A healthy human umbilical cord blood-derived immortalized nk cell line sz093 and a preparation method and application thereof
By isolating and constructing the immortalized NK cell line SZ093 from umbilical cord blood of healthy individuals and using immortalized lentivirus infection, the problem of limited expansion of umbilical cord blood NK cells was solved, achieving high efficiency proliferation and high killing capacity in long-term culture, which is suitable for the preparation of anti-tumor drugs.
Patent Information
- Application Number
- CN202511535098.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-27
- Publication Date
- 2026-05-29
- Estimated Expiration
- 2045-10-27
AI Technical Summary
Existing NK cells derived from umbilical cord blood have limited expansion potential in vitro and are prone to functional decline with prolonged culture time, making it difficult to meet the quantity and functional requirements of large-scale, standardized treatment.
Mononuclear cells were isolated from umbilical cord blood from healthy individuals, and after activation, amplification, and culture, NK cells were infected with immortalized lentiviruses to construct the immortalized NK cell line SZ093. The cells were then cultured for a long period using specific culture media and activating factors.
The immortalized NK cell line SZ093 maintains good proliferation capacity and high survival rate during long-term culture, and has a high killing ability against tumor cells, making it suitable for the preparation of anti-tumor drugs.
Smart Images

Figure CN121022754B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of immortalized cell technology, specifically to an immortalized NK cell line SZ093 derived from umbilical cord blood of healthy individuals, its preparation method, and its application. Background Technology
[0002] Natural killer cells (NK cells) are not only involved in anti-tumor, anti-viral infection, and immune regulation, but also participate in hypersensitivity reactions and the development of autoimmune diseases in certain situations. Unlike traditional T cells and other immune cells that require recognition of specific antigens to activate, NK cells inherently possess the ability to recognize and rapidly eliminate abnormal cells, such as cancer cells and virus-infected cells. NK cells can directly recognize and kill malignant cells or virus-infected cells by releasing cytotoxic substances such as perforin and granzymes, and by expressing death receptor ligands (such as FasL and TRAIL). In addition, NK cells can regulate adaptive immune responses by secreting various cytokines (such as interferon-γ) and chemokines. These unique biological characteristics make NK cells a promising candidate for immunotherapy, especially for the treatment of malignant tumors, and have become one of the current hot topics in biomedical research and development.
[0003] Currently, NK cells commonly used in clinical research or trials are mainly derived from peripheral blood, umbilical cord blood, induced pluripotent stem cells, or NK cell lines. While umbilical cord blood is a potential source of NK cells, and although it has relatively low immunogenicity and is abundant, primary umbilical cord blood NK cells suffer from limited expansion in vitro and are prone to functional decline (e.g., decreased ability to kill tumor cells) with prolonged culture time. This makes it difficult to meet the stringent requirements for NK cell quantity and function in large-scale, standardized treatment. Therefore, there is an urgent need to find an NK cell line that can proliferate indefinitely, maintain good proliferative capacity and high survival rate during long-term culture, and possess high tumor cell killing ability. Summary of the Invention
[0004] To address the limitations of existing NK cells derived from umbilical cord blood in vitro, which exhibit limited expansion and functional decline with prolonged culture time, this invention provides an immortalized NK cell line SZ093 derived from healthy human umbilical cord blood, along with its preparation method and applications.
[0005] According to a first aspect of the present invention, an immortalized NK cell line SZ093 derived from umbilical cord blood of a healthy human is provided, which was deposited at the Guangdong Provincial Center for Microbial Culture Collection on September 26, 2025, with accession number GDMCC No: 67036.
[0006] Cell immortalization refers to the process by which cultured cells escape the crisis of proliferation and aging due to their own changes or the influence of external conditions, thereby gaining unlimited proliferative capacity. The probability of spontaneous cell immortalization is very low. The construction of immortalized cell lines mainly adopts exogenous induction methods, including chemical substances, radiation mutagenesis, viral infection, telomerase activation, etc.
