Application of trmt61a as a target in preparation of aml treatment drugs

By using the TRMT61A inhibitor Thiram and its combination therapy, the PI3K/AKT/mTOR signaling pathway is regulated, overcoming the limitations of chemotherapy and targeted inhibitors in AML treatment. This significantly inhibits AML cell proliferation and delays disease progression, demonstrating significant clinical application potential.

CN121059809BActive Publication Date: 2026-03-20HARBIN MEDICAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511632733.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-10
Publication Date
2026-03-20
Estimated Expiration
2045-11-10

AI Technical Summary

Technical Problem

Current chemotherapy and targeted inhibitor therapies for AML have limited clinical applicability and some patients develop drug resistance. The mechanism of action of TRMT61A in AML is unclear, and new treatment strategies need to be developed.

Method used

By utilizing the TRMT61A inhibitor small molecule compound Thiram and its combination therapy strategies, including the combined use with the mTOR inhibitor Rapamycin, the KDM1A inhibitor ORY1001, and the chemotherapeutic drug Ara-C, the PI3K/AKT/mTOR signaling pathway is regulated by inhibiting TRMT61A protein expression, thereby promoting apoptosis and differentiation of AML cells.

Benefits of technology

It significantly inhibits AML cell proliferation, promotes cell apoptosis and differentiation, delays leukemia progression, reduces mouse mortality, and enhances the efficacy of existing treatment regimens, showing broad prospects for clinical application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121059809B_ABST
    Figure CN121059809B_ABST
Patent Text Reader

Abstract

The present application relates to the application of TRMT61A as a target point in the preparation of AML treatment drugs, and belongs to the technical field of biological medicine. In order to solve the problem of the clinical applicability limitation of current chemotherapy and targeted inhibitor treatment in AML treatment, the present application provides the application of TRMT61A as a target point in the preparation of AML treatment drugs, wherein the drug comprises a TRMT61A inhibitor Thiram or a targeted sgRNA. Knocking out TRMT61A can significantly inhibit AML cell proliferation, promote apoptosis differentiation and block the cell cycle. Thiram has an inhibitory effect on AML cell growth and patient-derived leukemia cell viability, and shows a synergistic anti-leukemia effect when combined with Rapamycin, ORY-1001 or the clinical chemotherapy drug Ara-C, can significantly inhibit leukemia cell infiltration in a mouse model and prolong the survival period. The present application provides a new strategy for AML treatment.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to application of TRMT61A as a target in preparation of an AML treatment drug. BACKGROUND

[0002] Acute myeloid leukemia (AML) is an aggressive hematological malignancy characterized by the abnormal proliferation of undifferentiated myeloid cells in the bone marrow, blood, and other tissues. In the current clinical diagnosis and treatment scheme, the "7+3" chemotherapy regimen (i.e., continuous injection of cytarabine for 7 days, followed by combination with anthracycline drugs for 3 days) is the main treatment strategy for AML patients. However, only about 60%~80% of patients are sensitive to standard chemotherapy, and patients over 60 years old often have poor tolerance and are difficult to accept high-intensity chemotherapy.

[0003] Targeted inhibitors targeting the FLT3 signaling pathway, IDH1 / 2 metabolic enzymes, and BCL-2 apoptosis proteins can significantly improve the efficacy of AML treatment. However, due to the high incidence of low-risk cytogenetics or genetic mutations, such targeted therapy is only suitable for a part of the population, and drug resistance problems are prone to occur. Therefore, current research is focusing on the development of epigenetic targeted drugs to overcome the limitations of existing therapies and expand treatment options.

[0004] tRNA methyltransferase 61A (TRMT61A) is a key enzyme that catalyzes the modification of tRNA at position 58 N1-methyladenosine (m1A), and maintains the stability and translation function of tRNA by forming a complex with TRMT6. The TRMT61A gene is located in the region of 103529196-103537073 of the human chromosome 14 GRCh38 genome version, and its abnormal expression shows a significant carcinogenic effect in various malignant tumors. In the tumor tissues of patients with liver cancer and head and neck squamous cell carcinoma, the expression level of TRMT61A is significantly higher than that in normal tissues. The increase in expression level is closely related to the diffusion, migration ability, and strengthening of invasiveness of tumor cells. In bladder cancer, the increase in m1A modification level is consistent with the dysregulation of unfolded protein response (UPR) related genes. Molecular mechanism studies have shown that the TRMT6 / TRMT61A complex promotes PPARδ protein translation by increasing m1A methylation in tRNA, thereby triggering cholesterol synthesis to activate Hedgehog signaling, ultimately driving the self-renewal of liver cancer stem cells and tumorigenesis. However, the mechanism of action of TRMT61A in AML has not been reported. SUMMARY

