SNP molecular marker in Chinese cabbage bolting-resistant gene BrBL1 as well as KASP primer group and application thereof
By developing SNP molecular markers and KASP primer sets for the BrBL1 gene in Chinese cabbage, and utilizing PCR amplification and fluorescence signal detection, the challenges of screening and breeding for bolting resistance were solved, achieving efficient and accurate variety selection.
Patent Information
- Application Number
- CN202511354713.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-22
- Publication Date
- 2025-11-25
AI Technical Summary
Existing technologies make it difficult to efficiently screen and breed Chinese cabbage varieties with strong bolting resistance, resulting in damage to the yield and quality of Chinese cabbage heads during the production process.
SNP molecular markers in the BrBL1 gene and its KASP primer set were developed. By detecting the G/C allelic variant at position g.5544261 on chromosome A02 in the Chinese cabbage genome, specific primers were designed for PCR amplification and fluorescence signal reading, enabling rapid identification and breeding of bolting resistance.
This technology enables rapid and accurate screening of individuals containing the bolting-resistant gene BrBL1 at the molecular level, improving the breeding efficiency of bolting-resistant varieties, reducing the workload of field selection, and helping to accelerate variety selection.
Smart Images
Figure CN121006416A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of molecular genetics and breeding, and particularly relates to a SNP molecular marker in a bolting-tolerant gene BrBL1 of Brassica rapa, a KASP primer set thereof and application thereof. BACKGROUND
[0002] Brassica rapa L. ssp. pekinensis belongs to Brassica (AA, 2n = 20) and originates from China, is one of the vegetables with the largest planting area and the widest distribution in China, and plays an important role in Chinese vegetable economic crops. The production of spring Chinese cabbage meets the market demand for Chinese cabbage in the south and north from May to July, and plays an important role in the annual supply of Chinese cabbage. However, in the production process of spring Chinese cabbage, the temperature is low in the early stage and high in the late stage, and if the temperature management is improper or the climate changes, the varieties with weak winter resistance are prone to bolting through the vernalization process, causing "premature bolting". Premature bolting seriously affects the yield and quality of Chinese cabbage leaf balls, causing great losses to production, and is the main limiting factor for the production of spring Chinese cabbage in China and the production of Chinese cabbage in high latitude and high altitude areas.
[0003] Breeding late-bolting varieties is the most economical and effective way to solve the problem of premature bolting of Chinese cabbage. At present, most of the main cultivated varieties of spring Chinese cabbage in China are introduced from South Korea and Japan, and in recent years, domestic units have also introduced a part of spring Chinese cabbage varieties to meet market demand. These varieties have the advantages of early maturity, disease resistance, high quality and good commodity, and meet the local consumption habits, but the bolting resistance is far inferior to that of foreign varieties. Therefore, breeding excellent late-bolting varieties has become a problem to be solved. Therefore, identifying and breeding different late-bolting breeding materials, fine mapping and cloning of late-bolting genes, not only can clarify the bolting mechanism of Chinese cabbage, but also can breed late-bolting varieties through molecular marker-assisted selection of multiple late-bolting genes, which has important significance.
[0004] KASP (Kompetitive Allele Specific PCR, competitive allele-specific PCR) can accurately determine SNPs or InDels widely existing in genomic DNA, can detect a large number of samples at the same time, and is a high-throughput, economical and effective SNP typing technology. Therefore, screening of SNPs related to bolting resistance and further development of KASP markers suitable for high-throughput and high-efficiency detection for application in selection of Chinese cabbage bolting-tolerant materials have important significance in improving the yield and quality of Chinese cabbage. SUMMARY
[0005] The application aims to provide a SNP molecular marker in a BrBL1 gene and a KASP primer set thereof, which can not only quickly screen individuals containing the bolting-resistant gene BrBL1 in a Chinese cabbage offspring population at a molecular level, but also has high accuracy and greatly improves the breeding efficiency of bolting-resistant varieties.
[0006] In order to achieve the above-mentioned purpose, the application provides the following technical scheme.
[0007] The application provides application of a SNP molecular marker in a BrBL1 gene in detection of bolting traits of Chinese cabbage, and the SNP molecular marker is a G / C allelic variation base at g.5544261 of an A02 chromosome of a Chinese cabbage genome Brapa-Chiifu-V1.5 or a G / C allelic variation base at the 5' end of a 101bp sequence of a SNP molecular marker A02-5544261.
