Lactobacillus rhamnosus and application thereof

Abstract

The invention discloses a strain of lactobacillus muricatum and application thereof.The lactobacillus muricatum SZH025 obtained through the method has an obvious inhibiting effect on acinetobacter baumannii, klebsiella pneumoniae and escherichia coli under the in-vitro condition and is suitable for preventing and treating intestinal infectious diseases or adjusting intestinal flora; the cholate hydrolase (BSH) activity is remarkable, bile acid metabolism is facilitated, cholesterol excretion is promoted, and the blood fat reducing and regulating effects are achieved. In addition, the strain shows good safety characteristics, has relatively strong gastrointestinal tract environmental adaptability, has certain antioxidant function and ethanol decomposition capacity, is beneficial to alcohol metabolism, can produce oleic acid, and has potential probiotic effects of regulating lipid, resisting inflammation and improving the metabolic state of a host.

Description

Technical Field

[0001] This invention relates to the field of probiotics technology, and more specifically, to a strain of Lactobacillus murineis and its applications. Background Technology

[0002] Microorganisms are widely distributed in various microenvironments of the human body, including the skin, mouth, respiratory tract, and gastrointestinal tract, playing a vital role in maintaining host health and homeostasis. Probiotics are live microorganisms that, when ingested in sufficient quantities, can provide health benefits to the host. Currently, most probiotic research focuses on classic species such as Lactobacillus and Bifidobacterium; however, the human gut microbiota is rich in diversity and ecologically complex, and a large number of potentially beneficial probiotics have yet to be fully explored and utilized.

[0003] Lactobacillus murineis ( Ligilactobacillus murinus (Alternaria spp.), also known as *Lactobacillus assemblica*, is classified according to the latest classification system. Ligilactobacillus Although research on this genus is relatively limited, existing studies have shown that it has certain probiotic potential in alleviating enteritis, regulating intestinal flora structure, improving hyperglycemia and hyperlipidemia, enhancing intestinal barrier function, and fighting infection. Its bacteriocins, which have broad-spectrum antibacterial activity, can inhibit the growth of a variety of pathogens and have application prospects in food safety and human health intervention.

[0004] For example: CN120060074A discloses a strain of *Lactobacillus murineis* and its application in treating choline-tryptophan deficiency-induced non-alcoholic fatty liver disease; CN116970539A discloses a strain of *Lactobacillus murineis* that can inhibit weight gain caused by high-fat diet and has lipid-lowering function; CN116445326A discloses a strain of *Lactobacillus murineis* and its application, which can effectively inhibit *Klebsiella pneumoniae*, promote intestinal development in humans or animals, and improve the body's immunity; CN114561318A discloses a strain of *Lactobacillus murineis* that can effectively treat type II diabetes, significantly reduce the insulin resistance index, significantly improve glandular tissue pathological damage, and upregulate the expression of genes related to the insulin signaling pathway.

[0005] Acinetobacter baumannii ( Acinetobacter baumannii Klebsiella pneumoniae is a common clinical multidrug-resistant Gram-negative bacterium. Klebsiella pneumoniae ) and Escherichia coli ( Escherichia coli Lactobacillus is listed as a major pathogen causing hospital-acquired infections, and its drug resistance is becoming increasingly serious, becoming a focus of global public health concern. Therefore, developing natural probiotic strains with inhibitory activity against multidrug-resistant bacteria such as Acinetobacter baumannii has significant application value. Currently, there are no publicly available patent documents reporting that Lactobacillus murineis has an inhibitory effect on Acinetobacter baumannii.

[0006] Bile salt hydrolase (BSH, Bile Salt Hydrolase) is a key enzyme produced by intestinal microorganisms, which mainly functions to hydrolyze the glycine or taurine part in bile acids and convert it into free bile acids. It plays an important role in lipid metabolism, cholesterol homeostasis regulation and host-microorganism interaction, and is related to metabolic diseases such as obesity and diabetes. Strains with high bile salt hydrolase activity can play an active role in preventing and treating hyperlipidemia and related metabolic diseases. No Lactobacillus murinus strain with high bile salt hydrolase activity has been found. SUMMARY

[0007] The purpose of the present application is to overcome the shortcomings of the prior art and provide a Lactobacillus murinus and its application.

[0008] The first purpose of the present application is to provide a Lactobacillus murinus (Lactobacillus murinus) SZH025. Ligilactobacillus murinus )SZH025.

[0009] The second purpose of the present application is to provide a fermentation broth of the Lactobacillus murinus SZH025.

[0010] The third purpose of the present application is to provide the use of the Lactobacillus murinus SZH025 or the fermentation broth thereof in the preparation of a preparation with antioxidant function.

[0011] The fourth purpose of the present application is to provide the use of the Lactobacillus murinus SZH025 in the preparation of a microbial agent with ethanol degradation or alcoholism relieving function.

[0012] The fifth purpose of the present application is to provide the use of the Lactobacillus murinus SZH025 or the fermentation broth thereof in the preparation of a preparation with bacteriostatic or intestinal flora regulating function.

[0013] The sixth purpose of the present application is to provide the use of the Lactobacillus murinus SZH025 in the preparation of a microbial agent with lipid-lowering function.

