Molecular marker for identifying larimichthys polyactis sperm-induced larimichthys polyactis gynogenesis offspring and hybrid offspring, primer set and kit and application thereof
By developing specific molecular markers and their primer sets, and using PCR amplification and electrophoresis detection, the problem of distinguishing between female offspring and hybrid offspring of small yellow croaker has been solved, realizing a rapid, accurate, and low-cost identification method, which supports the genetic breeding of small yellow croaker.
Patent Information
- Application Number
- CN202511543595.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-28
- Publication Date
- 2026-03-31
- Estimated Expiration
- 2045-10-28
AI Technical Summary
Existing technologies make it difficult to accurately distinguish between female offspring and hybrid offspring of small yellow croaker, and directly applying the methods used for large yellow croaker cannot solve the identification problem of small yellow croaker.
Specific molecular markers and their primer sets were developed. Genomic DNA was extracted from the parents of small yellow croaker and yellow croaker, gynogenetic offspring and hybrid offspring. PCR amplification and agarose gel electrophoresis were performed using specific primers F and R. Gynogenetic individuals and hybrid individuals were distinguished based on the electrophoretic bands.
This technology enables rapid, accurate, and low-cost identification of gynogenetic and hybrid offspring of small yellow croaker during the juvenile stage, providing important support for genetic breeding.
Smart Images

Figure CN121006405B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of fish development and identification, specifically involving molecular markers, primer sets, kits, and applications for identifying female and hybrid offspring of small yellow croaker induced by yellow croaker sperm. Background Technology
[0002] Small yellow croaker ( Larimichthys polyactis The small yellow croaker (Croton tigrinosa) belongs to the order Perciformes, family Sciaenidae, and genus Croaker. It is an important marine economic fish in my country. Its flesh is delicate and delicious, rich in various amino acids, fatty acids, minerals, and trace elements, making it highly nutritious and popular with consumers. Since the 1960s, due to overfishing and environmental degradation, the natural resources of small yellow croaker have declined sharply, with the population structure showing a declining trend of younger age, earlier sexual maturity, and smaller individuals, resulting in a severe situation for its germplasm resources. Relying solely on marine fishing is no longer sufficient to meet the growing market demand for high-quality small yellow croaker. In 2015, artificial breeding technology for small yellow croaker was successfully developed, and in 2016, a breakthrough was achieved in the key technology of fully artificial breeding. To date, a large-scale breeding technology system with a scale of tens of millions of fry has been successfully established, and the prospects for industrialization in aquaculture are very broad. Gynogenesis is a special developmental process that uses genetically inactivated heterologous sperm to activate the egg and inhibits the expulsion of the second polar body through chromosome doubling technology, restoring the embryo's chromosomes to diploidity, thus achieving a process in which embryonic development is completely controlled by maternal genetic material. Under natural conditions, gynogenesis is common in fish (such as silver carp and Amazonian killifish) and invertebrates. By inhibiting meiosis or fusing with polar bodies, the egg cell maintains or restores its diploidity to ensure normal development. Applying gynogenesis technology can rapidly establish pure lines, fix desirable traits, and help precisely locate genes or genomic regions that control key economic traits such as growth, disease resistance, and stress tolerance, providing an important foundation for subsequent genetic analysis and new variety breeding.
[0003] However, in experiments on gynogenesis in small yellow croaker, hybrid individuals may arise from accidental fertilization in the offspring. These hybrid individuals are morphologically difficult to distinguish from gynogenic individuals, especially in the juvenile stage. Therefore, establishing a molecular marker method that can rapidly and accurately distinguish gynogenic individuals from hybrid individuals has become a critical problem that urgently needs to be solved.
[0004] Patent CN118452116A discloses a method for inducing gynogenesis in large yellow croaker using sperm from yellow croaker. This patent uses genetically inactivated yellow croaker sperm to induce gynogenesis in large yellow croaker, successfully breeding gynogenic offspring. These offspring exhibit significantly superior growth rate, stress resistance, and meat quality compared to ordinary large yellow croaker, laying a solid foundation for improving large yellow croaker germplasm resources and holding significant importance in fish genetics, breeding, and evolutionary biology research. Furthermore, this invention achieves a spawning success rate of over 80% and yields a large number of high-quality eggs through enhanced cultivation of female parents, two-dose injections, and optimized dosage of spawning-inducing drugs, providing a reliable guarantee for the smooth implementation of gynogenesis technology. However, the method provided in this patent primarily targets large yellow croaker. While it has important reference value in inducing gynogenesis, it does not address effective techniques for distinguishing between gynogenic offspring and hybrid offspring from small yellow croaker. Because small yellow croaker and large yellow croaker differ in their genetic background, directly applying this method still cannot solve the problem of accurately identifying female offspring and hybrid offspring of small yellow croaker. Therefore, it is urgent to develop specific molecular markers and identification systems suitable for small yellow croaker. Summary of the Invention
[0005] To address the difficulty of existing technologies in distinguishing whether offspring of small yellow croaker induced by croaker sperm are true gynogenetic offspring, this invention, based on genomic data analysis, develops molecular markers, kits, and their applications that can accurately distinguish them from hybrid offspring. It proposes molecular markers, primer sets, kits, and applications for identifying gynogenetic offspring and hybrid offspring of small yellow croaker induced by croaker sperm.