[0008] The application further provides a KASP primer set of the SNP molecular marker for detecting the bolting traits of Chinese cabbage, and the KASP primer set comprises a forward primer BrBL1-K1Fa as shown in a nucleotide sequence of SEQ ID NO. 3, a forward primer BrBL1-K1Fb as shown in a nucleotide sequence of SEQ ID NO. 4 and a reverse primer BrBL1-K1R as shown in a nucleotide sequence of SEQ ID NO. 5.
[0009] Preferably, the 5'-end of the forward primers BrBL1-K1Fa and BrBL1-K1Fb is connected with a FAM-tail universal fluorescent label sequence and a HEX-tail universal fluorescent label sequence respectively.
[0010] The application further provides a KASP primer set of the SNP molecular marker for detecting the bolting traits of Chinese cabbage, and the KASP primer set has at least one of the following functions:
[0011] (1) identifying or assisting in identifying the bolting traits of Chinese cabbage;
[0012] (2) breeding of Chinese cabbage with bolting-resistant traits;
[0013] (3) breeding of Chinese cabbage with bolting-resistant traits.
[0014] The application further provides a method for identifying or assisting in identifying the bolting traits of Chinese cabbage, and the method comprises: detecting polymorphism or genotypes of the SNP molecular marker in a Chinese cabbage genome to be detected.
[0015] The allelic variation base of the SNP molecular marker is G / C, which is located at g.5544261 on the A02 chromosome in the Brassica rapa genome Brapa-Chiifu-V1.5; or the G / C allelic variation base at the 101st bp at the 5' end of the sequence shown in the SNP molecular marker A02-5544261.
[0016] Preferably, when the base at g.5544261 on the A02 chromosome in the Brassica rapa genome Brapa-Chiifu-V1.5 or the 101st bp at the 5' end of the sequence shown in SEQ ID NO. 1 is G, the Brassica rapa is a bolting-tolerant variety.
[0017] When the base at g.5544261 on the A02 chromosome in the Brassica rapa genome Brapa-Chiifu-V1.5 or the 101st bp at the 5' end of the sequence shown in SEQ ID NO. 2 is C, the Brassica rapa is a bolting-susceptible variety.
[0018] The present application also provides a method for detecting the bolting trait of Brassica rapa, comprising the following steps:
[0019] S1, extracting the Brassica rapa genomic DNA;
[0020] S2, using the Brassica rapa genomic DNA as a template, establishing a PCR reaction system by using the KASP primer set in claim 1 to perform PCR amplification to obtain a PCR amplification product;
[0021] S3, reading the fluorescence signal value of the PCR amplification product obtained in step S2, and analyzing the SNP typing result.
[0022] Preferably, the PCR reaction system is 8 μL, which comprises: 1.5 μL of the Brassica rapa genomic DNA 80 ng / μL, 4 μL of KASP Mastermix (2x), 0.14 μL of a primer mixture, and the rest is supplemented with ddH2O; the primer mixture is obtained by mixing BrBL1-K1Fa, BrBL1-K1b, BrBL1-K1R and ddH2O at a volume ratio of 12:12:30:46 at a concentration of 100 μmol / L.
[0023] Preferably, the amplification procedure of the PCR amplification is: the first stage is denaturation at 94℃ for 15 min; the second stage is denaturation at 94℃ for 20 s, annealing at 61℃ for 60 s, a total of 10 cycles, and from the second cycle, each cycle is reduced by 0.6℃; the third stage is denaturation at 94℃ for 20 s, annealing at 55℃ for 60 s, a total of 26 cycles; and the fourth stage is 37℃ for 1 min.
[0024] Preferably, the reading of the fluorescence signal value includes: the signal point of homozygous bolting-resistant material a is blue; the signal point of homozygous bolting-prone material b is green; and the signal point of heterozygous bolting-prone material h is red.
[0025] The beneficial effects of this invention are:
[0026] The SNP molecular markers and their KASP primer sets provided by this invention can rapidly screen individuals containing the bolting-resistant gene BrBL1 in the offspring population of Chinese cabbage at the molecular level with high accuracy, greatly improving the breeding efficiency of bolting-resistant varieties. Attached Figure Description
[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0028] Figure 1 This is a frequency distribution diagram of bolting length in the F2 population.