[0014] The seventh purpose of the present application is to provide the use of the Lactobacillus murinus SZH025 in the preparation of a microbial agent with anti-inflammatory function.

[0015] The eighth purpose of the present application is to provide the use of the Lactobacillus murinus SZH025 in the preparation of a microbial agent with oleic acid synthesis function.

[0016] The ninth purpose of the present application is to provide the use of the Lactobacillus murinus SZH025 in the preparation of a microbial agent with bile salt hydrolase activity.

[0017] In order to achieve the above purposes, the present application is realized by the following technical solutions: The present application claims a Lactobacillus murinus (Lactobacillus murinus) SZH025. Ligilactobacillus murinusSZH025, which was preserved in Guangdong Microbial Culture Collection Center (GDMCC) on April 29, 2025, and the preservation number is GDMCC No:66241.

[0018] The present application also claims the fermentation liquor of the Lactobacillus murinus SZH025, which contains or does not contain bacterial cells.

[0019] The present application also claims the following applications: The application of the Lactobacillus murinus SZH025 or its fermentation liquor in the preparation of a preparation with antioxidant function.

[0020] Preferably, the preparation is a bacterial agent.

[0021] The application of the Lactobacillus murinus SZH025 in the preparation of a bacterial agent with the function of degrading ethanol or relieving alcoholism.

[0022] The application of the Lactobacillus murinus SZH025 or its fermentation liquor in the preparation of a preparation with the function of inhibiting bacteria or regulating intestinal flora.

[0023] Preferably, the bacteria are Escherichia coli, Klebsiella pneumoniae and / or Acinetobacter baumannii.

[0024] The application of the Lactobacillus murinus SZH025 in the preparation of a bacterial agent with the function of lowering blood lipids.

[0025] The application of the Lactobacillus murinus SZH025 in the preparation of a bacterial agent with the function of anti-inflammation.

[0026] The application of the Lactobacillus murinus SZH025 in the preparation of a bacterial agent with the function of synthesizing oleic acid.

[0027] The application of the Lactobacillus murinus SZH025 in the preparation of a bacterial agent with the activity of bile salt hydrolase.

[0028] Preferably, the bacterial agent or preparation is used to prepare a solid beverage, a health product with one or more of the following functions: helping to maintain the healthy level of blood lipids (cholesterol / triglyceride), helping to regulate intestinal flora, helping to control body fat, helping to resist oxidation and helping to enhance immunity; or a medicine with one or more of the following functions: lowering blood lipids, antibacterial, anti-inflammatory, antioxidant, degrading ethanol, relieving alcoholism, weight loss, preventing and treating intestinal infectious diseases.

[0029] Compared with the prior art, the present application has the following beneficial effects: The obtained Lactobacillus murinus SZH025 has obvious inhibiting effect on Acinetobacter baumannii, Klebsiella pneumoniae and Escherichia coli under in-vitro conditions, is suitable for preventing and treating intestinal infectious diseases or regulating intestinal flora; the bile salt hydrolase (BSH) activity of the strain is significant, which is helpful for bile acid metabolism and cholesterol excretion, and the strain has the effects of lowering blood lipid and regulating lipid. In addition, the strain has good safety characteristics, has strong adaptability to gastrointestinal environment, has certain antioxidant function and ethanol decomposition capacity, is helpful for ethanol metabolism, can produce oleic acid, and has potential effects of regulating lipid, resisting inflammation and improving metabolic state of a host. BRIEF DESCRIPTION OF DRAWINGS

[0030] Figure 1 It is a whole genome circle diagram of the Lactobacillus murinus SZH025.

[0031] Figure 2 It is a phylogenetic tree constructed by using the whole genome of the Lactobacillus murinus SZH025.

[0032] Figure 3 It is a hemolysis result of the Lactobacillus murinus SZH025 and hemolysis phenomenon of positive strains.

[0033] Figure 4 It is tolerance / sensitivity detection of the Lactobacillus murinus SZH025; A is OD 600 at different temperatures; B is viable bacterial concentration at different pH values; C is viable bacterial concentration at different NaCl concentrations; D is survival rate in simulated gastric juice at different pH values; E is survival rate at different bile salt concentrations; and F is survival rate in simulated intestinal juice at different pH values.

[0034] Figure 5 It is self-aggregation and co-aggregation results of the Lactobacillus murinus SZH025 and pathogenic bacteria.

[0035] Figure 6 It is DPPH free radical scavenging rate result of the Lactobacillus murinus SZH025.

[0036] Figure 7 It is ethanol degradation rate of the Lactobacillus murinus SZH025 at different ethanol concentrations.

[0037] Figure 8 It is bacteriostatic effect of the Lactobacillus murinus SZH025; A is inhibiting effect of the Lactobacillus murinus SZH025 supernatant on Acinetobacter baumannii; B is inhibiting effect of the Lactobacillus murinus SZH025 bacterial suspension on Acinetobacter baumannii; C is inhibiting effect of the Lactobacillus murinus SZH025 supernatant on Klebsiella pneumoniae; D is inhibiting effect of the Lactobacillus murinus SZH025 bacterial suspension on Klebsiella pneumoniae; and E is inhibiting effect of the Lactobacillus murinus SZH025 bacterial suspension of the application on Escherichia coli.