[0007] The inventors of this application isolated human cord blood mononuclear cells (CBMCs) from the cord blood of healthy individuals. After activation, expansion, and culture, the CBMCs were differentiated into NK cells. These NK cells were then infected with an immortalized lentivirus and cultured for an extended period until significant cell growth was observed, resulting in a new immortalized NK cell line, namely the SZ093 immortalized NK cell line derived from healthy human cord blood provided by this invention. The SZ093 immortalized NK cell line derived from healthy human cord blood provided by this invention maintains good proliferative capacity and high survival rate even during long-term culture (over one year), and exhibits high killing ability against tumor cells.
[0008] According to a second aspect of the present invention, a method for preparing the immortalized NK cell line SZ093 derived from the umbilical cord blood of healthy individuals is provided, comprising the following steps:
[0009] S1. Human cord blood mononuclear cells were isolated from umbilical cord blood of healthy individuals;
[0010] S2. Human umbilical cord blood mononuclear cells were cultured in activating medium for 3-6 days, then activating medium was added to the culture system and cultured for another 4-6 days. Then, amplification medium was added to the culture system and cultured for another 2-4 days to obtain human umbilical cord blood NK cells.
[0011] S3. Human umbilical cord blood NK cells were infected with immortalized lentivirus and cultured to obtain the immortalized NK cell line SZ093.
[0012] Preferably, in S2, the activation medium contains the following components: 5-15 vol% plasma, activating factor, and serum-free medium;
[0013] The activation medium contains the following components: 5-15 vol% plasma, activating factor, and serum-free medium;
[0014] The amplification medium contains the following components: amplification factor and serum-free medium;
[0015] The activating factor contains at least one of IL-1α, IL-2, IL-3, IL-7, IL-12, IL-15, IL-18, IL-21, FLT3 Ligand, stem cell growth factor (SCF), anti-human CD16 monoclonal antibody, and anti-human CD56 monoclonal antibody;
[0016] The activating factor contains at least one of IL-1α, IL-2, IL-3, IL-7, IL-12, IL-15, IL-18, IL-21, FLT3 Ligand, and SCF;
[0017] The amplification factor contains at least one of IL-2, IL-15, and IL-21.
[0018] Preferably, the activation medium contains the following components: 5-15 vol% plasma, serum-free medium, 100-1200 U / mL IL-2, 8-12 ng / mL IL-12, 3-7 ng / mL IL-15, 40-60 ng / mL IL-18, 5-15 ng / mL FLT3Ligand, 40-60 ng / mL SCF, and 500-2200 ng / mL anti-human CD16 monoclonal antibody;
[0019] The activation medium contains the following components: 5-15 vol% plasma, serum-free medium, 100-1200 U / mL IL-2, 8-12 ng / mL IL-12, 3-7 ng / mL IL-15, 40-60 ng / mL IL-18, 5-15 ng / mL FLT3 Ligand, and 40-60 ng / mL SCF;
[0020] The amplification medium contains the following components: serum-free medium and 100~1200 U / mL IL-2.
[0021] Preferably, the serum-free culture medium contains the following components: 1-10 mM amino acids, 0.5-150 mg / L vitamins, 0.1-50 μg / L inorganic salts, and basal culture medium;
[0022] The amino acid contains at least one of L-glutamine, alanyl-glutamine, glycyl-glutamine, alanyl-alanine, L-glutamine, and L-alanylamine.
[0023] Vitamins contain at least one of the following: nicotinamide, para-aminobenzoic acid, pyridoxine hydrochloride, folic acid, riboflavin, inositol, thiamine, biotin, and cyanocobalamin.
[0024] The inorganic salt contains at least one of manganese chloride, manganese sulfate, zinc chloride, copper sulfate, sodium selenate, ammonium molybdate, sodium vanadate, sodium selenite, and sodium selenate.
[0025] Preferably, the serum-free culture medium further contains the following components: 0.01~0.1 mg / L nucleotides, 0.00001~10 g / L first additive, 0.0005~50 g / L second additive, 0.01~30 mg / L lipids, and 20~1000 mg / L nonionic surfactants.
[0026] Nucleotides contain at least one of the following: adenosine 5'-triphosphate disodium salt hydrate, guanosine 5'-triphosphate trisodium salt, cytidine 5'-triphosphate disodium salt, uridine 5'-triphosphate trisodium salt, adenosine 5'-monophosphate, and deoxyadenosine 5'-triphosphate.