[0006] The present invention is implemented using the following technical solutions:
[0007] The first aspect of this invention provides a primer set for identifying molecular markers related to gynogenesis offspring and hybrid offspring induced by yellow croaker sperm, characterized in that the primer set includes primers F and R, wherein the nucleotide sequence of primer F is shown in SEQ ID NO.1 and the nucleotide sequence of primer R is shown in SEQ ID NO.2.
[0008] A second aspect of the present invention provides a kit containing the above-described primer set.
[0009] The third aspect of this invention provides the application of the above-described primer set or the above-described kit in identifying the offspring and hybrid offspring of small yellow croaker induced by yellow croaker sperm.
[0010] The fourth aspect of this invention provides a method for identifying offspring of small yellow croaker induced by yellow croaker sperm and hybrid offspring based on specific molecular markers, comprising the following steps:
[0011] S.1 Extract genomic DNA from the caudal fins of the parent croaker and yellow croaker, gynogenetic offspring, and hybrid offspring;
[0012] S.2 Design specific primers F and R, wherein the nucleotide sequence of primer F is shown in SEQ ID NO.1 and the nucleotide sequence of primer R is shown in SEQ ID NO.2;
[0013] S.3 Using the genomic DNA of the parents, gynogenetic offspring, and hybrid offspring of small yellow croaker and yellow croaker as templates, PCR amplification was performed using specific primers F / R, and the amplification products were detected by electrophoresis;
[0014] S.4 Identify gynogenetic individuals and hybrid individuals of small yellow croaker based on electrophoretic bands.
[0015] Furthermore, the method for obtaining the specific primers F / R in step S.2 is as follows: the DNA sequence of the gene is obtained by searching the sequence information of A022153.1 and CM024806.1 in the genome database of small yellow croaker and yellow croaker respectively.
[0016] Furthermore, the electrophoresis method in step S.3 is agarose gel electrophoresis.
[0017] Furthermore, the PCR reaction system in step S.3 is as follows: 2×Hieff® PCR Master Mix, 10 μL; ddH2O, 8 μL; DNA template, 1 μL; F / R, 0.5 μL each; the amplification program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 61℃ annealing for 30 s, 72℃ extension for 20 s, 35 cycles; 72℃ extension for 10 min.
[0018] Furthermore, in step S.4, the electrophoretic bands, when there is only one specific band of about 389-400 bp in the parents, indicate small yellow croaker; when there is only one specific band of about 499-510 bp, indicate yellow croaker. In the offspring of the gynogenesis experiment, when there is only the maternal small yellow croaker band, it indicates a small yellow croaker gynogenic individual; when both maternal and paternal bands are present, it indicates a hybrid individual.
[0019] The present invention has the following beneficial effects:
[0020] (1) Based on genomic data analysis, the present invention has developed a molecular marker F / R that can effectively distinguish between gynogenic offspring and hybrid offspring of small yellow croaker during the juvenile stage. The method includes extracting genomic DNA from the parents and offspring, PCR amplification and agarose gel electrophoresis detection, and finally distinguishing gynogenic individuals and hybrid individuals by whether the electrophoretic band contains the parental marker of yellow croaker.
[0021] (2) The identification method used in this invention is simple, fast, accurate and low cost, and plays an important role in the genetic breeding of small yellow croaker. Attached Figure Description
[0022] Figure 1 The image shows the results of PCR electrophoresis. Note: 1-6: Yellow croaker; 7-12: Yellow croaker gynogenetic offspring; 13-18: Hybrid offspring; 19-24: Yellow croaker. Detailed Implementation
[0023] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, unless otherwise specified, the following embodiments and features can be combined with each other. Unless otherwise specified, the methods used in the embodiments of the present invention are conventional methods, and the reagents used are commercially available.
[0024] Example 1:
[0025] 1. Genomic DNA extraction and detection
[0026] Caudal fins of broodstock, gynogenetic offspring, and hybrid offspring of *Siniperca maculatus* and *Siniperca spp.* were collected and preserved in 95% ethanol. Genomic DNA was extracted from the samples using a marine animal tissue genomic DNA extraction kit (DP324-02, Tiangen Biotech Co., Ltd.). DNA extraction efficiency was assessed using 1% agarose gel electrophoresis (110V, 60mA, 30min) and a NanoDrop™ One spectrophotometer. Results showed that all DNA bands were clear, intact, and undegraded, with OD values of [missing value]. 260 / OD 280 The ratios were all between 1.9 and 2.0, indicating high DNA purity.