[0038] Figure 9The results of the quantitative bile salt hydrolase activity of Lactobacillus murinus SZH025 with cholic acid were obtained. DETAILED DESCRIPTION

[0039] The application will be further described in conjunction with the drawings of the specification and specific examples, which are only used to explain the application and are not used to limit the scope of the application. The test methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are commercially available reagents and materials unless otherwise specified.

[0040] Example 1 Isolation, screening and identification of Lactobacillus murinus SZH025 I. Experimental methods (1) Isolation and screening of Lactobacillus murinus SZH025 The feces of C57BL / 6 mice induced by high-fat diet were collected, the sample was added to sterile normal saline and shaken, 400 μL of the stock solution was added to 3.6 mL of sterile normal saline and shaken to make a 10 -1 dilution; the same operation was performed until the dilution reached 10 -2 , 10 -3 , 10 -4 , 10 -5 dilution gradient, 100 μL of the dilution was taken and uniformly coated on MRS agar plates, and cultured at 37°C for 24 h.

[0041] The characteristic colonies on the plates with the number of colonies between 30 and 300 were selected, a portion of the bacterial body was picked up with a sterile inoculation loop for Gram staining, and the strain morphology was observed under an optical microscope oil lens, and the strain shape, size, color, etc. were recorded. The Gram staining of lactic acid bacteria was positive, so the colonies with positive Gram staining and purity were retained.

[0042] The obtained pure colonies with positive Gram staining were picked up with a sterile inoculation loop, a drop of 3% hydrogen peroxide was added to the white ceramic reaction plate, and whether bubbles were generated was observed. If bubbles were generated, it was positive, and if no bubbles were generated, it was negative. Lactic acid bacteria were usually negative in the hydrogen peroxide enzyme experiment.

[0043] The obtained pure colonies with positive Gram staining and negative hydrogen peroxide enzyme experiment were picked up with a sterile inoculation loop, and the bacterial body was streaked on MRS agar plates and cultured at 37°C for 48 h.

[0044] A single colony SZH025 was obtained, the single colony was picked up in MRS liquid medium for expansion, the inoculation amount was 2%, and the culture was incubated at 37°C overnight. The bacterial liquid of overnight culture was transferred to a sterile freezing tube containing a protective liquid and preserved in a -80°C refrigerator.

[0045] (2) Lactobacillus murinus SZH025 strain identification The genomic DNA of the strain SHY0004 was extracted by a bacterial genome extraction kit, the upstream primer was 27F (AGAGTTTGATCCTGGCTCAG), the downstream primer was 1492R (TACGGCTACCTTGTTACGACTT), and the 16S rDNA sequence was amplified to obtain a PCR product. The PCR product was sequenced.

[0046] The PCR reaction system was as follows: PCR Mix 20 μL, 0.8 μL of the upstream and downstream primers, 2 μL of the DNA template, and 16.4 μL of ddH2O.

[0047] The PCR reaction conditions were as follows: 96℃ for 5 min; 96℃ for 30 s, 56℃ for 30 s, 72℃ for 1 min, 35 cycles; and 72℃ for 5 min.

[0048] The PCR product was detected by 1.0% agarose gel electrophoresis, and the band characteristics were observed. The PCR product was sent to Shengong Bioengineering Co., Ltd. for sequencing.

[0049] The bacterial precipitate was sent to Shenzhen Yibigene Co., Ltd. for whole genome sequencing. All the 70 strains of Lactobacillus murinus retrieved from the NCBI database were downloaded for whole genome sequencing, and Lactobacillus acidophilus was selected as the outgroup genome. First, the single-copy genes of all strains were found by GTDB-TK, then multiple sequence alignment was performed, and the phylogenetic tree was constructed by Fasttree software.

[0050] II. Experimental results The 16S rDNA sequence of the strain SZH025 was obtained by sequencing, and was identified as Lactobacillus murinus by NCBI-BLAST comparison, named Lactobacillus murinus (Lactobacillus murinus) SZH025, which was preserved in the Guangdong Microbial Culture Collection Center (GDMCC) on April 29, 2025, with the preservation number GDMCC No: 66241, and the classification name Lactobacillus murinus (Lactobacillus murinus). Ligilactobacillus murinus Ligilactobacillus murinus

[0051] The whole genome sequencing result showed that the whole genome of Lactobacillus murinus SZH025 consisted of a circular chromosome without plasmid. Figure 1 The phylogenetic tree analysis result showed that, L. murinus SZH025 was most closely related to the strains KD6 and 1-9. L. murinus Figure 2

[0052] Example 2: Antibiotic resistance evaluation of Lactobacillus murinus SZH025 ​​​​I. Experimental method Kirby-Bauer (K-B) disk diffusion method was used to evaluate the drug resistance of Lactobacillus murinus SZH025. 0.1 mL aliquot of Lactobacillus murinus SZH025 bacterial solution (about 1.0 x 10 8 CFU / mL) after activation was evenly smeared on the surface of sterilized and cooled solidified MRS agar medium. The antibiotic sensitive paper was pasted to the agar surface with sterile forceps, and placed at room temperature for 40 minutes, then inverted and cultured at 37 °C for 24 hours. The diameter of the inhibition zone was measured with a vernier caliper with an accuracy of 0.01 mm and recorded. Each antibiotic was tested in triplicate. The drug resistance judgment standard is based on the latest standard of drug sensitivity test paper published by the American Clinical and Laboratory Standards Association (CLSI) in 2015.