[0005] In order to solve the problem of the clinical applicability limitation of chemotherapy and targeted inhibitor treatment in current AML treatment, the application provides an application of TRMT61A as a target in preparation of an AML treatment drug.

[0006] The technical scheme of the application:

[0007] The application of the TRMT61A inhibitor in preparation of an acute myeloid leukemia treatment drug.

[0008] Further, the TRMT61A inhibitor is a small molecule compound or an artificially designed small nucleic acid gene silencing preparation.

[0009] Further, the TRMT61A inhibitor is a small molecule compound Thiram, and the Thiram is a dithiocarbamate compound with a molecular formula of C6H 12 N2S4.

[0010] Further, the content of the Thiram in the acute myeloid leukemia treatment drug is 10-150 nM.

[0011] Further, the acute myeloid leukemia treatment drug is a combined application of the small molecule compound Thiram and an mTOR inhibitor Rapamycin.

[0012] Further, the acute myeloid leukemia treatment drug is a combined application of the small molecule compound Thiram and a KDM1A inhibitor ORY1001.

[0013] Further, the acute myeloid leukemia treatment drug is a combined application of the small molecule compound Thiram and Ara-C.

[0014] Further, the artificially designed small nucleic acid gene silencing preparation is sgRNA, and the sequence of the sgRNA is shown in SEQ ID No: 1 or SEQ ID No: 2.

[0015] Further, the acute myeloid leukemia treatment drug is a combined application of the small nucleic acid gene silencing preparation sgRNA and Ara-C.

[0016] The beneficial effects of the application:

[0017] The application knocks out TRMT61A in acute myeloid leukemia cells, significantly inhibits tumor cell proliferation, promotes cell apoptosis and differentiation, and blocks cell cycle progression. TRMT61A deletion leads to down-regulation of key protein expression in the PI3K / AKT / mTOR signaling pathway, thereby relieving the inhibition of the pathway on apoptosis, restoring the function of myeloid differentiation-related transcription factors, and inhibiting cell cycle progression by blocking mTORC1-dependent protein synthesis.

[0018] The present application discloses a new use of TRMT61A inhibitor Thiram in treating acute myeloid leukemia. Through in vitro AML cell experiments and patient primary leukemia cell verification, Thiram can effectively reduce the growth and proliferation ability of AML cells, and significantly weaken the viability of leukemia cells in patients. Through animal model experiments, it is proved that Thiram can inhibit the migration and colonization of leukemia cells to liver and spleen, effectively delay the progression of leukemia, reduce the mortality of mice, and has a synergistic effect with the first-line chemotherapy drug Ara-C in inhibiting the progression of leukemia, and has high clinical transformation value.

[0019] tRNA methyltransferase TRMT61A promotes the expression of core pathway proteins such as PI3K / AKT / mTOR, and inhibiting the expression of TRMT61A protein shows a broad-spectrum inhibitory effect on AML. PI3K / AKT / mTOR pathway is generally abnormally activated in AML, and TRMT61A inhibitor regulates this pathway through upstream, which can avoid the drug resistance problem of direct inhibitors. Epigenetic drugs are often synergistic with chemotherapy or other targeted drugs, and the combined effect of Thiram with mTOR inhibitor Rapamycin or KDM1A inhibitor ORY1001 on AML cells is significantly synergistic, which improves the efficacy of existing AML treatment programs and has broad clinical application prospects. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 The survival rate comparison chart of the high expression group and the low expression group of patients detected by two probes in Example 1, A is 221907_at probe, and B is 52741_at probe;

[0021] Figure 2 The cell proliferation count result comparison chart of the control group and the TRMT61A knockout group in Example 2;