[0027] The first additive contains at least one of sulfur-containing organic compounds, cell protectants, and antioxidants. The sulfur-containing organic compounds contain at least one of taurine, cysteine, and thioglycerol. The cell protectants contain at least one of ethanolamine, ascorbic acid, and ascorbic acid-2-phosphate. The antioxidants contain at least one of reduced glutathione, β-mercaptoethanol, dithiothreitol, tocopheryl acetate, and butylated hydroxytoluene.
[0028] The second additive contains at least one of the following: human serum albumin, recombinant human serum albumin, bovine serum albumin, polysucrose-70, polyvinyl alcohol, recombinant human insulin, recombinant human insulin-like growth factor-1, human long-R3 insulin-like growth factor (Long-R3-IGF-1), recombinant human fibroblast growth factor-2, recombinant human epidermal growth factor, recombinant human platelet-derived growth factor-BB, and recombinant human transferrin.
[0029] Lipids contain at least one of unsaturated fatty acids, saturated fatty acids, and sterols. Unsaturated fatty acids contain at least one of linoleic acid, linolenic acid, arachidonic acid, oleic acid, palmitoleic acid, eicosapentaenoic acid, and docosahexaenoic acid. Saturated fatty acids contain at least one of palmitic acid, stearic acid, myristic acid, lauric acid, capric acid, and caprylic acid. Sterols contain at least one of stigmasterol, cholesterol, β-sitosterol, lanosterol, and 7-dehydrocholesterol.
[0030] The nonionic surfactant contains at least one of Tween 20, Tween 80, poloxamer 188, poloxamer 407, and polyoxyethylene lauryl ether.
[0031] Preferably, the basal culture medium contains at least one of Ham's F-12 medium, IMDM medium, alpha MEM medium, and RPMI 1640 medium.
[0032] Using activation medium, amplification medium and amplification medium containing the above components to culture CBMCs can induce the differentiation of NK cells in an activated state from CBMCs, and the number of NK cells obtained is large, which provides a basis for the subsequent preparation of immortalized NK cell lines.
[0033] Preferably, in S3, the immortalized lentivirus is constructed through the following steps:
[0034] Step 1: Integrate nucleic acid molecules into a vector to construct the target plasmid, wherein the nucleotide sequence of the nucleic acid molecule is selected from at least one of SEQ ID NO:1~3;
[0035] Step 2: The target plasmid is mixed with the lentiviral packaging plasmid to obtain a plasmid mixture. The lentiviral packaging plasmid contains pLP1 plasmid, pLP2 plasmid, and BaEV-pMD2G plasmid (pMD2G plasmid packaged with BaEV retrovirus). The mass ratio of the target plasmid, pLP1 plasmid, pLP2 plasmid, and BaEV-pMD2G plasmid is 3.7: 2.6: 2.1: 5.2.
[0036] Step 3: Mix the transfection reagent containing polyethyleneimine with the plasmid mixture to obtain a mixed solution;
[0037] Step 4: Mix the mixed solution with HEK 293T cells and culture them. Collect the culture supernatant and isolate the immortalized lentivirus from the culture supernatant.
[0038] Immortalized lentiviruses were obtained by transfecting HEK 293T cells with a lentivirus transfection system containing the target gene and culturing them. NK cells induced from CBMCs were then infected with these immortalized lentiviruses and cultured for an extended period to obtain a new immortalized NK cell line, namely the SZ093 immortalized NK cell line derived from healthy human umbilical cord blood provided by this invention. The SZ093 immortalized NK cell line maintained good proliferation capacity and high survival rate during long-term culture.
[0039] According to a third aspect of the present invention, the application of the immortalized NK cell line SZ093 derived from the above-mentioned healthy human umbilical cord blood or the immortalized NK cell line SZ093 derived from the above-mentioned healthy human umbilical cord blood prepared by the preparation method of the above-mentioned healthy human umbilical cord blood derived NK cell line SZ093 in the preparation of antitumor drugs is provided.
