Streptomycin-resistant gene as well as encoding protein and application thereof

Abstract

The invention discloses an anti-streptomycin gene as well as an encoding protein and application thereof, and belongs to the technical field of phytopathology. The invention discloses a novel streptomycin resistance gene aphh (3) derived from tomato canker pathogen. The gene is located on a newly found plasmid pCM3 of tomato canker pathogen, and is used for coding a protein APH (3) belonging to an aminoglycoside antibiotic phosphotransferase family. The functions of the gene are verified through tests of gene knockout, function complementation, heterologous expression and the like, meanwhile, mass spectrometric analysis proves that APH (3) can catalyze streptomycin molecules to generate phosphorylation reaction to generate streptomycin monophosphate, so that the inhibitory activity on bacteria is lost, and a strain carrying the gene has remarkable resistance to streptomycin. The streptomycin resistance gene aphh (3) can be widely applied to the fields of pathogenic bacterium resistance mechanism research, resistance strain screening, molecular marker selection and the like, and has important scientific research and application values.

Description

Technical Field

[0001] This invention relates to the field of plant pathology, specifically to a streptomycin resistance gene, its encoded protein, and its applications. Background Technology

[0002] Streptomycin is an aminoglycoside antibiotic that was once widely used in agriculture to control various plant bacterial diseases; it is also used in human and veterinary medicine to inhibit bacterial infections. However, streptomycin resistance in pathogens is becoming increasingly prevalent, seriously affecting control effectiveness and exacerbating the spread of resistance genes in agricultural ecosystems and environmental microorganisms. The main mechanisms of streptomycin resistance include target mutations (such as...) rpsL The role of genes and antibiotic-modifying enzymes, the latter mainly consisting of phosphotransferases (APHs).

[0003] Bacterial canker of tomato is caused by the Gram-positive bacterium Corynebacterium micranthum (Bacillus miltiorrhiza). Claviabcter michiganensis Bacterial canker (BCC) is a typical seed-borne disease caused by infection, severely impacting tomato production. Due to the lack of commercially available resistant tomato varieties, control primarily relies on preventative measures such as seed treatment, and the application of chemical pesticides in the early stages of disease development to inhibit its spread. Recent field monitoring has identified streptomycin-resistant varieties... Claviabcter michiganensis The strain has been identified, but its molecular mechanism is not fully understood. Currently, there are no systematic reports on the phosphorylation-mediated streptomycin inactivation resistance mechanism in this bacterium. Summary of the Invention

[0004] To address the aforementioned shortcomings of existing technologies, the present invention aims to provide an anti-streptomycin gene, its encoded protein, and its applications, thereby providing a novel anti-streptomycin gene for research on pathogen resistance mechanisms, screening of resistant strains, and selection of molecular markers.

[0005] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: A streptomycin-resistant gene is provided. aph(3) streptomycin resistance gene aph(3) The nucleotide sequence is shown in SEQ ID NO.1.

[0006] Furthermore, the anti-streptomycin gene aph(3) Originating from Tomato Canker Bacterium Clavibacter michiganensis The plasmid pCM3 of strain TX-0702; said plasmid pCM3 includes elements associated with horizontal gene transfer. Furthermore, elements associated with horizontal gene transfer include transposases, integrases, and conjugation transfer proteins.

[0007] This invention provides the above-mentioned streptomycin resistance gene aph(3)APH(3) has the amino acid sequence shown as SEQ ID NO. 2.

[0008] Further, D188, N193 and D208 of the encoded protein APH(3) are key amino acid sites necessary for catalytic activity.

[0009] The application provides the above-mentioned streptomycin-resistant gene aph(3) In the application of resistance bacteria screening or plant pathogenic bacteria resistance monitoring.

[0010] The application provides the above-mentioned streptomycin-resistant gene aph(3) The application of the encoded protein APH(3) in phosphorylated streptomycin.

[0011] The application also provides a method for phosphorylating streptomycin, which uses the above-mentioned encoded protein APH(3) to phosphorylate streptomycin to generate monophosphoryl streptomycin in a reaction system in the presence of ATP.