[0022] Figure 3 The colony formation comparison chart of the control group and the TRMT61A knockout group in Example 2, A is the colony formation photo, and B is the colony formation colony number comparison chart;

[0023] Figure 4 The CD11b positive cell proportion comparison chart of the control group and the TRMT61A knockout group in Example 2;

[0024] Figure 5 The cell apoptosis proportion comparison chart of the control group and the TRMT61A knockout group in Example 2;

[0025] Figure 6 The PI3K / AKT / mTOR pathway protein expression comparison chart of the control group and the TRMT61A knockout group in Example 2;

[0026] Figure 7 Cell viability of leukemia cells in each group after treatment with different concentrations of Thiram in Example 3;

[0027] Figure 8 Cell viability of leukemia cells in bone marrow of AML patients in each group after treatment with different concentrations of Thiram in Example 3;

[0028] Figure 9 Cell viability after treatment with TRMT61A knockout combined with chemotherapy drug cytarabine in Example 4;

[0029] Figure 10 ZIP synergistic effect score of TRMT61A inhibitor Thiram combined with mTOR inhibitor Rapamycin in Example 5;

[0030] Figure 11 ZIP synergistic effect score of TRMT61A inhibitor Thiram combined with KDM1A inhibitor ORY1001 in Example 5;

[0031] Figure 12 Comparison chart of spleen tissue and spleen weight percentage of control group, Thiram single-drug group, Ara-C single-drug group and Thiram combined with Ara-C administration group in Example 6, A is a photo of spleen tissue, B is spleen weight percentage;

[0032] Figure 13 Comparison chart of AML cell percentage in total cell number in bone marrow of control group, Thiram single-drug group, Ara-C single-drug group and Thiram combined with Ara-C administration group in Example 6, A is a flow chart, B is AML cell percentage in total cell number in flow experiment results;

[0033] Figure 14 Comparison chart of survival time of control group, Thiram single-drug group, Ara-C single-drug group and Thiram combined with Ara-C administration group in Example 6. DETAILED DESCRIPTION

[0034] The technical solutions of the present application are further described below in conjunction with examples, but are not limited thereto. Any modification or equivalent replacement to the technical solutions of the present application without departing from the spirit and scope of the technical solutions shall be covered in the protection scope of the present application. The process equipment or device not specifically mentioned in the following examples is the conventional equipment or device in the art. If not specifically mentioned, the raw materials used in the examples of the present application are commercially available. If not specifically mentioned, the technical means used in the examples of the present application are conventional means known to those skilled in the art.

[0035] Example 1

[0036] This example analyzes the correlation between the expression level of TRMT61A and the survival time of patients with acute myeloid leukemia in humans using the Kaplan-Meier public database.

[0037] This example detects the expression amount of the TRMT61A gene at different sites using two different oligonucleotide probes 221907_at and 52741_at respectively, and then divides the patients into high expression and low expression groups according to the expression amount of the probes, and compares the survival rates of patients in different groups. A P value less than 0.05 proves that there is a correlation between the expression of the gene and the survival rate of the patients.

[0038] As Figure 1 As shown in the survival rate data comparison of the 221907_at probe group in A, the survival rate of the TRMT61A low expression group is significantly improved compared with the TRMT61A high expression group, and the corresponding hazard ratio (HR) is 1.54 (95% confidence interval: 1.15-2.08), and P=0.0037, indicating that the survival time of the TRMT61A high expression group is significantly shortened.

[0039] As Figure 1 As shown in the survival rate data comparison of the 52741_at probe group in B, the survival probability of the TRMT61A low expression group is also significantly higher than that of the high expression group, and the hazard ratio (HR) is 1.62 (95% confidence interval: 1-2.62), P=0.046.

[0040] In summary, compared with the TRMT61A low expression group (blue curve), the cumulative survival rates of the patients in the high expression group (orange curve) at 50, 100, 150 and 200 months are all significantly reduced (P<0.05), further confirming that the high expression of TRMT61A is closely related to the poor prognosis of AML patients, which is manifested as a significantly shortened survival time, suggesting that it may become a prognostic evaluation and potential therapeutic target.

[0041] Example 2

[0042] This example constructs a TRMT61A knockout AML stable cell model by CRISPR / Cas9 KO technology and investigates the cell proliferation, apoptosis, cell cycle and cell differentiation of the cell model.