[0040] According to a fourth aspect of the present invention, an antitumor pharmaceutical composition is provided, the antitumor pharmaceutical composition comprising the above-mentioned immortalized NK cell line SZ093 derived from healthy human umbilical cord blood, or the immortalized NK cell line SZ093 derived from healthy human umbilical cord blood prepared by the above-mentioned method for preparing the immortalized NK cell line SZ093 derived from healthy human umbilical cord blood, or a CAR NK cell constructed by gene editing based on the above-mentioned immortalized NK cell line SZ093 derived from healthy human umbilical cord blood.
[0041] The immortalized NK cell line SZ093 provided by this invention has a high killing ability against tumor cells. When applied to the preparation of anti-tumor drugs, the resulting anti-tumor drugs have a strong killing ability against tumor cells and have broad application prospects in the clinical treatment of tumors. Furthermore, the immortalized NK cell line SZ093 provided by this invention has good safety and will not pose a risk of tumorigenesis during clinical application. Attached Figure Description
[0042] Figure 1 The figure shows the results of observing the state of NK cells during the preparation step (3) of the immortalized NK cell line SZ093 derived from umbilical cord blood of healthy individuals in Example 1, specifically during the culture process of NK cells infected with immortalized lentivirus.
[0043] Figure 2 The image shows the cell cycle detection results during the long-term culture of the immortalized NK cell line SZ093, as shown in Test Example 1.
[0044] Figure 3 STR typing profile of immortalized NK cell line SZ093 derived from umbilical cord blood of healthy individuals, provided for test example 2.
[0045] Figure 4 The results of the detection of surface markers CD3 / CD56, CD16, and NKG2D in the immortalized NK cell line SZ093 provided for test example 3 are shown in the figure.
[0046] Figure 5 The soft agar tumorigenesis test results of the immortalized NK cell line SZ093 provided for test example 6. Detailed Implementation
[0047] The technical features of the technical solution provided by the present invention will be further clearly and completely described below with reference to specific embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0048] Example 1
[0049] A method for preparing an immortalized NK cell line SZ093 derived from umbilical cord blood of healthy individuals, comprising the following steps:
[0050] (1) Human cord blood mononuclear cells (CBMCs) were isolated from umbilical cord blood of healthy individuals by density gradient centrifugation and added to cryopreservation tubes at a rate of 1 mL / tube;
[0051] (2) After thawing the frozen CBMCs, centrifuge at 300 g for 5 minutes, discard the supernatant to obtain the cell pellet, resuspend the cell pellet in activation medium, take samples for trypan blue staining and counting, and then add activation medium to adjust the cell density to 1.2 × 10⁻⁶ cells / year. 6 Cells were cultured at a density of 100 viable cells / mL for 3 days, with activation medium added every 2 days. After 4 days of culture in activation medium, samples were taken, stained with trypan blue, and counted. The cell density was then adjusted to 1×10⁶ cells / mL using activation medium. 6 1 live cells / mL were seeded into a culture flask and cultured for 2 days. After adding expansion medium, the cells were transferred back to the incubator and cultured for 2 days. After adding 5 mL of expansion medium, the cells were transferred back to the incubator and cultured for 1 day to obtain a culture medium containing NK cells.
[0052] The activation medium contained the following components: 10 vol% plasma, 1000 U / mL IL-2, 10 ng / mL IL-12, 5 ng / mL IL-15, 50 ng / mL IL-18, 10 ng / mL FLT3 Ligand, 50 ng / mL SCF, 2000 ng / mL anti-human CD16 monoclonal antibody, and serum-free medium.
[0053] The activation medium contained the following components: 5 vol% plasma, 1000 U / mL IL-2, 10 ng / mL IL-12, 5 ng / mL IL-15, 50 ng / mL IL-18, 10 ng / mL FLT3 Ligand, 50 ng / mL SCF, and serum-free medium.
[0054] The amplification medium contained the following components: 1000 U / mL IL-2, serum-free medium;
[0055] The serum-free culture medium contained the following components: 2 mM alanine-glutamine, 2.5 mg / mL human serum albumin, 39 μL / L thioglycerol, 0.55 mg / L recombinant human transferrin, 1 mg / L recombinant human insulin, 0.0005 mg / L sodium selenite, 0.091 mg / L adenosine triphosphate disodium hydrate, 8.8 mg / L folic acid, and basal medium.
[0056] The basal culture medium was prepared by mixing Ham's F-12 medium, IMDM medium, and alpha MEM medium in a volume ratio of 43.6:43.9:8.8.