[0053] The following commonly used antibiotics were selected for antibiotic resistance analysis in this example: β-lactams (penicillin, ampicillin, piperacillin, cefalexin, cefazolin, ceftriaxone, cefradine, cefuroxime, cefoperazone, cefazidime), macrolides (erythromycin, midecamycin, clindamycin), tetracyclines (tetracycline, doxycycline, minocycline), quinolones (ciprofloxacin, ofloxacin), aminoglycosides (gentamicin, kanamycin), glycopeptides (vancomycin) and chloramphenicol.

[0054] Resistance Gene Identifier (RGI, Version 6.0.0), Comprehensive Antibiotic Resistance Database (CARD, Version 4.0.0), ResFinder (Version 4.0), AMRFinderPlus (Version 3.10.42) were used to search for the presence of antibiotic resistance genes in whole genome sequencing data.

[0055] II. Experimental results The results are shown in Table 1. Lactobacillus murinus SZH025 obtained in Example 1 has resistance to gentamicin, kanamycin and vancomycin, three aminoglycoside antibiotics. It has moderate sensitivity to cefradine, ceftazidime, clindamycin and ciprofloxacin. For all other tested antibiotics, the strain shows a clear inhibition zone, proving its sensitivity to most antibiotics (Table 1). Among them, S (Sensitive), sensitive; I (Intermediate), moderately sensitive; R (Resistant) resistant.

[0056] Table 1. Drug resistance of Lactobacillus murinus SZH025

[0057] Further genome-wide detection, no known resistance genes, good safety.

[0058] In lactic acid bacteria, resistance to aminoglycosides and vancomycin is usually intrinsic, usually due to reduced membrane permeability, efflux pumps or target site changes, rather than horizontally acquired genes. Since there are no plasmids and resistance genes, there is no possibility of horizontal gene transfer. These findings indicate the genomic and phenotypic safety of Lactobacillus murinus SZH025 obtained in Example 1 as a candidate probiotic.

[0059] Example 3 Hemolytic activity of Lactobacillus murinus SZH025 I. Experimental methods Lactic acid bacteria may produce hemolysin during metabolism to lyse red blood cells, leading to anemia and other diseases. Therefore, it is necessary to determine that there is no hemolysis.

[0060] Lactobacillus murinus SZH025 obtained in Example 1 was activated in MRS medium and cultured at 37°C for 15 hours. Staphylococcus aureus ATCC12598 was used as a positive control, and Lactobacillus murinus SZH025 obtained in Example 1 and Staphylococcus aureus ATCC12598 were inoculated with a loop onto Columbia blood agar plates, respectively, and cultured at 37°C for 24 hours. After confirming that there was no bacterial contamination, the colony morphology was observed and photographed, and the presence or absence of hemolytic rings was confirmed.

[0061] The genomic sequence was submitted to the VFDB database to search for virulence genes it carries.

[0062] II. Experimental results The results of the hemolysis experiment are shown in Figure 3 The positive control strain Staphylococcus aureus ATCC12598 showed a clear transparent hemolytic ring around the colony, while Lactobacillus murinus SZH025 obtained in Example 1 grew into a milky white colony with no hemolytic ring around it, and the result was negative. It can be initially confirmed that Lactobacillus murinus SZH025 obtained in Example 1 has no damage to blood cells.

[0063] The genomic sequence was submitted to the VFDB database, and no virulence factors were found, proving its good safety.

[0064] Example 4 Environmental condition tolerance (sensitivity) of Lactobacillus murinus SZH025 I. Temperature tolerance (sensitivity) 1. Experimental methods 100 μL of activated *Lactobacillus murineis* SZH025 bacterial culture obtained in Example 1 was inoculated into 5 mL of MRS broth medium and cultured at 4, 15, 30, 37, and 45 °C for 24 hours, respectively. OD values ​​were measured using a microplate reader. 600 The absorbance at a certain temperature was measured to investigate the growth of bacteria at different temperatures.

[0065] 2. Experimental Results The results are as follows Figure 4 As shown in Figure A, the *Lactobacillus murineis* SZH025 obtained in Example 1 exhibited the highest OD value (OD) at 37°C. 600 =1.04±0.02), then 30℃ (OD) 600 =0.87±0.01), the bacterial growth effect decreased at 4℃, 15℃ and 45℃.

[0066] II. pH tolerance (sensitivity) 1. Experimental Methods 100 μL of activated *Lactobacillus murineis* SZH025 bacterial culture obtained in Example 1 was placed in MRS at pH values ​​of 2.0, 3.0, 4.0, 5.0, 6.0, and without adjustment. After incubation at 37°C for 24 hours, the number of surviving bacteria was measured using a microbial cell counter.