[0043] This example designs sgRNA sequences according to the DNA sequence of the TRMT61A gene in the NCBI database, which are:

[0044] The sg61A#1 is shown as SEQ ID No: 1: ATACGAGGAGCTGATCAAGG;

[0045] sg61A#2: ACTGGGCCATGGTGCAATGG as shown in SEQ ID No: 2.

[0046] In this embodiment, two sgRNA sequences were cloned into the lentivirus vector pLenti-U6-sgRNA-SFFV-Cas9-2A-pPuro plasmid, respectively, to obtain a plasmid for knocking out the target gene TRMT61A. The work of specific molecular construction was completed by Shanghai Aibimeng Biotechnology Co., Ltd.

[0047] The lentivirus packaging technology was used to package the lentivirus containing TRMT61A sgRNA in 293T cells. The human acute myeloid leukemia cell line-Kasumi-1 cells were cultured in 1640 medium containing 10% fetal bovine serum to the logarithmic growth phase. The Kasumi-1 cells were infected with the lentivirus medium mixed with the virus containing 2 μg of Polybrene (polybrene) per milliliter of culture medium. The surviving cells were screened using 1 μg / ml puromycin antibiotic 10% FBS 1640 medium, and the TRMT61A knockout stable cell line sg61A#1 and sg61A#2 was obtained. In the same way, the Kasumi-1 cells were infected with the empty control lentivirus without sgRNA sequence, and the empty control sgCtrl was obtained.

[0048] I. Cell proliferation experiment:

[0049] The TRMT61A knockout Kasumi-1 cells sg61A#1, sg61A#2 and the empty control group sgCtrl were collected and adjusted to 1 × 10 5 cells / well were inoculated into a 6-well plate, 3 replicate wells were set for each group, and the cells were cultured in a cell incubator. Every 2 days, the cells were counted after staining with trypan blue, and a total of 10 days.

[0050] The results are shown in Figure 2 Compared with the control group sgCtrl, the cell proliferation ability of the knockout groups sg61A#1 and sg61A#2 was significantly decreased.

[0051] II. Cell cloning experiment:

[0052] Kasumi-1 cells sg61A#1, sg61A#2 and empty control group sgCtrl after TRMT61A knockout, single cell suspension was inoculated in 6-hole culture plate at a density of 1000 / hole, 3 parallel holes were set for each group; placed in 37℃, 5% CO2 incubator for continuous culture for 8-14 days, during which fresh culture medium was replaced every 3 days; after the culture was terminated, the culture medium was discarded, 70% ethanol was fixed at room temperature for 15 minutes, and 0.5% crystal violet solution was stained for 15 minutes; the colony formation rate was calculated by counting the colonies containing ≥50 cells. All experiments were repeated three times.

[0053] Results as shown in Figure 3 Compared with the control group sgCtrl, the clone formation ability of the knockout group sg61A#1 and sg61A#2 was significantly decreased, and the self-renewal ability of the cells was inhibited.

[0054] Three, cell differentiation experiment:

[0055] Kasumi-1 cells sg61A#1, sg61A#2 and empty control group sgCtrl after TRMT61A knockout, collect cells: discard supernatant, add 1ml PBS and wash once, discard supernatant, cell suspension is transferred to a centrifuge tube, centrifuged at 1500rpm for 5min to collect cells. Add 3ml 4℃ pre-cooled PBS to resuspend the cells, centrifuge at 1500rpm for 5min, discard the supernatant. Shake the precipitate evenly. After counting, 500,000 / hole were divided and centrifuged at 400g for 5 minutes, and the supernatant was discarded. 100 microliters containing 2.5 microliters CD11b + antibody dilution buffer, incubate on ice for 30 minutes, avoid light. 400g centrifugation for 5 minutes, discard the supernatant, resuspend the cells with pre-cooled PBS 500 microliters / sample, and measure on the machine.

[0056] Results as shown in Figure 4 Compared with the control group sgCtrl, the proportion of CD11b positive cells (myeloid-derived immune cells) of the knockout group sg61A#1 and sg61A#2 was significantly increased, suggesting that the differentiation ability of AML cells after TRMT61A knockout was enhanced.