[0057] (3) Add umbilical cord blood NK cells to 12-well plates at a rate of 400,000 cells / well and incubate overnight. Preheat the plates using a constant temperature centrifuge beforehand. Remove the 12-well plates from the incubator, discard some of the supernatant, add immortalized lentivirus to the plates at a multiplicity of infection (MOI) of 33, and add amplification medium to a total volume of 3 mL. Centrifuge the plates and transfer them back to the incubator for another day. Discard most of the supernatant, add fresh amplification medium, and incubate for another day. Discard some of the medium, add fresh amplification medium, and continue incubating. Perform half-medium replacement every 2-3 days and continuously observe the status of lentivirus-infected cells. Continue culturing until significant cell growth is observed to obtain an immortalized NK cell line derived from healthy human umbilical cord blood, which will be named SZ093 and classified as follows: Homo sapiens SZ093 cells The immortalized NK cell line SZ093 derived from the umbilical cord blood of a healthy person was deposited at the Guangdong Provincial Center for Microbial Culture Collection on September 26, 2025. The deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, with accession number GDMCC No: 67036.
[0058] The immortalized lentivirus is constructed through the following steps:
[0059] Step 1: Resuscitate one tube of HEK 293T cells, centrifuge at 300g for 5 minutes, discard the supernatant, resuspend the cell pellet in 10 mL of HEK 293 serum-free medium, seed the cell suspension into a culture flask, add HEK 293 serum-free medium to 35 mL, transfer the culture flask to an incubator and culture for 3 days. Remove the culture flask, discard the culture supernatant, wash once with HEK 293 serum-free medium, and passage the cells evenly into 3 culture flasks, adding HEK 293 serum-free medium to 35 mL in each flask. Transfer the culture flasks to an incubator and culture for 3 days. Remove the culture flask, discard the culture supernatant, wash once with HEK 293 serum-free medium, and passage the cells evenly into 7 culture flasks, adding HEK 293 serum-free medium to 30 mL in each flask. Transfer the culture flasks to an incubator and culture overnight to obtain HEK 293T cells.
[0060] Step 2: Integrate the three nucleic acid molecules with nucleotide sequences as shown in SEQ ID NO:1, 2, and 3 into the vector to construct three target plasmids;
[0061] Step 3: Mix the three target plasmids with the lentiviral packaging plasmid to obtain a plasmid mixture. The lentiviral packaging plasmid contains pLP1 plasmid, pLP2 plasmid, and BaEV-pMD2G plasmid. The mass ratio of the target plasmid, pLP1 plasmid, pLP2 plasmid, and BaEV-pMD2G plasmid is 3.7: 2.6: 2.1: 5.2.
[0062] Step 4: Mix the transfection reagent containing polyethyleneimine with the plasmid mixture to obtain a mixed solution;
[0063] Step 5: After mixing the mixed solution with HEK 293T cells, culture them and collect the culture supernatant. Centrifuge the collected culture supernatant containing lentiviral particles at 4℃ and 1000 g for 5 min (to remove cell debris). Collect the supernatant after centrifugation, filter it once through a 0.22 μm filter membrane, and then centrifuge it at 4℃ and 30000 rpm for 2 hours to concentrate the lentivirus before aliquoting and storing it.
[0064] SEQ ID NO:1
[0065]
[0066] SEQ ID NO:2
[0067]
[0068] SEQ ID NO:3
[0069] atgactgccatggaggagtcacagtcggatatcagcctcgagagagcgtgcccacctgcacaagcgcctctcccccgcaaaagaaaaaaccacttgatggagagtatttcaccctcaagatccgcgggcgtaaacgcttcgagatgttccgga gctgaatgaggccttagagttaaaggatgcccatgctacagaggagtctggagacagcagggctcactccagctacctgaagaccaagaagggccagctacttcccgccataaaaaaacaatggtcaagaaagtggggcctgactcagactga
[0070] Test Example 1
[0071] This test case aims to observe the NK cell status during the culture process of immortalized NK cell line SZ093 derived from healthy human umbilical cord blood in step (3) of Example 1, where NK cells were infected with immortalized lentivirus. The results are as follows: Figure 1 As shown, where, Figure 1 Figures A, B, and C show the cell status observation results of NK cells infected with immortalized lentivirus on days 1, 48, and 71, respectively. Figure 1 Figures D, E, F, and G show the cell status observation results of immortalized lentivirus-infected NK cells on days 90, 218, 375, and 464, respectively.