[0029] Figure 2 The BSA-Seq mapping results for the bolting-resistant gene BrBL1 are shown (plotting window is 1Mb, step length is 50kb, yellow line is 95% confidence interval, blue line is 99% confidence interval. The mapping interval is a candidate region of 2.6-6.9Mb on chromosome A02);
[0030] Figure 3 The results of KASP genotyping in the F2 population using the marker BrBL1-K1;
[0031] Figure 4 The results of the analysis of variance between the genotype and bolting height of 172 individual plants in the F2 population;
[0032] Figure 5 The results of KASP genotyping in a natural population using the marker BrBL1-K1 are shown. Detailed Implementation
[0033] This invention provides a bolting resistance gene BrBL1 in Chinese cabbage and its ASNP molecular markers. The ASNP molecular markers are either a G / C allelic variation at position g.5544261 on chromosome A02 in the Chinese cabbage genome Brapa-Chiifu-V1.5, or a G / C allelic variation at the 101st bp of the 5' end of the sequence shown by the ASNP molecular marker A02-5544261. The ASNP molecular marker A02-5544261 is as follows:
[0034] CTATCAAGAACTTCATATGGTATGCCCAACTCTTTTCTTTCTTTCTTG AGTTTATAAAAAACAAGATTTAGTTTATTCATCTGCTCTACTTGTTTCTG[G / C]AAGACTGGATCTAAGGGAATCACTCAGGATTTTTCTTGTTGTTCTCACCC TGATCTGTTCTCACAACTCAAAAGACCTGAAAAATAGTTAACTTGTCCCT.
[0035] The base in the bolting-resistant material is G, and the SNP molecular marker is shown in SEQ ID NO.1: CTATCAAGAACTTCATATGGTATGCCCAACTCTTTTCTTTTCTTTTCTTGAGTTTATAAAAAACAAGATTTAGTTTATTCATCTGCTCTACTTGTTTCTGGAAGACTGGATCTAAGGGAATCACTCAGGATTTTTCTTGTTGTTCTCACCCTGATCTGTTCTCACAACTCAAAAGACCTGAAAAATAGTTAACTTGTCCCT (SEQ ID NO.1).
[0036] The base in the bolting material is C, and the SNP molecular marker is shown in SEQ ID NO.2: CTATCAAGAACTTCATATGGTATGCCCAACTCTTTTCTTTTCTTTTCTTGAGTTTATAAAAAACAAGATTTAGTTTATTCATCTGCTCTACTTGTTTCTGCAAGACTGGATCTAAGGGAATCACTCAGGATTTTTCTTGTTGTTCTCACCCTGATCTGTTCTCACAACTCAAAAGACCTGAAAAATAGTTAACTTGTCCCT (SEQ ID NO.2).
[0037] The present invention also provides a KASP primer set for detecting SNP molecular markers of bolting trait in Chinese cabbage. The KASP primer set consists of a forward primer BrBL1-K1Fa with nucleotide sequence SEQ ID NO.3, a forward primer BrBL1-K1Fb with nucleotide sequence SEQ ID NO.4, and a reverse primer BrBL1-K1R with nucleotide sequence SEQ ID NO.5. The 5' ends of the forward primers BrBL1-K1Fa and BrBL1-K1Fb are respectively connected to a FAM-tail universal fluorescent tag sequence and a HEX-tail universal fluorescent tag sequence.
[0038] The KASP primer set described in this invention has at least one of the following functions:
[0039] (1) To identify or assist in the identification of bolting characteristics of Chinese cabbage;
[0040] (2) Breeding of Chinese cabbage with bolting resistance;
[0041] (3) Select Chinese cabbage varieties with bolting resistance.
[0042] This invention relates to the SNP molecular marker A02-5544261 associated with the bolting-resistant gene BrBL1 in Chinese cabbage, and designed the detection primer set BrBL1-K1 for this SNP molecular marker. This SNP molecular marker and its primer set BrBL1-K1 can accurately and efficiently detect bolting-resistant and bolting-prone material types. This screening method is unaffected by environmental factors, significantly reduces the workload of field selection, and helps to accelerate the breeding of bolting-resistant varieties of Chinese cabbage.
[0043] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0044] Unless otherwise specified, the production processes, experimental methods, or testing methods involved in the embodiments of this invention are all conventional methods in the prior art, and their names and / or abbreviations are all conventional names in the field, which are very clear and distinct in the relevant application areas. Those skilled in the art can understand the conventional process steps based on the names and apply the corresponding equipment, and implement them according to conventional conditions or the conditions recommended by the manufacturer.