[0012] The application has the following beneficial effects: the application finds a new streptomycin-resistant gene Clavibacter michiganensis derived from tomato canker pathogen (Pseudomonas syringae pv. tomato DC3000) aph(3) and its role in antibiotic inactivation. The gene is located on a newly discovered plasmid pCM3 of the tomato canker pathogen, and encodes a protein APH(3) belonging to the aminoglycoside antibiotic phosphotransferase family. The function of the gene is verified through gene knockout, functional complementation and heterologous expression, and mass spectrometry analysis confirms the catalytic product, which proves that APH(3) can catalyze the phosphorylation reaction of streptomycin molecule (C 21 H 39 N7O 12 ) to generate monophosphoryl streptomycin (C 21 H 40 N7O 15 P), thereby losing the inhibitory activity on bacteria, and the strain carrying the gene has significant resistance to streptomycin. It is found that D188, N193 and D208 of the APH(3) protein are key catalytic residues. The streptomycin-resistant gene of the application can be widely used in the fields of pathogenic bacteria resistance mechanism research, resistant strain screening and molecular marker selection, and has important scientific research and application value. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 is a pCM3 plasmid map; Figure 2 is a pMarA-Chl plasmid map; Figure 3 is aph(3) gene positioning map; Figure 4 Among different strains of tomato canker pathogen aph(3) Expression level, MIC, and resistance phenotype; Figure 5 The inhibition zones of streptomycin before and after APH(3) enzyme treatment against different tomato canker pathogens are shown. Figure 6 LC-MS spectra of streptomycin and its phosphorylated products; Figure 7 The results show the phosphorylation ability of streptomycin after mutation at the key site of APH(3); Figure A is a diagram of the APH(3) mutation site; Figure B is a diagram of the inhibition zone of the mutated tomato canker pathogen. Detailed Implementation

[0014] The examples given below are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, conditions in the examples are performed under standard conditions or as recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0015] Example 1: aph(3) Gene identification and functional verification anti-streptomycin gene aph(3) Originating from Tomato Canker Bacterium Clavibacter michiganensis The plasmid pCM3 of strain TX-0702 (see plasmid map) Figure 1 ). Clavibacter michiganensis The TX-0702 strain is deposited at the Seed Health Center of China Agricultural University, with the accession number TX-0702.

[0016] Bacillus transposon plasmid pMarA (Baosai Biotechnology) carries a pUC-type replicon, in C. michiganensis It cannot replicate autonomously and is a suicide plasmid. Theoretically, pMarA can only... C. michiganensis A transposition occurs, resulting in the disruption of a single gene. The original transposon fragment carries the kanamycin resistance gene; for the convenience of subsequent experiments, a gene suitable for [specific gene selection] is selected. C. michiganensis The selected chloramphenicol resistance fragment replaced kanamycin. The pMarA plasmid backbone, excluding kanamycin, was amplified by PCR. cmx The resistant fragment was ligated into a circular shape using a seamless cloning method to form a recombinant vector. The modified transposon plasmid was named pMarA-Chl (plasmid map shown). Figure 2 ).

[0017] pMarA-Chl plasmid was introduced via electroporation. Clavibacter michiganensisTX-0702 competent cells were used. Transformed cells were further screened on LBA plates containing 10 μg / mL chloramphenicol and 50 μg / mL streptomycin, yielding 30 chloramphenicol-resistant but streptomycin-sensitive mutants (i.e., resistance-loss mutants). Genomic DNA was extracted from the streptomycin-sensitive mutants and digested with restriction endonucleases XhoI, SalI, and NgoMIV to obtain... aph(3) The Suk sequence of the gene. This sequence contains an 810 bp open reading frame encoding a class of phosphotransferases belonging to the APH(3'') family (see Suk sequence). Figure 3 ).