[0067] 2. Experimental Results In the pH tolerance test, unadjusted MRS medium was used as the control group. Results are as follows: Figure 4 Figure B shows that the results indicate that the growth of *Lactobacillus murineis* SZH025 at pH=5 and pH=6 was not significantly different from the control group. While its growth was inhibited at pH 2, 3, and 4, the viable count still reached 10^6 at pH 3 and 4. 6 ~10 7 CFU / mL.

[0068] Therefore, it can be seen that the Lactobacillus murineis SZH025 obtained in Example 1 has strong acid resistance and can survive in the gastrointestinal environment and perform the function of probiotics.

[0069] III. NaCl Concentration Tolerance (Sensitivity) 1. Experimental Methods The activated *Lactobacillus murineis* SZH025 bacterial suspension obtained in Example 1 was centrifuged at 8000 rpm and 4°C for 10 min. The supernatant was discarded, and the bacterial pellet was collected, washed twice with PBS, and resuspended to a final volume of 1.0 × 10⁻⁶. 8CFU / mL. 100 μL of the resuspension was inoculated into 10 mL of MRS broth containing 0-10% NaCl (w / v), respectively. After 24 hours of incubation at 37°C, the number of viable bacteria was determined using a microbial cell counter.

[0070] 2. Experimental results Results as shown in Figure 4 C shows that after 24 hours of incubation of Lactobacillus murinus SZH025 obtained in Example 1 in MRS broth containing different concentrations of NaCl, the highest number of viable Lactobacillus murinus SZH025 obtained in Example 1 was observed in the 2% NaCl group, reaching (3.18 ± 0.05) x 10 8 CFU / mL, which was significantly higher than the control group without NaCl (p<0.05).

[0071] There was no significant difference in the number of viable Lactobacillus murinus SZH025 obtained in Example 1 between the 1%, 4% and 0% NaCl groups (p>0.05). Even under the condition of 6% NaCl, the number of viable Lactobacillus murinus SZH025 obtained in Example 1 remained at (1.01 ± 0.13) x 10 6 CFU / mL, indicating that Lactobacillus murinus SZH025 obtained in Example 1 had significant salt tolerance and could maintain viability under high osmotic pressure, which indicated that it was very suitable for survival in salt-rich environments such as fermented foods and the gastrointestinal tract.

[0072] Example 5 Evaluation of the tolerance of Lactobacillus murinus SZH025 to the digestive tract I. Experimental methods 1. Gastric and intestinal juice treatment The pH of human gastric juice is between 1.5 and 2.0, and after being diluted by food, it can usually reach 3.0-4.0, so pH=2.0, 3.0 and 4.0 were used to evaluate the tolerance of simulated gastric fluid (SGF).

[0073] Simulated gastric fluid (SGF) was prepared by dissolving 3 mg pepsin in 1 mL of 0.5% physiological saline (w / v) with pH of 2.0, 3.0 and 4.0, respectively.

[0074] Simulated intestinal fluid (SIF) includes primary simulated intestinal fluid (PSIF) and secondary simulated intestinal fluid (SSIF). PSIF is prepared from 1 mg / mL trypsin solution with pH 8.0, and SSIF is prepared by adding 0.03 g choline salt to 10 mL PSIF. The above solutions are filtered with a 0.22 μm filter.

[0075] The activated *Lactobacillus murineis* SZH025 obtained in Example 1 was added to SGF or SIF at a 10% inoculum, mixed for 60 seconds, and incubated at 37°C for 2 hours and 4 hours, respectively. The culture medium was then collected.

[0076] 2. Bile salt treatment Bile salts are sodium or potassium salts formed by the combination of bile acids secreted by hepatocytes and glycine or taurine. To evaluate the tolerance of *Lactobacillus murineis* SZH025 obtained in Example 1 to different concentrations of bile salts, 100 μL of *Lactobacillus murineis* SZH025 bacterial culture was inoculated into 10 mL of MRS broth containing 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% (w / v) bile salts. The cultures were incubated at 37 °C for 24 hours.

[0077] 3. Detection of surviving bacteria After all the above experiments, a microbial cell counter was used to measure the surviving bacteria and calculate the survival rate (%). Survival rate (%) = [Log CFU (N Final ) / (Log CFU (N Initial )] ×100%.

[0078] II. Experimental Results The results are as follows Figure 4 As shown in Figure D, after incubating the *Lactobacillus murineis* SZH025 obtained in Example 1 with SGF for 2 hours, the survival rates in SGF at pH 4.0 and 3.0 were 59.40 ± 2.15% and 37.86 ± 3.27%, respectively. In SGF at pH 4.0 and pH 3.0, the survival rates after 4 hours were 29.76 ± 1.76% and 6.20 ± 1.95%, respectively.

[0079] The results are as follows Figure 4 As shown in F, in the artificial intestinal fluid tolerance test, the survival rate of SZH025 did not differ significantly between PSIF and SSIF, with survival rates ranging from 99% to 103%, indicating that it has good adaptability to simulated intestinal fluid.

