dark ratio of 16h:8h. Replace the original culture medium in the culture dish with this culture medium every 3 days.

[0054] Example 7: Identification of Positive Mutants

[0055] After about two months of cultivation, sporadic algal colonies are visible to the naked eye on the culture medium. Continue cultivation until the algal colonies grow larger. The growth of the kelp gametophyte colonies is as follows: Figure 3 As shown. Sequence mutations were detected using semi-nested PCR. The first amplification was performed using the Plant Direct PCR Kit with primers APT-F2 and APT-R2. Gametophyte cells were isolated under a microscope and added to 20 μl of Plant Direct Lysis Buffer A. The mixture was heated at 95°C for 10 min, briefly centrifuged after heating, and 1 μl of the supernatant was added to the PCR reaction system as a template. The following program was used: pre-denaturation (98°C, 5 min); denaturation (95°C, 10 s), annealing (60°C, 15 s), and extension (72°C, 30 s), 35 cycles; final extension (72°C, 5 min).

[0056] After the PCR reaction was completed, the product was diluted 50 times, and 1 μL was added to the PCR reaction system as a template for the second amplification reaction. The enzyme used was 2 × Phanta Max Master Mix, and the primers used were APT-F3 and APT-R2. The program used was as follows: pre-denaturation (95℃, 3 min); denaturation (95℃, 15 s), annealing (58℃, 15 s) and extension (72℃, 30 s), 35 cycles; final extension (72℃, 5 min).

[0057] PCR products were identified using 1% agarose gel electrophoresis and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing to compare wild-type and mutant DNA sequences. Sequence alignment revealed a two-base deletion mutation in the APT gene near the PAM sequence, which could cause premature termination of the encoded amino acid at amino acid 38. The sequence alignment results are as follows: Figure 4 As shown in Table 2.

[0058] Table 2 Primer Sequences

[0059]

[0060] The above examples only represent the technical solutions of this invention and are not intended to limit the experiments. Although we have improved the experimental scheme, researchers in the same field can still further improve the experimental scheme described above or make scientifically equivalent substitutions for the experimental steps. These changes do not cause the substance of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed in this invention.

Claims

1. An sgRNA targeting the kelp APT gene, characterized in that, The sgRNA sequence is shown in SEQ ID NO.

3.

2. A method for gene editing in kelp gametophytes, characterized in that... The gene editing method includes the following steps: (1) Preparation of kelp gametophytes: After crushing the kelp gametophytes, filter them and place them in a culture medium for static culture to allow them to attach naturally; (2) Preparation of RNP complex and microcarrier: Cas9 nuclease and sgRNA were mixed in PBS buffer and incubated to form RNP complex; gold powder was weighed and washed with anhydrous ethanol, sterile water and PBS buffer to obtain microcarrier; (3) Using a gene gun to introduce the RNP complex into kelp gametophytes: using the attached kelp gametophytes as recipients, the RNP complex and microcarrier are uniformly mixed and dropped onto the center of the carrier membrane, and the kelp gametophyte recipient cells are transformed by a gene gun. (4) The kelp gametophytes transformed by the gene gun were cultured and screened.

3. The gene editing method according to claim 2, characterized in that, In step (1), the kelp gametophytes must be broken up and filtered through a 200-300 mesh sieve. The filtered gametophytes should have a cell concentration of less than 1×10⁻⁶. 7 / ml, as experimental material, was incubated in solid culture medium for 4-6 days to allow it to adhere naturally, and the process was repeated twice.

4. The gene editing method according to claim 2, characterized in that, The culture conditions for kelp gametophytes in step (1) are: light intensity of 30-40 μmol·m -2 ·s -1 The temperature was 13℃, the light-dark ratio was 16h:8h, the culture medium was cooled seawater that had been sterilized by high-pressure steam, and additional NaNO3-N 4 mg / L and KH2PO4-P 0.4 mg / L were added.

5. The gene editing method according to claim 2, characterized in that, In step (2), the molar ratio of Cas9 to sgRNA is 1:1.5-2.

6. The gene editing method according to claim 2, characterized in that, The diameter of the gold powder in step (2) is 0.8um-1.2um.

7. The gene editing method according to claim 2, characterized in that, In step (3), the pressure of the ruptured membrane converted by the gene gun is 1100 Psi, the distance between the receptor and the termination screen is 6 cm, and the vacuum degree is 26-27 inch Hg.

8. The gene editing method according to claim 2, characterized in that, The kelp gametophyte receptor cells attach in batches to increase the amount of gametophytes used.

9. The gene editing method according to claim 2, characterized in that, The post-bombardment culture conditions in step (4) are: light intensity of 30-40 μmol·m -2 ·s -1 The culture was carried out at a temperature of 17℃ with a light-dark ratio of 16h:8h.

10. The application of the gene editing method according to claim 2 in the targeted knockout of genes in kelp gametophytes.

Images