[0057] Four, apoptosis experiment:

[0058] TRMT61A knockout Kasumi-1 cells sg61A#1, sg61A#2 and empty control group sgCtrl, respectively, wash the cells with pre-cooled PBS and discard the supernatant, take 500,000 resuspended cells, centrifuge at 1000r for 5min, discard the supernatant. Use apoptosis detection kit for detection. The fluorescence signals of Annexin V-FITC and PI-FE were measured by flow cytometry, and the data were analyzed using FlowJo software.

[0059] Results as shown in Figure 5 Compared with the control group sgCtrl, the knockout group sg61A#1 and sg61A#2 had significantly increased apoptotic cells, and the proportion of early and late apoptotic cells was higher than that of the control group.

[0060] V. PI3K / AKT / mTOR pathway protein expression

[0061] PI3K / AKT / mTOR pathway plays a key role in regulating cell growth, proliferation, survival, metabolism, and protein synthesis, and abnormal activation of this pathway is closely related to the occurrence and development of cancer. In this embodiment, Western Blotting (Western Blotting) experiment was used to detect the expression of key proteins P13K (phosphatidylinositol 3-kinase), AKT (protein kinase B) and mTOR (mammalian target of rapamycin) in PI3K / AKT / mTOR pathway of Kasumi-1 cells and control cells after TRMT61A knockout, and the effect of targeting inhibition of TRMT61A expression on PI3K / AKT / mTOR pathway protein expression was investigated.

[0062] The results of WB experiment are shown in Figure 6 Compared with the control group sgCtrl, the expression of PI3K / AKT / mTOR pathway proteins in the knockout group cells was down-regulated.

[0063] Based on the above experimental data analysis, it can be known that inhibiting the expression of TRMT61A in acute myeloid leukemia cells can down-regulate the expression of PI3K / AKT / mTOR pathway proteins, inhibit the differentiation of AML tumor cells, increase the apoptosis of AML tumor cells, and reduce the proliferation rate and self-renewal ability of AML tumor cells.

[0064] Example 3

[0065] This embodiment provides a therapeutic drug for acute myeloid leukemia, which contains a TRMT61A inhibitor, a small molecule compound Thiram.

[0066] Thiram (Thiram) is a dithiocarbamate compound with a molecular formula of C6H 12 N2S4, CAS No. 137-26-8; widely used as an agricultural fungicide and a vulcanization accelerator in the rubber industry. As a fungicide, it can be used for wheat, corn, cotton seed treatment to prevent and control soil and seed-borne fungal diseases (such as damping-off, anthracnose). The Thiram used in this embodiment is purchased from Aladdin brand with the item number T111114-250mg.

[0067] Example 1 The present example provides the cell viability detection results of human acute myeloid leukemia cell lines SHI cells, SKNO-1 cells, Kasumi-1 cells and OCI-AML2 cells after treatment with different concentrations of Thiram. The specific detection method is as follows:

[0068] Thiram powder was dissolved in organic solvent DMSO and diluted with phosphate buffer for use. Thiram with concentrations of 10 nM, 20 nM, 50 nM, 100 nM and 150 nM was set up, and SHI cells, SKNO-1 cells, Kasumi-1 cells and OCI-AML2 cells were treated with the drug, respectively, with a cell number of 1×10 5 The cell culture solution with the corresponding concentration of drug was replaced with fresh one every day.

[0069] As shown in the results, Figure 7 The cell viability of Kasumi-1 cells, SKNO-1 cells, OCI-AML2 cells and SHI cells decreased with the increase of Thiram concentration under Thiram treatment.

[0070] Example 2 The present example provides the cell viability detection results of AML patient bone marrow cells after treatment with different concentrations of Thiram. The specific detection method is as follows:

[0071] Thiram powder was dissolved in organic solvent DMSO and diluted with phosphate buffer for use. Thiram with concentrations of 10 nM, 20 nM, 50 nM, 100 nM and 200 nM was set up, and AML patient bone marrow cells AML#01 and AML#04 with a cell concentration of 5000 cells / well were treated with the drug, respectively, and the cell culture solution was replaced every day.

[0072] As shown in the results, Figure 8 AML patient bone marrow cells AML#01 and AML#04 showed a dose-dependent response to Thiram, and showed a significant decrease in viability under high-concentration inhibitor treatment, thereby proving that Thiram can inhibit the cell viability of leukemia cells in AML patients.