[0072] Depend on Figure 1 It can be seen that in step (3) of the preparation method provided in Example 1, the immortalization process of NK cells on days 1, 48, and 71 after infection with the immortalized lentivirus is still observed. No obvious growth phase was observed during this process, and the number of cells showed a gradual decreasing trend. Figure 1The immortalized NK cells were infected with lentivirus on days 90, 218, 375, and 464, which corresponds to the period after successful immortalization (i.e., the NK cells at this time are the immortalized NK cell line SZ093 obtained in Example 1). During this process, significant cell growth was observed. The number of cells on day 90 after immortalized lentivirus infection was significantly higher than that on day 71. Furthermore, the immortalized NK cells (i.e., the immortalized NK cell line SZ093 obtained in Example 1) remained in good condition on days 218, 375, and 464 after immortalized lentivirus infection and could continue to be cultured. This indicates that the immortalized NK cell line SZ093 can maintain good proliferation capacity and high survival rate during long-term (more than 1 year) culture.
[0073] Furthermore, this test case also detected the cell cycle of the immortalized NK cell line SZ093 derived from umbilical cord blood of healthy individuals obtained in Example 1. The proliferation or continuous passage ability of the immortalized NK cell line SZ093 was evaluated in conjunction with the above results. The results are as follows: Figure 2 As shown.
[0074] Depend on Figure 2 It can be seen that the 2N (G0 / G1) ratio of the cell cycle of the NK cell line SZ093 is 46.0%, which is much lower than the ratio of normal primary cells (70%-85%). This indicates that the G1 phase of the immortalized NK cell line SZ093 is significantly shortened and the density inhibition is weakened, with a large number of cells continuously in the growth and expansion cycle.
[0075] Furthermore, during the long-term culture of the immortalized NK cell line SZ093 derived from umbilical cord blood of healthy individuals, the immortalized NK cell line SZ093, cultured for more than one year, was still able to grow and proliferate normally.
[0076] The above results prove that the NK cell line SZ093 has achieved immortalization.
[0077] Test Example 2
[0078] STR loci consist of short tandem repeats of 3–7 base pairs in length. These repeats are widely distributed throughout the human genome, serving as highly polymorphic markers and can be detected by PCR (polymerase chain reaction). Alleles at STR loci can be distinguished by differences in the copy number of repeat sequences within the amplified region, and can be identified by fluorescence detection after separation by capillary electrophoresis. Subsequently, using specific calculation methods, the obtained STR typing results can be compared with a professional cell STR database to infer the cell line to which the sample belongs or the name of any potentially cross-contaminated cell lines.
[0079] This test case aims to identify the immortalized NK cell line SZ093 derived from healthy human umbilical cord blood obtained in Example 1 using STR typing technology, in order to determine whether it is contaminated by human cell lines and the names of cell lines that may be cross-contaminated. The specific experimental procedures are as follows: The whole genome DNA of the immortalized NK cell line SZ093 derived from healthy human umbilical cord blood was extracted using a genomic extraction kit. The extracted whole genome DNA sample was numbered as S25032820013. The DNA concentration was detected by QC using a micro UV-Vis spectrophotometer (Thermo Fisher NanoDrop 2000c). At the same time, multiplex amplification using IGE-STR20A (ABI9700 PCR System) was performed. Capillary electrophoresis and fragment separation were performed using an ABI3730XL genetic analyzer (ABI Corporation, USA), and genotyping was performed using GeneMapper® ID software (version: ID-X 1.5).
[0080] The STR typing profile of the immortalized NK cell line SZ093 derived from umbilical cord blood of healthy individuals obtained in Example 1 is as follows: Figure 3 As shown in Table 1, the STR genotyping results are as follows. Among them, 8 core STR loci (vWA, D7S820, CSF1PO, D16S539, TH01, D13S317, TPOX, D5S818) and 1 sex locus (Amelogenin) are required to be tested according to the US National Standard (ASN-0002-2011).