[0027] 2. Specific primer design
[0028] The DNA sequence of this gene was obtained by retrieving the sequence information of A022153.1 and CM024806.1 from the genome databases of small yellow croaker and yellow croaker. Specific primers F: GCATCCTCAACGCTGATGACA (as shown in SEQ ID NO.1) and R: ACGACGTTACGTGACTCACAG (as shown in SEQ ID NO.2) were designed using Primer 5 and synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0029] 3. PCR amplification and gel electrophoresis detection
[0030] Using the genomic DNA extracted in step 1 from the parent croaker and yellow croaker, gynogenetic progeny, and hybrid progeny as templates, PCR amplification was performed using the specific primers F / R from step 2. The PCR reaction system was as follows: 10 μL of 2×Hieff® PCR MasterMix (With Dye); 8 μL of ddH2O; 1 μL of DNA template; and 0.5 μL each of F / R primers. The amplification program was: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 61℃ annealing for 30 s, 72℃ extension for 20 s, 35 cycles; and 72℃ extension for 10 min. The PCR amplification products were detected by 1.2% agarose gel electrophoresis (110V, 60mA, 30 min). After electrophoresis, the gel was photographed using a BIO-RADGel Doc XR+ imaging system.
[0031] 4. Results Analysis
[0032] The electrophoresis results in step 3 showed that the small yellow croaker parent had only one specific band of about 389-400 bp, and the yellow croaker parent had only one specific band of about 499-510 bp; in the gynogenesis experiment, the offspring of the small yellow croaker only showed the maternal (small yellow croaker) band, and no infiltration of paternal (yellow croaker) genetic material was detected, thus identifying them as gynogenic individuals; if the offspring of the gynogenesis experiment contained both maternal (small yellow croaker) and paternal (yellow croaker) bands, they were identified as hybrid individuals. Figure 1 ).
Claims
1. The application of a primer set for identifying a molecular marker related to the offspring of Pseudosciaena heteroloba induced by sperm of Nibea albiflora or a kit containing the primer set for identifying a molecular marker related to the offspring of Pseudosciaena heteroloba induced by sperm of Nibea albiflora in identifying the offspring of Pseudosciaena heteroloba induced by sperm of Nibea albiflora, wherein the primer set comprises primers F and R, the nucleotide sequence of the primer F is shown as SEQ ID NO. 1, and the nucleotide sequence of the primer R is shown as SEQ ID NO.
2.
2. A method for identifying the offspring of induced gynogenesis and hybridization of Nibea albiflora based on specific molecular markers, characterized in that, The method comprises the following steps: S.1 extracting genomic DNA from the tail fins of Pseudosciaena heteroloba and Nibea albiflora parents, gynogenesis offspring and hybrid offspring; S.2 designing specific primers F and R, wherein the nucleotide sequence of the primer F is shown as SEQ ID NO. 1, and the nucleotide sequence of the primer R is shown as SEQ ID NO. 2; S.3 using the genomic DNA of Pseudosciaena heteroloba and Nibea albiflora parents, gynogenesis offspring and hybrid offspring as a template and using specific primers F / R for PCR amplification, and performing electrophoresis detection on the amplification products; S.4 identifying Pseudosciaena heteroloba gynogenesis individuals and hybrid individuals according to the electrophoresis bands, wherein in the parents, when there is only one specific band of 389-400 bp, it is Pseudosciaena heteroloba, and when there is only one specific band of 499-510 bp, it is Nibea albiflora; in the offspring after gynogenesis experiment, when there is only the band of the female Pseudosciaena heteroloba, it is a Pseudosciaena heteroloba gynogenesis individual, and when there are the bands of the female and the male, it is a hybrid individual.
3. The method for identifying offspring and hybrid offspring of small yellow croaker induced by yellow croaker sperm based on specific molecular markers as described in claim 2, characterized in that, The method for obtaining the specific primers F / R in step S.2 is as follows: according to the sequence information of A022153.1 and CM024806.1 in the genomic database of Pseudosciaena heteroloba and Nibea albiflora, the DNA sequence of the gene is obtained by searching.
4. The method for identifying offspring and hybrid offspring of small yellow croaker induced by yellow croaker sperm based on specific molecular markers as described in claim 2, characterized in that, The electrophoresis method in step S.3 is agarose gel electrophoresis.
5. The method for identifying offspring and hybrid offspring of small yellow croaker induced by yellow croaker sperm based on specific molecular markers as described in claim 2, characterized in that, The PCR reaction system in step S.3 is as follows: 2x PCR Master Mix, 10 μL; ddH2O, 8 μL; DNA template, 1 μL; F / R, 0.5 μL each; and the amplification program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 61℃ annealing for 30 s, 72℃ extension for 20 s, 35 cycles; and 72℃ extension for 10 min.