[0045] The various instruments, equipment, raw materials or reagents used in the embodiments of this invention are not subject to any special restrictions on their source. They are all conventional products that can be purchased through regular commercial channels and can be prepared according to conventional methods known to those skilled in the art.
[0046] Example 1
[0047] 1.1 Investigation of test materials and properties
[0048] YW81, a bolting-resistant DH line of Chinese cabbage, and R16-11, an early bolting line, were selected as parents. The two lines were crossed to obtain F1 generation seeds, and the F1 materials were self-pollinated to obtain F2 generation seeds. Seeds germinated from YW81, R16-11, F1, and F2 were vernalized at 4℃ for 6 weeks, and then cultivated and managed under long-day conditions (16h light / 8h dark). The bolting length of each individual plant was measured after one-third of the F2 population had flowered.
[0049] From the frequency distribution diagram of F2 ( Figure 1 The F1 generation exhibits a distinct bimodal distribution, indicating the presence of a major gene. The bolting length of the F1 generation is close to that of the early-bolting parent R16. Figure 1 The results indicate that the bolting resistance trait of YW81 is controlled by a recessive gene, which is named BrBL1.
[0050] 1.2 Genomic DNA Extraction
[0051] Genomic DNA was extracted from both parents and individual plants of the F1 and F2 generations using a modified CTAB method. The specific steps are as follows.
[0052] Take an appropriate amount of fresh leaf tissue and place it in a 2.0 mL centrifuge tube. Add one 5 mm diameter steel bead, followed by 1000 μL of 2% CTAB extraction buffer. Place the centrifuge tube in a tissue homogenizer (Retsch MM400, Germany) and homogenize at 30 times / second for 1 min. Incubate the homogenized sample at 65°C for 1 hour, shaking well 2-3 times during this period. After cooling, add 500 μL of chloroform, shake thoroughly, and then centrifuge at 12000 rpm for 10 min. Transfer 500 μL of the supernatant to a new 1.5 mL centrifuge tube, add 500 μL of isopropanol pre-chilled, mix thoroughly, incubate on ice for 30 min, and then centrifuge at 12000 rpm for 5 min. Discard the supernatant, add 1000 μL of 75% ethanol to wash the DNA precipitate, centrifuge again at 12000 rpm for 2 min, and discard the supernatant. The DNA precipitate was dried at room temperature, and 100 μL of ddH2O was added to dissolve the DNA. The dissolved DNA was then stored in a -20°C freezer for later use.
[0053] 1.3 Locating the bolting resistance gene BrBL1 in Chinese cabbage
[0054] Using the F2 segregating population mentioned above as test material, 50 F2 single plants with very early and very late bolting were selected to construct two gene pools for early bolting and late bolting. Whole genome resequencing of the two parents (YW81 and R16-11) and the two pools was performed using BSA-Seq technology.
[0055] Using the Chinese cabbage Chiifu-401-42 genome sequence (V1.5) as a reference sequence, clean reads from both parents and two mixed pools were aligned to the reference genome using BWA (v0.7.17) software. SNP calling was performed using Samtools (v1.9) and Bcftools (v1.9) to obtain the SNP loci for each sample. Analysis using the ΔSNP-index method located the late bolting gene BrBL1 within a 4.3 Mb (2.6-6.9 Mb) segment on chromosome A02.
[0056] 1.4 Development of KASP molecular marker for BrBL1, a bolting resistance gene in Chinese cabbage
[0057] A G / CSNP variant exists at position 5,544,261 bp on chromosome A02 (2.6-6.9 Mb) of BrBL1 (Brapa_Chiifu_V1.5 reference gene), as shown below. A G / C SNP variant exists at position 101. The base is G in bolt-resistant materials and C in bolt-prone materials. This variant is called SNP marker A02-5544261.
[0058] CTATCAAGAACTTCATATGGTATGCCCAACTCTTTTCTTTCTTTCTTG AGTTTATAAAAAACAAGATTTAGTTTATTCATCTGCTCTACTTGTTTCTG[G / C]AAGACTGGATCTAAGGGAATCACTCAGGATTTTTCTTGTTGTTCTCACCC TGATCTGTTCTCACAACTCAAAAGACCTGAAAAATAGTTAACTTGTCCCT.