[0081] Table 1. STR genotyping results of immortalized NK cell line SZ093
[0082]
[0083] Depend on Figure 3 As shown in Table 1, after extracting the whole genome DNA (sample number S25032820013) of the immortalized NK cell line SZ093 derived from the umbilical cord blood of healthy humans obtained in Example 1, and testing S25032820013, it was found that no site among the 21 STR loci tested had more than two allele peaks. The above results indicate that the tested sample was not contaminated by human cell lines.
[0084] According to the US National Standard ASN-0002-2011, a cell line with a matching rate of not less than 80% may be the cell line to which the tested cell belongs, or a derivative of that cell line, or it may originate from the same donor as that cell line; a cell line with a matching rate of less than 56% is generally considered to be unrelated to the tested cell; and a cell line with a matching rate between 56% and 80% requires further study to confirm its identity.
[0085] This test case also compared the immortalized NK cell line SZ093 derived from umbilical cord blood of healthy individuals obtained in Example 1 with cell lines in the Aiji Bio Cell Line Identification Database. The results are shown in Table 2. Table 2 lists the five cell lines in the database with the highest percent match rate with the immortalized NK cell line SZ093.
[0086] Table 2. Comparison results of immortalized NK cell line SZ093 with the Aiji Biotechnology cell line identification database.
[0087]
[0088] As shown in Table 2, the immortalized NK cell line SZ093 derived from umbilical cord blood of healthy individuals obtained in Example 1 is not a cell line included in the database, nor is it included in any cell bank. It is a new NK cell line.
[0089] Test Example 3
[0090] This test case aims to use flow cytometry to detect surface markers (CD3 / CD56, CD16, NKG2D) of the immortalized NK cell line SZ093 derived from healthy human umbilical cord blood obtained in Example 1, in order to further verify the cell line to which the immortalized NK cell line SZ093 derived from healthy human umbilical cord blood obtained in Example 1 belongs. The detection results of the surface markers CD3 / CD56, CD16, and NKG2D of the immortalized NK cell line SZ093 are as follows: Figure 4 As shown, where, Figure 4 A is the flow cytometry detection result of CD3 / CD56. Figure 4 B is the flow cytometry detection result of CD16. Figure 4 C is the flow cytometry detection result of NKG2D.
[0091] Depend on Figure 4 It can be seen that the CD3+ of the immortalized NK cell line SZ093 derived from umbilical cord blood of healthy individuals... - CD56 + The positive rate was 97.8%, which met the classic immunophenotypic indicators of NK cells. The positive rates of CD16 and NKG2D were 93.9% and 95.9%, respectively, which were both high, indicating that the immortalized NK cell line SZ093 has a strong killing ability against tumor cells.
[0092] Test Example 4
[0093] NK cells synthesize and release large amounts of perforin and granzyme only after receiving activation signals. Therefore, high levels of these two molecules in the supernatant of NK cell culture are a sign that NK cells have been successfully activated.
[0094] This test case aims to detect the concentrations of perforin and granzyme secreted by the immortalized NK cell line SZ093 in the culture supernatant of the immortalized NK cell line SZ093 in step (3) of the preparation of the immortalized NK cell line SZ093 derived from umbilical cord blood of healthy human in Example 1. The results are shown in Table 3. The activation status of the immortalized NK cell line SZ093 was assessed by the secretion concentration levels of perforin and granzyme. The higher the secretion levels of perforin and granzyme in the culture supernatant, the more successfully the immortalized NK cell line SZ093 was activated and the stronger its killing ability against target cells.
[0095] Table 3. Results of perforin and granzyme concentration detection in culture supernatant
[0096]
[0097] As shown in Table 3, in step (3) of the preparation of the immortalized NK cell line SZ093 derived from umbilical cord blood of healthy individuals in Example 1, when NK cells were infected with immortalized lentivirus and cultured until significant cell growth was observed, the concentration of perforin in the culture supernatant was higher than that in the supernatant of resting primary human NK cells after 48 h of culture (2000-5000 pg / mL), and the concentration of granzyme was higher than that in the supernatant of resting primary human NK cells after 48 h of culture (<100 pg / mL). This indicates that the immortalized NK cell line SZ093 obtained in Example 1 was successfully activated and has a strong killing ability against target cells.