[0073] Example 4

[0074] The present example provides the combined effect of TRMT61A knockout combined with the clinical chemotherapy drug Ara-C (Ara-C).

[0075] Kasumi-1 cell stable cell lines sg61A#1 and sg61A#2 of TRMT61A knockout and empty control sgCtrl of Kasumi-1 cell were obtained by the method of Example 2. The sg61A-1 cells, sg61A-2 cells and sgCtrl cells were treated with AML chemotherapy drug Ara-C at concentrations of 15.625 nM, 31.25 nM, 62.5 nM, 125 nM, 250 nM, 500 nM, 1000 nM, 5000 cells per well (96-well plate), and the cell culture medium with corresponding drug concentration was replaced every 24 hours, and cell counting was performed every two days.

[0076] The results are shown in Figure 9 TRMT61A knockout combined with Ara-C group has the lowest leukemia cell viability.

[0077] Example 5

[0078] This example provides the evaluation results of the synergistic effect of TRMT61A inhibitor Thiram and currently known pathway inhibitors in leukemia.

[0079] I. TRMT61A inhibitor Thiram combined with mTOR inhibitor Rapamycin

[0080] To evaluate the synergistic effect of Thiram (5 nM, 10 nM, 25 nM, 50 nM) and currently known pathway inhibitors Rapamycin (1 nM, 2 nM, 5 nM concentration) in leukemia, Kasumi-1 cells of acute myeloid leukemia (5000 cells per well, 96-well plate) were treated with combined drugs at different drug concentrations, and CTG cell viability was detected after 72 hours of treatment.

[0081] The results are shown in Figure 10 After calculating the ZIP synergistic effect score chart, the reference index of combined drug efficacy was obtained, and the calculation result was 13.2 (synergistic score greater than 10 indicates that the combination of two drugs has synergistic effect), which indicates that the combination of Thiram and Rapamycin has a significant synergistic inhibitory effect on leukemia cells.

[0082] II. TRMT61A inhibitor Thiram combined with KDM1A inhibitor ORY1001

[0083] To evaluate the synergistic effect of Thiram (10 nM, 20 nM, 30 nM, 40 nM, 50 nM) and the epigenetic drug ORY1001 (0.5 μmol, 1 μmol, 2 μmol, 4 μmol, 8 μmol) in the phase II clinical trial, acute myeloid leukemia Kasumi-1 cells (5000 cells / well, 96-well plate) were treated with the combined drugs at different concentrations of leukemia cells, and CTG cell viability was measured 96 hours after treatment.

[0084] The results are as follows Figure 11 As shown, the ZIP synergy score chart was calculated to obtain the reference index for the efficacy of the combined drug therapy. The calculated result was 39.86 (a synergy score greater than 10 indicates that the two drugs have a synergistic effect), suggesting that the combined action of Thiram and ORY1001 has a significant synergistic inhibitory effect on leukemia cells.

[0085] Example 6

[0086] This embodiment provides information on the spleen and survival of mice after treatment with the TRMT61A inhibitor Thiram in an MLL-AF9 mouse AML leukemia model. The embodiment provides spleen morphology and animal survival statistics, offering crucial evidence for the in vivo antileukemic activity and safety of Thiram from both morphological validation and overall survival benefit quantification dimensions.

[0087] I. Preparation and Adaptation of Mice

[0088] Six- to eight-week-old female C57BL / 6 mice were housed in a barrier environment with a temperature of 22-25°C, humidity of 40-60%, and a 12-hour light-dark cycle. The mice were allowed free access to sterilized feed and water. The mice were allowed to adapt for more than three days. The mice's mental state, activity level, and weight were observed daily, and abnormal individuals were excluded.

[0089] II. Construction of an MLL-AF9 leukemia model

[0090] (1) Retroviral packaging (triple plasmid system + 293T cells) and hematopoietic stem cell transfection

[0091] 24 hours before the experiment, 293T cells were passaged into 10cm culture dishes and cultured until the confluence reached 70-80% at transfection. The culture medium and PBS were pre-warmed for 30 min, and the liposome reagent was warmed to room temperature for 15 min. For virus packaging, the transfection complex was prepared first: pMIG-FLAG-MLL-AF9 plasmid (Addgene plasmid #71443; RRID: Addgene_71443) + PUMVC plasmid + VSV-G plasmid were mixed with the transfection reagent and allowed to stand.