[0080] Results of bile salt tolerance, such as E.coil As shown in Figure E, the survival rates of *Lactobacillus murineis* SZH025 after 4 hours in MRS broth supplemented with 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% bile salts were 107.39±2.84%, 105.34±0.29%, 104.45±4.75%, 104.20±0.46%, and 101.89±0.64%, respectively. Compared with the initial value at 0 hours, the bacterial counts in all treatment groups increased slightly, indicating that the strain not only tolerated bile salt stress but also continued to proliferate under these conditions.

[0081] Example 6: Self-aggregation and co-aggregation ability of Lactobacillus murineis SZH025 I. Experimental Methods The ability of lactic acid bacteria to self-aggregate and co-aggregate reflects their ability to stably colonize the intestine and exert their effects.

[0082] The PBS resuspension of *Lactobacillus murineis* SZH025 obtained in Example 1 was left to stand at 25 °C for 10 hours to test its self-aggregation ability.

[0083] The *Lactobacillus murineis* SZH025 obtained in Example 1 and two indicator bacteria ( S.aureus 200109 and Figure 5 ATCC12598 was resuspended in PBS, and its bacterial concentration was detected using a microplate reader. After adjusting the absorbance at 600 nm to 0.5, the cultures were mixed at a 1:1 ratio (v / v) and resuspended, and then incubated at 25 °C for 10 hours. Oddi ratios were measured every hour. 600 The absorbance of the supernatant was measured.

[0084] Aggregation rate (%) = (1 - real-time OD) 600 / Initial OD 600 ) × 100% II. Experimental Results The results are as follows Figure 6 As shown, in the self-aggregation experiment, the self-aggregation rate of Lactobacillus murineis SZH025 obtained in Example 1 rapidly reached 83.63±2.17% within 2 hours, then slowly increased, and finally reached 90.83±0.43% within 10 hours.

[0085] In the co-aggregation experiment, when the *Lactobacillus murineis* SZH025 obtained in Example 1 co-aggregated with *Escherichia coli* 200109 or *Staphylococcus aureus* ATCC12598, the aggregation rates after 10 h were 44.48±0.70% and 73.18±4.03%, respectively.

[0086] It is evident that the *Lactobacillus murineis* SZH025 obtained in Example 1 exhibits outstanding self-aggregation and co-aggregation ability with pathogens, strong adhesion, and the ability to stably colonize the intestine.

[0087] Example 7 Antioxidant capacity of Lactobacillus murineis SZH025 I. Experimental Methods The antioxidant activity of *Lactobacillus murineis* SZH025 obtained in Example 1 was evaluated by assessing its DPPH free radical scavenging ability. DPPH (1,1-diphenyl-2-picrylhydrazine) used in the experiment is a stable free radical, and its scavenging rate reflects antioxidant capacity.

[0088] The operation steps are as follows: Prepare 0.2 mmol / L DPPH ethanol solution (diluted from 5 mmol / L DPPH stock solution with anhydrous ethanol), store in the dark, and prepare fresh each time; Resuspend the activated Lactobacillus murinus in Example 1 in PBS to obtain resuspensions of different concentrations (1 x 10 5 , 1 x 10 6 , 1 x 10 7 , and 1 x 10 8 CFU / mL) and cell-free supernatants (CFS), and mix 1 mL of each sample with 1 mL of DPPH solution; React at 30°C for 30 minutes in the dark; After the reaction is complete, centrifuge at 8000 rpm for 10 minutes, and measure the absorbance of the supernatant at a wavelength of 517 nm; the DPPH radical scavenging rate (%) = [1 - (A1- A2) / A3] x 100%, where A1 is the absorbance of the sample + DPPH + ethanol; A2 is the background absorbance of the sample + ethanol (without DPPH); and A3 is the blank control absorbance of DPPH + ethanol (without the sample).

[0089] II. Experimental Results The results are shown in Figure 7 When the concentration of viable cells reaches 1 x 10 7 and 1 x 10 8 CFU / mL, the clearance rate of the bacterial solution is 49.22 ± 2.79% and 77.66 ± 4.79%, respectively. The culture supernatant also shows strong antioxidant capacity (70.56 ± 3.74%).

[0090] The results show that both the cell components and the secreted metabolites of Lactobacillus murinus SZH025 obtained in Example 1 contribute to its antioxidant effect, and it has strong antioxidant capacity and is a functional probiotic.

[0091] Example 8: Alcohol metabolism capacity of Lactobacillus murinus SZH025 I. Experimental Methods The whole genome sequencing results of Lactobacillus murinus SZH025 obtained in Example 1 were analyzed, and it was found that the strain encodes multiple key enzymes related to alcohol metabolism, including four sites encoding ethanol dehydrogenase (EC:1.1.1.1) and one site encoding acetaldehyde / ethanol bifunctional dehydrogenase (adhE), indicating its ability to metabolize ethanol to acetaldehyde and then to acetic acid.

[0092] The ability of *Lactobacillus murineis* SZH025 obtained in Example 1 to degrade ethanol was determined using the potassium dichromate-sulfuric acid method: *Lactobacillus murineis* SZH025 obtained in Example 1 was inoculated into MRS liquid medium containing different volume fractions (4%, 6%, 8%) of ethanol and cultured at 37°C for 12 h and 24 h; MRS ethanol liquid medium without the strain was used as a control.