[0059] The KASP marker BrBL1-K1 was designed for this SNP marker A02-5544261, consisting of three primers:
[0060] BrBL1-K1Fa:5'- GAAGGTGACCAAGTTCATGCT ATCTGCTCTACTTGTTT CTGG-3'(SEQ IDNO.3);
[0061] BrBL1-K1Fb:5'- GAAGGTCGGAGTCAACGGATT ATCTGCTCTACTTGTTT CTGC-3'(SEQ IDNO.4);
[0062] BrBL1-K1R: 5'-CTGAGTGATTCCCTTAGATCCAGTC-3' (SEQ ID NO. 5).
[0063] BrBL1-K1Fa and BrBL1-K1Fb are two allele-specific forward primers. BrBL1-K1Fa is the specific primer for the bolting-resistant genotype, and BrBL1-K1Fb is the specific primer for the bolting-prone genotype. FAM and HEX fluorescent sequence tags (underlined portions) are added to the 5' end, respectively. BrBL1-K1R is a common reverse primer.
[0064] KASP-PCR was performed on a 96-well PCR instrument. The total reaction volume was 8 μL: 1.5 μL DNA (80 ng / μL), 4 μL KASP Master mix (2×), 0.14 μL primer mixture (obtained by mixing BrBL1-K1Fa, BrBL1-K1b, BrBL1-K1R with ddH2O at a volume ratio of 12:12:30:46 at a concentration of 100 μmol / L), and the remainder was made up with ddH2O.
[0065] The KASP-PCR amplification program is as follows: Stage 1: denaturation at 94℃ for 15 min; Stage 2: denaturation at 94℃ for 20 s, followed by annealing at 61℃ for 60 s, for a total of 10 cycles (starting from the second cycle, the temperature is reduced by 0.6℃ for each cycle); Stage 3: denaturation at 94℃ for 20 s, followed by annealing at 55℃ for 60 s, for a total of 26 cycles; Stage 4: denaturation at 37℃ for 1 min.
[0066] KASP-PCR amplification products were read using the endpoint method with a Roche LightCycler 480 Instrument II (LC480II) real-time PCR instrument.
[0067] SNP genotyping results were analyzed using LC480 software v1.5.1: Homozygous bolting-resistant materials showed blue signal spots, competitively amplified by primers linking the 5' end to the FAM fluorescent tag sequence, clustering near the X-axis; homozygous bolting-prone materials showed green signal spots, competitively amplified by primers linking the 5' end to the HEX fluorescent tag sequence, clustering near the Y-axis; heterozygous bolting-prone materials showed red signal spots, clustering near the diagonal. Figure 2 The BrBL1-K1 marker can significantly distinguish between two homozygous genotypes and can also identify heterozygous genotypes. It has the characteristics of a codominant marker and has been successfully developed.
[0068] Genotyping was performed on 172 individuals from the F2 population using the BrBL1-K1 marker. Homozygous bolting-resistant genotypes were denoted as 'a', homozygous bolting-prone genotypes as 'b', and heterozygous genotypes as 'h'. Results showed that 43 individuals had genotype 'a' with an average bolting height of 10.55 cm; 83 individuals had genotype 'h' with an average bolting height of 20.53 cm; and 43 individuals had genotype 'b' with an average bolting height of 26.28 cm. Figure 3 Analysis of variance showed that there was no difference between genotypes b and h in the bolting-prone material, while there was a highly significant difference between genotype a in the bolting-resistant material and genotypes (b and h) in the bolting-prone material. This indicates that the BrBL1-K1 marker genotype is highly correlated with the bolting trait, and can clearly identify bolting-prone and bolting-resistant materials. This method can be used for molecular-assisted breeding of bolting resistance in Chinese cabbage.
[0069] Example 2: Application of the KASP molecular marker BrBL1-K1
[0070] Twenty-four natural populations were selected, and the flowering time of each material was investigated (the flowering date minus the planting date). Individual DNA was extracted from the natural populations using the method described in section 1.2 (Genomic DNA Extraction) and stored for later use. The KASP marker BrBL1-K1 was used for validation within the natural populations.
[0071] The results showed that 133 materials with genotype a had an average flowering time of 74.50 days, while 121 materials with genotype b had an average flowering time of 70.11 days. Figure 4 The material with genotype a flowered on average 4.39 days later than the material with genotype b, showing a highly significant difference. The marker BrBL1-K1 has good universality and accuracy and can be used for marker-assisted selection of bolting resistance in Chinese cabbage.