[0092] 293T cells were replaced with fresh culture medium, and the transfection complex was added to the culture dish, which was incubated at 37°C in a 5% CO2 environment for 8 hours. The culture medium was discarded and fresh complete culture medium was added.

[0093] The culture medium (containing virus particles) was replaced and collected at 24 and 48 hours after transfection. The virus solution was concentrated using an ultrafiltration tube, and the virus titer was measured and used to infect mouse hematopoietic stem cells (HSCs).

[0094] Mouse hematopoietic stem cell (HSC) in vitro culture conditions:

[0095] Opti-MEM containing 20% fetal bovine serum TM Serum-reduced medium; add stem cell culture cytokines. Incubate at 37°C in a 5% CO2 humidified environment, and replace fresh culture medium daily.

[0096] Before infection, prepare mouse hematopoietic stem cells in logarithmic growth phase with a viability of ≥90%, add Polybrene and an appropriate amount of virus solution, centrifuge the culture plate, and incubate at 37°C in a 5% CO2 environment for 24 hours. Replace fresh culture medium after 72 hours. Detect the proportion of GFP-positive cells by flow cytometry and sort them. Keep the GFP-positive cell population and expand it for quality control. Collect MLL-AF9 cells.

[0097] (2) Mouse transplantation

[0098] Observe the state of MLL-AF9 cells 24 hours before the experiment to ensure uniform suspension without obvious aggregation, good refraction, and a viability of ≥90%. When preparing the injection cells, collect the cell suspension in a sterile centrifuge tube, place it in a centrifuge, centrifuge at 1000 rpm at room temperature for 5 minutes, and discard the supernatant. Add 10 mL of pre-warmed PBS, gently resuspend the cells by blowing, centrifuge again at 1000 rpm for 5 minutes, and repeat the washing twice to completely remove residual culture medium components and cell debris. Discard the supernatant from the last centrifugation, add 1 mL of serum-free culture medium or PBS, gently blow to prepare a single cell suspension, and take 20 μL of the suspension for cell counting and viability detection. According to the counting results, adjust the cell concentration to 5×10 5 cells / 100 μL with normal saline or PBS.

[0099] Take the mouse for cell injection, and the injection amount is 1×10 6The tail root of each mouse was gently pinched with the left hand, and the right hand held a syringe, with the needle at an angle of 15-30° with the tail vein. The plunger of the syringe was slowly pushed, and the tail was observed for swelling and fluid leakage. After injection, the puncture site was pressed with a dry cotton ball for 30 seconds to prevent blood leakage. The mouse was returned to the original cage, and the cage number and mouse number were marked. The mouse injected with cells was monitored daily, and the mental state, hair, food intake, water intake, and defecation of the mouse were recorded. The mouse was observed for typical leukemia symptoms such as hunched back, rapid breathing, and enlarged spleen.

[0100] One week after injection, 20 μL of whole blood was taken from the tail vein of the mouse to prepare a blood smear, which was stained with Wright-Giemsa and observed under a microscope for the presence of abnormal leukemia cells. When the mice in the same group showed typical leukemia characteristics, bone marrow or spleen single-cell suspensions were taken, and the proportion of GFP-positive cells in MLL-AF9 leukemia cells was detected by flow cytometry. The experimental protocol was approved by the relevant experimental animal management and welfare ethics committee, and the euthanasia of the mouse conformed to the "3R principle".

[0101] III. Drug intervention and phenotype analysis

[0102] After 7 days of feeding, the drug experiment was performed. The MLL-AF9 mice were divided into a control group, a Thiram single-drug group, an Ara-C single-drug group, and a Thiram and Ara-C combined administration group, with eight mice in each group. The drug administration scheme was as follows: the Thiram single-drug group was administered at a dose of 1.6 mg Thiram / kg body weight, the Ara-C single-drug group was administered at a dose of 50 mg Ara-C / kg body weight, the Thiram and Ara-C combined administration group was administered at a dose of 1.6 mg Thiram / kg body weight and 50 mg Ara-C / kg body weight, and the control group was administered with the same amount of drug solvent DMSO (not more than 1% of the total volume of the drug solution). Each group was administered a total of three times, with two days between each administration.