[0093] The residual ethanol content was determined using the potassium dichromate-sulfuric acid method. The difference between the initial ethanol and the remaining ethanol was the content of degraded ethanol, and the ratio of the ethanol difference to the initial ethanol was the ethanol degradation rate.

[0094] II. Experimental Results The results are as follows Escherichia coli As shown, the results indicate that this strain possesses a certain ethanol metabolism capacity. In fermentation systems with initial ethanol concentrations of 4%, 6%, and 8%, the ethanol degradation rates reached 11.73%, 17.16%, and 23.32%, respectively, after 24 hours of cultivation.

[0095] The results showed that the degradation rate gradually increased with the increase of the initial ethanol concentration, exhibiting a certain concentration dependence. This phenomenon may be related to the substrate-induced effect: higher concentrations of ethanol may enhance the expression or activity of enzymes related to ethanol metabolism (such as alcohol dehydrogenase and aldehyde dehydrogenase) in the strain, thereby improving the efficiency of ethanol metabolism and the rate of enzymatic reaction.

[0096] The results indicate that the *Lactobacillus murineis* SZH025 obtained in Example 1 has a certain ability to metabolize ethanol and has the function of assisting in ethanol metabolism and detoxification. It can be used to develop related functional probiotics or foods in the future.

[0097] Example 9: In vitro antibacterial activity of Lactobacillus murineis SZH025 I. Experimental Methods The antibacterial activity of *Lactobacillus murineis* SZH025 obtained in Example 1 against common pathogens was evaluated using the Oxford cup perforation method.

[0098] The tested pathogens included Escherichia coli. Klebsiella 200109, Klebsiella pneumoniae pneumoniae Acinetobacter baumannii ATCC 700603 and Acinetobacter baumannii Figure 8 ATCC 17978.

[0099] The above-mentioned pathogenic bacterial standard strains were cultured overnight on MRS medium, then centrifuged at 8000 rpm for 10 minutes at 4°C. After discarding the supernatant, the samples were washed twice with sterile PBS buffer and resuspended to 1.0 × 10⁻⁶. 8CFU / mL; the pathogenic bacteria standard strain bacterial suspension was uniformly coated on the surface of MRS agar plates; a sterile Oxford cup (6 mm in diameter) was vertically inserted into the agar surface to form a hole, 100 μL of the sample to be tested (the supernatant CFS and the resuspended bacterial liquid RSBC of Lactobacillus murinus SZH025 obtained in Example 1) was added into each hole; after the plates were incubated at 37°C for 12 hours, the diameter of the inhibition zone (unit: mm) was measured to evaluate the antibacterial effect.

[0100] II. Experimental results The results are shown in Figure 9 and Table 2, the results show that both CFS and RSBC exhibit similar antibacterial effects on the above-mentioned pathogenic bacteria, and there is no significant difference in the diameter of the inhibition zone, indicating that the bacterial metabolites of Lactobacillus murinus SZH025 obtained in Example 1 and the bacterial body itself both have certain antibacterial capacity.

[0101] Table 2 Diameter of inhibition zone (mm)

[0102] Example 10 Bile salt hydrolase activity of Lactobacillus murinus SZH025 I. Experimental method Bile salt hydrolase can decompose one molecule of glycocholic acid into one molecule of free cholic acid and one molecule of glycine, and the bile salt hydrolase activity (BSH) can be evaluated by determining the ability to convert conjugated cholic acid into free cholic acid. B420 strain is a commercially available strain with a hypolipidemic effect, which is used as a control.

[0103] The specific method is as follows: Lactobacillus murinus SZH025 obtained in Example 1 and commercially available animal bifidobacterium lactis subsp. B420 strain B420 were inoculated into MRS medium for continuous activation three times, and the seed liquid in the logarithmic phase after the third activation was inoculated into 5 mL of MRS liquid medium containing sodium glycocholate at a inoculation amount of 2%, and cultured at 37°C. At 12 h and 24 h of culture, samples were taken for determination of bacterial density and pH. 1 mL of fermentation broth at 0, 12 and 24 h was added with 10 μL of 6 M HCl to terminate the BSH activity. After ultrasonic crushing and centrifugation, the supernatant was filtered with a 0.22 μm filter membrane, 200 μL of the filtered liquid was added with 800 μL of pure methanol and stood for 5 min, vortexed for 5 min, ultrasonically treated for 5 min, and after centrifugation, 100 μL of the supernatant was taken and bottled for machine operation, and the amount of cholic acid generated was determined by LC-MS / MS.

[0104] Specific method of LC-MS / MS: The chromatographic column used was ACQUITY UPLC HSS C18 column (3.0 × 100 mm, 1.7 μm) of Waters Corporation of the United States; the mobile phase A was water containing 0.1% formic acid, and the mobile phase B was methanol containing 0.1% formic acid; the flow rate was 0.4 mL / min; the column temperature was 45°C; the injection volume was 1 μL; and the elution mode was gradient elution. The elution gradient was as follows: Table 3 Gradient elution mode

[0105] The high-resolution mass spectrometer used was QTRAP 6500+ of AB Sciex Corporation; the ion source used was electrospray ionization (ESI); the detection mode was negative ion mode acquisition; the scan mode was MRM; and the ion source temperature was 500°C.