[0098] Test Example 5
[0099] This test case aims to investigate the killing ability of the immortalized NK cell line SZ093 derived from umbilical cord blood of healthy individuals obtained in Example 1 against different tumor cells (Huh-7 human liver cancer cells, OVCAR-3 human ovarian cancer cells, and HGC27 human gastric cancer cells). At the same time, NK cells obtained by culturing CBMC in step (2) of the preparation method provided in Example 1 through activation medium, activation medium, and amplification medium (i.e., NK cells before immortalization) were used as controls. The killing results of the immortalized NK cell line SZ093 and the NK cells before immortalization against different tumor cells are shown in Table 4.
[0100] Table 4. Killing effect of immortalized NK cell line SZ093 and pre-immortification NK cells on different tumor cells.
[0101]
[0102] As shown in Table 4, the immortalized NK cells exhibited a killing rate of only 53% against Huh-7 human liver cancer cells, while the immortalized NK cell line SZ093 obtained in Example 1 showed a killing rate as high as 98% against Huh-7 human liver cancer cells and 97% against OVCAR-3 human ovarian cancer cells. Furthermore, the immortalized NK cell line SZ093 also demonstrated a certain killing ability against HGC27 human gastric cancer cells. These results indicate that the immortalized NK cell line SZ093 derived from healthy human umbilical cord blood provided by this invention possesses strong killing ability against different tumor cells (especially human liver cancer cells and human ovarian cancer cells). It can be applied in the preparation of anti-tumor drugs, and the resulting anti-tumor drugs have strong killing ability against tumor cells, showing broad application prospects in the clinical treatment of tumors.
[0103] Test Example 6
[0104] This test case aims to investigate the safety of the immortalized NK cell line SZ093 derived from umbilical cord blood of healthy individuals obtained in Example 1. The specific experimental procedures are as follows: 0.6 wt% agarose was added to the amplification medium to prepare a bottom agarose layer containing the amplification medium with a final agarose concentration of 0.6 wt%. The layer was allowed to solidify at room temperature, and 1.0 × 10⁻⁶ cells were taken. 4 Immortalized NK cell line SZ093 was mixed with a top layer of agarose containing amplification medium and a final agarose concentration of 0.35 wt%, and then quickly added to the solidified bottom layer of agarose. The mixture was left to solidify at room temperature, and 1 mL of amplification medium was added to keep it moist. Every 7 days, 1 mL of supernatant was discarded, and 1 mL of fresh amplification medium was added. On day 21, photographs were taken to record and the number of colonies formed was calculated. The results are as follows: Figure 5 As shown.
[0105] Depend on Figure 5 The soft agar tumorigenesis test results of the immortalized NK cell line SZ093 showed that the immortalized NK cell line SZ093 did not form tumors. This indicates that the immortalized NK cell line SZ093 derived from healthy human umbilical cord blood provided by this invention has good safety and will not pose a risk of tumorigenesis during clinical application.
[0106] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention, but such modifications or substitutions are all within the scope of protection of the present invention.
Claims
1. An immortalized NK cell line SZ093 derived from umbilical cord blood of healthy humans was deposited at the Guangdong Provincial Center for Microbial Culture Collection on September 26, 2025, with accession number GDMCC No: 67036.
2. The application of the immortalized NK cell line SZ093 derived from healthy human umbilical cord blood as described in claim 1 in the preparation of antitumor drugs, characterized in that: The tumor includes at least one of liver cancer, ovarian cancer, and stomach cancer.
3. An antitumor drug composition, characterized in that: The antitumor drug composition contains the immortalized NK cell line SZ093 derived from the umbilical cord blood of healthy individuals as described in claim 1, or a CAR NK cell line constructed by gene editing based on the immortalized NK cell line SZ093 derived from the umbilical cord blood of healthy individuals as described in claim 1, wherein the tumor includes at least one of liver cancer, ovarian cancer, and gastric cancer.
Citation Information
Patent Citations
Conditional suicidal anti-tumor targeting immune cell and preparation method thereof
CN106867969A
Method for performing in-vitro activated amplification on human natural killer (NK) cells and special culture system thereof
CN108220235A