[0018] Using TX-0702 as the wild type, knockout was achieved through homologous recombination. aph(3) Gene (nucleotide sequence as shown in SEQ ID NO. 1). Compared with wild type (MIC = 128 μg / mL), the knockout mutant Δ aph(3) The streptomycin MIC was reduced to 4 μg / mL; the complete aph(3) The gene was cloned into the expression vector pHN216 (vector construction reference: Laine, MJ, Nakhei, H., Dreier, J., Lehtilä, K., Meletzus, D., Eichenlaub, R., and Metzler, MC (1996). Stable transformation of the gram-positive phytopathogenic bacterium Clavibacter michiganensis subsp. sepedonicus (with several cloning vectors. Appl. Environ. Microbiol. 62, 1500-1506.), electrical shock converts back to Δ aph(3) The streptomycin MIC in the transformant was restored to 128 μg / mL; overexpression in wild-type TX-0702 was also observed. aph(3) The MIC was increased to 256 μg / mL; further... aph(3) Introducing streptomycin-sensitive strains C. michiganensis The overexpression strain BT-0505+ was obtained from BT-0505 (original MIC = 4 μg / mL). aph(3) Its MIC increased to 32 μg / mL (see Figure 4 The above results confirm that... aph(3) Genes independently mediate streptomycin resistance.

[0019] Example 2: Verification of phosphorylation reaction Will aph(3) Gene cloning to a gene with a 6×His tagpEASY -Blunt E1 expression vector (purchased from Beijing TransGen Biotech), transformation Escherichia coli BL21(DE3) was used to induce and purify APH(3) protein. The reaction system consisted of 40 mM Tris-HCl (pH 7.5), 40 mM KCl, 10 mM MgCl2, 4 mM ATP, and 1 mg of purified APH(3) protein. Then, 1 mg of streptomycin was added and the mixture was incubated at 37°C for 2 h. Subsequently, 5 μL of the reaction product was added to filter paper and placed on a filter paper inoculated with... C. michiganensis (1×10) 6 LBA plates (CFU / mL). Results are as follows: Figure 5 As shown, treatment with APH(3) protein completely eliminated the effect of streptomycin on sensitive strains Δ aph(3) The antibacterial activity of BT-0505.

[0020] Using the above reaction system, the products of streptomycin before and after treatment with APH(3) protein were detected by LC-MS (liquid chromatography-mass spectrometry), with the untreated group serving as a blank control. Cation mode was used. The chromatographic column was a ThermoScientific™ Hypersil GOLD™ HILIC (2.1 mm × 150 mm); mobile phase A was water, and mobile phase B was acetonitrile; gradient elution: 0-5 min, 5% A; 5-15 min, 5% A-65% A; 15-20 min, 65% A-90% A; 20-25 min, 90% A; flow rate was 0.2 mL / min; injection volume was 15 μL; ion source was ESI; nebulizer was 30 psi; high-purity nitrogen was used as the spray dry gas at a flow rate of 11 L / min; temperature was 325℃; and capillary voltage was 4000 V. Results are as follows: Figure 6 As shown, streptomycin molecule (C 21 H 39 N7O 12 The hydrogenation peak of streptomycin monophosphate (MW=581.57 Da) was 582.27 m / z; after treatment with APH(3) protein, a peak of 662.24 m / z was detected, which is consistent with the theoretical value of streptomycin monophosphate (C). 21 H 40 N7O 15 P, MW = 661.55 Da) matching, confirming that APH(3) catalyzes the transfer of monophosphate groups.

[0021] Example 3: Analysis of key site mutations By multiple sequence alignment of APH(3) protein with homologous proteins of Actinobacteria, it is presumed that D188, N193 and D208 are catalytic key sites, and at the same time, T148, a unique non-conserved site, is selected as a negative control. C. michiganensis The above site is mutated to alanine (Ala). According to the method introduced in Example 2, the recombinant protein is expressed and purified, and the in vitro phosphorylation reaction is carried out. The results show that the mutation of any one of D188, N193 and D208 to Ala results in complete loss of phosphorylation function, while the mutation of T148 to Ala has no effect, indicating that the above three sites are the catalytic core of APH(3) protein (see Figure 7 ).