[0106] II. Experimental results The results are shown in Table 2. ​ As shown in Table 2, after 24 hours of culture, the concentration of cholic acid produced by Lactobacillus murinus SZH025 obtained in Example 1 was 7.20 ± 1.28 -07 μg / mL, which was about seven times higher than that of the reference strain B420. The presence and expression activity of cholate hydrolase are currently recognized mechanisms for reducing blood lipid levels, and therefore the above results show that Lactobacillus murinus SZH025 has certain ability to reduce blood lipids.

[0107] Example 11 Ability of Lactobacillus murinus SZH025 to synthesize oleic acid I. Experimental method Oleic acid is a monounsaturated fatty acid with biological activity and is widely recognized for its physiological functions such as reducing serum cholesterol and triglyceride levels, inhibiting the expression of inflammatory factors, etc. The ability of Lactobacillus murinus SZH025 obtained in Example 1 to produce oleic acid (C18:1) was detected to evaluate its potential in reducing blood lipids and anti-inflammation.

[0108] The specific method is as follows: Lactobacillus murinus SZH025 obtained in Example 1 was inoculated into MRS culture medium for continuous activation three times, and the seed liquid in the logarithmic phase after the third activation was inoculated into MRS liquid culture medium at a rate of 2%, and cultured at 37°C. 1 mL of fermentation broth was taken at 12 h of culture. After centrifugation of the fermentation broth, the supernatant was discarded, the bacterial cells were resuspended with 1 mL of PBS, and then broken, and centrifuged again. The supernatant was filtered with a 0.22 μm filter membrane and used for sample preparation. To exclude the interference of the blank culture medium, sterilized blank MRS liquid culture medium was used as a control.

[0109] Take 100 μL sample in 1.5 mL EP tube, add 200 μL methanol, 50 μL 36% phosphoric acid, 200 μL primary water and 200 μL methyl tert-butyl ether, shake, centrifuge, take the supernatant and repeat extraction for 2 times, combine the two extraction liquids, dry by nitrogen, add 400 μL 14% BF3-methanol for methyl esterification, add 200 μL saturated NaCl solution and 500 μL n-hexane and vortex for 1 min, centrifuge (20000 r / min, 15 min), take the upper liquid to the sample vial for GC-MS / MS detection and analysis.

[0110] GC-MS / MS method: chromatographic column: TR-FAME (100 m x 0.25 mm, 0.2 μm); sample size: 1 μL; carrier gas: helium; injection port temperature: 250 ℃; acquisition mode: EI source, multiple reaction monitoring mode (MRM). Ion source conditions: electron impact ion source (EI), ion source temperature 250 ℃, chromatography-mass spectrometry interface temperature 260 ℃, detection voltage 0.8 kv.

[0111] II. Experimental results The results show that the intracellular oleic acid synthesis amount of Lactobacillus murinus SZH025 obtained in Example 1 is 63.75±3.88 μg / mL, and the blank MRS medium contains 29.45±2.08 μg / mL oleic acid, and the oleic acid content is significantly increased. The results show that Lactobacillus murinus SZH025 obtained in Example 1 can synthesize and secrete oleic acid under in vitro conditions, suggesting that it has key enzyme activity of unsaturated fatty acid biosynthesis pathway. The ability of SZH025 to synthesize oleic acid may be an important metabolic basis for its multiple probiotic functions, and also indicates that it has the ability to develop as a lipid-lowering and anti-inflammatory functional food or health preparation.

Claims

1. A strain of Lactobacillus murineis ( Ligilactobacillus murinus SZH025, characterized in that, This strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on April 29, 2025, with accession number GDMCC No: 66241.

2. The fermentation broth of Lactobacillus murineis SZH025 according to claim 1, wherein the fermentation broth may or may not contain bacterial cells.

3. The use of Lactobacillus murineis SZH025 or its fermentation broth as described in claim 1 in the preparation of formulations with antioxidant functions.

4. The application of Lactobacillus murineis SZH025 as described in claim 1 in the preparation of a bacterial agent with the function of degrading ethanol or relieving alcohol intoxication.

5. The use of Lactobacillus murineis SZH025 or its fermentation broth as described in claim 1 in the preparation of preparations with antibacterial or intestinal flora regulating functions.

6. The application according to claim 5, characterized in that, The antibacterial effect is to inhibit Escherichia coli, Klebsiella pneumoniae, and / or Acinetobacter baumannii.

7. The application of the Lactobacillus murineis SZH025 according to claim 1 in the preparation of a bacterial agent with lipid-lowering function.

8. The application of Lactobacillus murineis SZH025 as described in claim 1 in the preparation of bacterial agents with anti-inflammatory functions.

9. The application of Lactobacillus murineis SZH025 as described in claim 1 in the preparation of a bacterial agent with oleic acid synthesis function.

10. The use of Lactobacillus murineis SZH025 according to claim 1 in the preparation of a bacterial agent with bile salt hydrolase activity.

Images