[0103] Seven days after the first administration, three mice from each group were taken for spleen and body weight measurement. The percentage of spleen weight to total body weight in the control group, the Thiram single-drug group, the Ara-C single-drug group, and the Thiram and Ara-C combined administration group was calculated and statistically analyzed, and the proportion of AML cells in bone marrow cells was also statistically analyzed by flow cytometry. The remaining mice were continuously observed for survival status, and the survival of the mice in each group was recorded and the survival period was statistically analyzed.

[0104] The results are as follows: Figure 12As shown, the control group showed significant pathological enlargement of the spleen tissue; in contrast, the pathological changes were significantly reduced in the Thiram monotherapy group, the Ara-C monotherapy group, and the Thiram and Ara-C combination therapy group, and the degree of splenomegaly was the lowest in the combination therapy group, directly demonstrating that Thiram can effectively inhibit the migration and colonization of leukemia cells to the liver and spleen tissue, has an inhibitory effect on leukemia cell organ infiltration, and can be used in combination with the clinical chemotherapeutic drug Ara-C to synergistically inhibit leukemia progression.

[0105] Figure 13 The results showed that the proportion of leukemia cells in the bone marrow of the control group was as high as 90.9%, the Thiram monotherapy group was 83.4%, the Ara-C monotherapy group was 69.5%, and the proportion of the combined administration group was significantly reduced to 33.4%. This indicates that Thiram can inhibit the bone marrow infiltration of leukemia cells, and exhibits a synergistic effect when used in combination with Ara-C, providing a potential combination drug strategy for clinical use.

[0106] Figure 14 The results showed that the median survival time of the control group was short, while the survival time of the Thiram treatment group was significantly prolonged, indicating that Thiram can significantly prolong the survival time of MLL-AF9 leukemia model mice, and is a strong evidence that Thiram can effectively delay leukemia progression and reduce animal mortality in vivo, which is one of the most promising therapeutic evidence for the transformation application of this compound.

Claims

1. The application of TRMT61A inhibitors in the preparation of drugs for the treatment of acute myeloid leukemia, characterized in that, The TRMT61A inhibitor is a small molecule compound, Thiram, or an artificially designed small nucleic acid gene silencing agent. Thiram is a dithiocarbamate compound with the molecular formula C6H. 12 N2S4, wherein the artificially designed small nucleic acid gene silencing agent is sgRNA, and the sequence of the sgRNA is shown in SEQ ID No:1 or SEQ ID No:

2.

2. The application of the TRMT61A inhibitor according to claim 1 in the preparation of a therapeutic drug for acute myeloid leukemia, characterized in that, The Thiram content in the acute myeloid leukemia treatment drug is 10~150 nM.

3. The application of the TRMT61A inhibitor according to claim 2 in the preparation of a therapeutic drug for acute myeloid leukemia, characterized in that, The treatment for acute myeloid leukemia is a combination of the small molecule compound Thiram and the mTOR inhibitor Rapamycin.

4. The application of the TRMT61A inhibitor according to claim 2 in the preparation of a therapeutic drug for acute myeloid leukemia, characterized in that, The treatment for acute myeloid leukemia is a combination of the small molecule compound Thiram and the KDM1A inhibitor ORY1001.

5. The use of the TRMT61A inhibitor according to claim 2 in the preparation of a therapeutic drug for acute myeloid leukemia, characterized in that, The treatment for acute myeloid leukemia is a combination of the small molecule compound Thiram and Ara-C.

6. The use of the TRMT61A inhibitor according to claim 1 in the preparation of a therapeutic drug for acute myeloid leukemia, characterized in that, The acute myeloid leukemia treatment drug is the combined use of the small nucleic acid gene silencing agent sgRNA and Ara-C.

Citation Information

Patent Citations

  • Application of TRMT6 / TRMT61A inhibitor in liver cancer treatment

    CN112972446A

  • TRMT61A and application of TRMT61A inhibitor tetramethylthiuram disulfide in tumor immunotherapy

    CN120796478A