[0072] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. The application of SNP molecular markers in the BrBL1 gene in detecting bolting traits in Chinese cabbage, characterized in that, The SNP molecular marker is the G / C allelic variant at position g.5544261 on chromosome A02 of the Chinese cabbage genome Brapa-Chiifu-V1.5, or the G / C allelic variant at position 101 bp at the 5' end of the sequence shown by the SNP molecular marker A02-5544261.
2. A KASP primer set for SNP molecular markers used to detect bolting traits in Chinese cabbage, characterized in that, The KASP primer set consists of the forward primer BrBL1-K1Fa (nucleotide sequence SEQ ID NO.3), the forward primer BrBL1-K1Fb (nucleotide sequence SEQ ID NO.4), and the reverse primer BrBL1-K1R (nucleotide sequence SEQ ID NO.5).
3. The KASP primer set according to claim 2, characterized in that, The 5' ends of the forward primers BrBL1-K1Fa and BrBL1-K1Fb are respectively connected to the FAM-tail universal fluorescent tag sequence and the HEX-tail universal fluorescent tag sequence.
4. A KASP primer set for SNP molecular markers used to detect bolting traits in Chinese cabbage, characterized in that, The KASP primer set has at least one of the following functions: (1) To identify or assist in the identification of bolting characteristics of Chinese cabbage; (2) Breeding of Chinese cabbage with bolting resistance; (3) Select Chinese cabbage varieties with bolting resistance.
5. A method for identifying or assisting in the identification of bolting characteristics in Chinese cabbage, characterized in that, The method includes: detecting the polymorphism or genotype of SNP molecular markers in the genome of the Chinese cabbage to be tested; The allelic variant of the SNP molecular marker is G / C, located at position g.5544261 on chromosome A02 in the Brapa-Chiifu-V1.5 genome of Chinese cabbage; or at position 101 bp at the 5' end of the sequence shown by the SNP molecular marker A02-5544261.
6. The method according to claim 5, characterized in that, The method specifically refers to the following: when the base at position g.5544261 on chromosome A02 in the Brapa-Chiifu-V1.5 genome of Chinese cabbage is G, or when the base at position 101 bp at the 5' end of the sequence shown in SEQ ID NO.1 is G, it is a bolting-resistant Chinese cabbage; When the base at position g.5544261 on chromosome A02 in the Brapa-Chiifu-V1.5 genome of Chinese cabbage is C, or at position 101 bp at the 5' end of the sequence shown in SEQ ID NO.2, it is a bolting Chinese cabbage.
7. A method for detecting bolting characteristics of Chinese cabbage, characterized in that, Includes the following steps: S1. Extract genomic DNA from Chinese cabbage; S2. Using Chinese cabbage genomic DNA as a template, a PCR reaction system was established using the KASP primer set described in claim 1 to perform PCR amplification and obtain PCR amplification products; S3. Read the fluorescence signal values of the PCR amplification products obtained in step S2 and analyze the SNP typing results.
8. The method according to claim 7, characterized in that, The PCR reaction system was 8 μL, comprising: 1.5 μL of Chinese cabbage genomic DNA (80 ng / μL), 4 μL of KASP Mastermix (2×), 0.14 μL of primer mixture, with the remainder made up with ddH2O; the primer mixture was prepared by mixing BrBL1-K1Fa, BrBL1-K1b, BrBL1-K1R and ddH2O at a volume ratio of 12:12:30:46 with a concentration of 100 μmol / L.
9. The method according to claim 7, characterized in that, The PCR amplification program is as follows: Stage 1: denaturation at 94℃ for 15 min; Stage 2: denaturation at 94℃ for 20 s, annealing at 61℃ for 60 s, for a total of 10 cycles, starting from the second cycle, each cycle is reduced by 0.6℃; Stage 3: denaturation at 94℃ for 20 s, annealing at 55℃ for 60 s, for a total of 26 cycles; Stage 4: 37℃ for 1 min.
10. The method according to claim 7, characterized in that, The reading of the fluorescence signal values includes: the signal point of homozygous bolting-resistant material a is blue; the signal point of homozygous bolting-prone material b is green; and the signal point of heterozygous bolting-prone material h is red.