[0022] In the present application aph(3) The nucleotide sequence of the gene is as follows: ATGCGCAGTCACACTCGCTCACTCGTCCAGCGACTGGAACGCGCCGCTGCCGGATGGTCGAGAGTCACCGCTGGCGACTCTGACGCGCTTGTGCTTCGCAGCGCGGACGGCGATCGGTACGCGAAGGTCGTGGATGGCAGGGGAGTCGAGGATCTGCAGGCTGAGCGAGATCGCATCGAATGGCTAGCGTCCACAAGCATTCCCGGCGCGTCCGTACTTGACTGGCACGAGGAACACGATGGCGCATTCTTGGTGACTTCCTCGGTCGCGGGGGTGCCAGCGGACGTGCTCGATGCAGCGGCTCTCACACGAGCGTGGCCGTTCATAACTGCGCAGGTGCGCGAACTGCACGCACTACCGGTTGAAGACTGCCCGTTCGAGTTCCGTGTGAACGAGAGGATGCAGGCGGCCCGCAAAGTCGTCGGGGGCGGGCGGGTCCATACCGAGTTCCTGCCCCTCGAAGTAGTGCATGTAGCGCCGAACGAGATCTTCGTGGAACTCGAGCGGCAGGCGTCAGCGCGTGAGGCGCAGGAAGCAGCCGGAATGGCGGTCTGTCACGGTGACCTGTGCTTGCCGAACATCCTGATCGACCCCGCGACGTCACGCGTGACTGGCCTGATCGACGTTGGCCGACTGGGACGAGCCGACGCGCACACCGACCTTGCACTGCTGTTCGCGACAGCGCGCGAGACGTGGGCCGATTCCAAGCGAGCAGCTGTCGCAGAAGCTGCGTTCCGGCGGACCTACGGCGGAACCATCGACGATGAACGACTAAGGTTCTACCTCTGGCTCGACCCACTCACATGGTAG (SEQ ID NO. 1); The amino acid sequence of the APH (3) protein in the present application is as follows: MRSHTRSLVQRLERAAAGWSRVTAGDSDALVLRSADGDRYAKVVDGRGVEDLQAERDRIEWLASTSIPGASVLDWHEEHDGAFLVTSSVAGVPADVLDAAALTRAWPFITAQVRELHALPVEDCPFEFRVNERMQAARKVVGGGRVHTEFLPLEVVHVAPNEIFVELERQASAREAQEAAGMAVCHGDLCLPNILIDPATSRVTGLIDVGRLGRADAHTDLALLFATARETWADSKRAAVAEAAFRRTYGGTIDDERLRFYLWLDPLTW (SEQ ID NO. 2).

[0023] The above description is merely that of the preferred embodiments of the application, and is not intended to limit the application. Any modification, equivalent replacements, improvements, and the like made within the spirit and principle of the application should be included in the protection scope of the application.

Claims

1. A streptomycin resistance gene aph(3) Its characteristics are, The anti-streptomycin gene aph(3) The nucleotide sequence is shown in SEQ ID NO.

1.

2. The streptomycin resistance gene according to claim 1 aph(3) Its characteristics are, The anti-streptomycin gene aph(3) Originating from Tomato Canker Bacterium Clavibacter michiganensis The plasmid pCM3 of strain TX-0702; said plasmid pCM3 includes elements associated with horizontal gene transfer.

3. The streptomycin resistance gene according to claim 2 aph(3) Its characteristics are, The elements associated with horizontal gene transfer include transposases, integrases, and conjugation transfer proteins.

4. The streptomycin resistance gene according to any one of claims 1-3 aph(3) The encoded protein APH(3) is characterized by, The amino acid sequence of the APH(3) is shown in SEQ ID NO.

2.

5. The streptomycin resistance gene according to claim 4 aph(3) The encoded protein APH(3) is characterized by, The D188, N193, and D208 sites of the protein APH(3) are essential amino acid sites for catalytic activity.

6. The streptomycin resistance gene according to any one of claims 1-3 aph(3) Applications in screening for resistant bacteria or monitoring resistance to plant pathogens.

7. The streptomycin resistance gene as described in claim 4 or 5 aph(3) The application of the protein APH(3) encoded by streptomycin in the phosphorylation of streptomycin monophosphate.

8. A method for phosphorylating streptomycin to generate streptomycin monophosphate, characterized in that, Using the protein APH(3) encoded by claim 4 or 5, streptomycin is phosphorylated to generate streptomycin monophosphate in a reaction system in the presence of ATP.

Images